Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background melB (Salmonella typhimurium) |
S. typhimurium strain LT2/SGSC1412/ATCC | PMID:1495487 | STM4299 | Used for melB cloning |
| Strain, strain background (Escherichia coli) | DW2 | PMID:3047112 | melA+ ΔmelB ΔlacZY | MelB expression and transport analysis |
| Strain, strain background (E. coli) | XL1 Blue | Agilent Technologies | recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)] | Plasmid amplification |
| Strain, strain background (E. coli) | ArcticExpress (DE3) | Agilent Technologies | F– ompT hsdS(rB – mB –) dcm+ Tetr gal λ(DE3) endA Hte [cpn10 cpn60 Gentr] | Protein expression |
| Strain, strain background (E. coli) | DH5α cyaA- | PMID:37380079 | ΔcyaA | Two-hybrid assay |
| Strain, strain background (E. coli) | BL21(DE3) T7 express | New England Biolabs | fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) endA1 Δ(mcrC-mrr)114::IS10 | Protein expression |
| Strain, strain background (E. coli) | BL21(DE3) C43 | PMID:8757792 | F– ompT hsdSB (rB- mB-) gal dcm (DE3) | Protein expression |
| Strain, strain background (E. coli) | BL21(DE3) pRIL | Agilent Technologies | F– ompT hsdS(rB – mB –) dcm+ Tetr gal endA Hte [argU ileY leuW], Camr | Protein expression |
| Recombinant DNA reagent (plasmid) |
pCS19 | PMID:10319814 | pQE60 derivative inserted with gene lacIq; ampr | Cloning/expressing vector |
| Recombinant DNA reagent (plasmid) |
pCS19/FX | PMID:25627011 | Expression vector derived from pCS19 with two SapI sites and ccdB gene for FX cloning; ampr | |
| Recombinant DNA reagent (plasmid) |
pACYC | PMID:2190220 | Expression vector; no ccdB gene: camr | |
| Recombinant DNA reagent (plasmid) |
pACYC/FX | PMID:25627011 | Expression vector derived from pACYC; with ccdB gene, camr | |
| Recombinant DNA reagent (plasmid) |
pACYC/MelBSt | PMID:25627011 | Expression plasmid for MelBSt derived from pACYC/FX; no ccdB gene, camr | |
| Recombinant DNA reagent (plasmid) |
pCS19/X:T18/FX | PMID:37380079 | FX cloning vector; two SapI sites and ccdB gene for FX cloning; ampr | Two-hybrid assay vector; expressing a target protein ‘X’ with a C-terminal T18 fusion |
| Recombinant DNA reagent (plasmid) |
pCS19/T18 | PMID:37380079 | Expression plasmid from pCS19/X:T18/FX for expressing T18 fragment only; no ccdB gene. | Two-hybrid assay plasmid; control vector |
| Recombinant DNA reagent (plasmid) |
pACYC/T25 | PMID:37380079 | Expression plasmid from pACYC/T25:X/FX for expressing T25 fragment; no ccdB gene, camr | Two-hybrid assay plasmid; control vector |
| Recombinant DNA reagent (plasmid) |
pACYC/T25:MelBSt | PMID:37380079 | Expression plasmid derived from pACYC/T25:X/FX; no ccdB gene, camr | Two-hybrid assay plasