| Antibodies |
|
| Mouse anti-Flag M2 |
Sigma-Aldrich |
Cat. No. F1804; RRID Ab_262044 |
| Mouse anti-FLAG M2-agarose beads |
Sigma-Aldrich |
Cat. No. A2220; RRID:AB_10063035 |
| Mouse anti-GAPDH |
Cell Signaling Technology |
Cat. No. 97166; RRID:AB_2756824 |
| Mouse anti-PSEN1-NTF |
Bio-Legend |
Cat. No. 823401; RRID:AB_2564868 |
| Mouse anti-Aβ 6E10 |
Bio-Legend |
Cat. No. 803001; RRID:AB_2564653 |
| Rabbit anti-total Aβ |
Cell Signaling Technology |
Cat. No. 8243; RRID:AB_2797642 |
| Rabbit anti-nicastrin |
Novus Biologicals |
Cat. No. NBP2-57365 |
| Rabbit anti-PSEN1 Loop (EP2000Y) |
Abcam |
Cat. No. ab76083; RRID:AB_1310605 |
| Alexa Fluor™ 488-conjugated goat anti-mouse IgG |
ThermoFisher |
Cat. No. A32723; RRID:AB_2633275 |
| Cy3-conjugated goat anti-rabbit IgG |
ThermoFisher |
Cat. No. A10520; RRID:AB_2534029 |
|
| Bacterial and virus strains |
|
|
E. coli BL21 DE3 |
New England Biolabs |
Cat. No. C2530H |
|
| Chemicals, peptides, and recombinant proteins |
|
| FreeStyle™ 293 Expression Medium |
ThermoFisher |
Cat. No. 12338018 |
|
13C glucose |
Cambridge Isotope Laboratories |
Cat. No. CLM-1396 |
|
15NH4Cl |
Cambridge Isotope Laboratories |
Cat. No. NLM-467 |
| Pac1 restriction enzyme |
New England Biolabs |
Cat. No. R0547S |
| Swa1 restriction enzyme |
New England Biolabs |
Cat. No. R0604S |
| BamH1 restriction enzyme |
New England Biolabs |
Cat. No. R01365
|
| NgoM4 restriction enzyme |
New England Biolabs |
Cat. No. R05645
|
| DOPC (1,2-dioleoyl-sn-glycerol-3-phosphocholine) |
Avanti Polar Lipids |
Cat. No. 850375 |
| DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine) |
Avanti Polar Lipids |
Cat. No. 850725 |
| CHAPSO (3-[(3-cholamidopropyl) dimethylammonio]-2-hydroxy-1-propanesulfonate) |
MP Biomedicals |
Cat. No. 190320 |
| Digitonin |
Goldbio |
Cat. No. D-180-5 |
| Transmembrane substrate mimetic inhibitor SB-250 |
In-house |
Ref. 18, cmpd 28 |
| Peptides VIT, ITL, VIV, TVI, IAT and VVIAA |
New England Peptide |
Custom synthesized |
|
| Critical commercial assays |
|
| QuikChange Lightning Multi-Site Directed Mutagenesis kit |
Agilent |
Cat. No. 210513 |
| Amyloid β-peptide 1-40 ELISA kit |
Invitrogen |
Cat. No. KHB3481 |
| Amyloid β-peptide 1-40 ELISA kit |
Invitrogen |
Cat. No. KHB3441 |
|
| Deposited data |
|
| CryoEM map for the structure of γ-secretase bound to probe SB-250 |
This study |
EMDB: EMD-36948 |
| Atomic model for the structure of γ-secretase bound to probe SB-250 |
This study |
PDB: 8K8E |
|
| Experimental models: Cell lines |
|
| FreeStyle™ HEK293F cells |
ThermoFisher |
Cat. No. R79007
|
| HEK293 cells |
ATCC |
Cat. No. CRL-1573 |
| HEK293 cells stably expressing WT APP C99 |
This study |
N/A |
| HEK293 cells stably expressing I45F APP C99 |
This study |
N/A |
| HEK293 cells stably expressing V44F/I45F APP C99 |
This study |
N/A |
| HEK293 cells with PSEN1/2 double knockout by CRISPR |
Lei Liu, Brigham and Women’s Hospital |
Liu et al.30
|
|
| Experimental models: Organisms/strains |
|
|
C. elegans parental juIs1 strain [unc-25p::snb-1::GFP + lin-15(+)] |
|
Hallam et al51
|
|
C. elegans juIs1 + wt C99APP + wt PS-1 (lhEx661) |
This study |
N/A |
|
C. elegans juIs1 + I45F C99APP + wt PS-1 (lhEx655) |
This study |
N/A |
|
C. elegans juIsl + I45F C99APP (lhEx648) |
This study |
N/A |
|
C. elegans juIs1 + V44F I45F C99APP + wt PS-1 (lhEx650) |
This study |
N/A |
|
C. elegans juIs1 + V44F I45F C99APP (lhEx652) |
This study |
N/A |
|
C. elegans juIs1 + V50F M51F C99APP + wt PS-1 (lhEx663) |
This study |
N/A |
|
C. elegans juIs1 + wt C99APP + L166P PS-1 (lhEx657) |
This study |
N/A |
|
C. elegans juIs1 + L166P PS-1 (lhEx659) |
This study |
N/A |
|
| Oligonucleotides |
|
| DNA primers for P117L PSEN1 mutagenesis: ggcagctaatctataccctattcacagaagataccgagactg |
Invitrogen |
Custom synthesized |
| DNA primers for I143T PSEN1 mutagenesis: gccatcatgatcagtgtcactgttgtcatgactatcctcctg |
Invitrogen |
Custom synthesized |
| DNA primers for L166P PSEN1 mutagenesis: aaggtcatccatgcctggcctattatatcatctctattgctg |
Invitrogen |
Custom synthesized |
| DNA primers for G384A PSEN1 mutagenesis: ggagtaaaacttggattggcagatttcattttctacagtg |
Invitrogen |
Custom synthesized |
| DNA primers for L435F PSEN1 mutagenesis: aagaaagcattgccagcttttccaatctccatcacctttgggc |
Invitrogen |
Custom synthesized |
| DNA primers for L286V PSEN1 mutagenesis: gaaacgctttttccagctgtcatttactcctcaacaatggtg |
Invitrogen |
Custom synthesized |
| DNA inserts for plasmid construction and generation of transgenic C. elegans lines |
GeneArt/ ThermoFisher |
Custom synthesized; see Table S7
|
|
| Recombinant DNA |
|
| pMLINK-PSEN1 |
Coauthor Y. Shi |
Lu et al.12
|
| pMLINK-Aph1 (with C-terminal HA epitope tag) |
Coauthor Y. Shi |
Lu et al.12
|
| pMLINK-NCT (with C-terminal V5 and 6XHIS epitope tags) |
Coauthor Y. Shi |
Lu et al.12
|
| pMLINK-Pen-2 (with N-terminal STREP and FLAG epitope tags) |
Coauthor Y. Shi |
Lu et al.12
|
| pMLINK-PSEN1-Aph1-NCT-Pen-2 |
This study |
Lu et al.12
|
| pMLINK-PSEN1(L166P)-Aph1-NCT-Pen-2 |
This study |
N/A |
| pMLINK-PSEN1(G384A)-Aph1-NCT-Pen-2 |
This study |
N/A |
| pMLINK-PSEN1 (I143T)-Aph1-NCT-Pen-2 |
This study |
N/A |
| pMLINK-PSEN1(L435P)-Aph1-NCT-Pen-2 |
This study |
N/A |
| pMLINK-PSEN1(L286V)-Aph1-NCT-Pen-2 |
This study |
N/A |
| pMLINK-PSEN1(P117L)-Aph1-NCT-Pen-2 |
This study |
N/A |
| pET22b-C100-FLAG |
In-house |
Li et al52
|
| pCMV(puro)-C99 with APP signal sequence |
Lei Liu, Brigham and Women’s Hospital |
Bhattarai et al.53
|
| C99 miRFP720-miRFP670 (C99 720-670) biosensor |
Coauthor M. Maesako |
Houser et al.54
|
| pcDNA3.1-C99 miRFP720 |
This study |
N/A |
| worm expression vector pEVL415 (Prgef-1:htau40::gfp::unc-54 3′UTR) |
Co-author B. Ackley |
Aquino Nunez et al.55
|
|
| Software and algorithms |
|
| Prism 9 version 9.5.1 |
GraphPad |
https://www.graphpad.com
|
| Sigmaplot for Windows v.14 |
Systat Software GmbH |
http://www.systat.de/
|
| Fiji ImageJ 1.53c |
NIH |
https://imagej.nih.gov/
|
| AzureSpot |
Azure Biosystems |
https://azurebiosystems.com/
|
| MassLynx |
Waters |
https://www.waters.com
|
| RELION 3.0 |
https://www2.mrc-lmb.cam.ac.uk/relion
|
Luo et al.56
|
| CHARMM-GUI |
https://www.charmm-gui.org/
|
Jo et al.; Lee et al.; Wu et al.57–59
|
| Peptide Gaussian accelerated molecular dynamics (Pep-GaMD) |
Coauthor Y. Miao |
Wang & Miao60
|
| Amber 20 |
https://ambermd.org/
|
Case et al.61
|
| VMD |
https://www.ks.uiuc.edu/
|
Humphrey et al.62
|
| PyReweighting |
Coauthor Y. Miao |
Miao et al.63
|
| SPC-830 (fluorescence lifetime imaging microscopy data collection) |
Becker & Hickl GmbH |
https://www.becker-hickl.com
|
| SPC Image software version 2.5 (fluorescence lifetime imaging microscopy analysis |
Becker & Hickl GmbH |
https://www.becker-hickl.com
|
| MATLAB (pseudo-color fluorescence lifetime imaging microscopy) |
MathWorks |
https://www.mathworks.com/
|
| LAS X Imaging software v3.5.7 (confocal microscopy of C. elegans) |
Leica Microsystems |
https://www.leica-microsystems.com/
|
| Fluoview SW FV10 - ASW v. 4.00 (fluorescence microscopy of C. elegans) |
Olympus Life Science |
https://www.olympus-lifescience.com/
|
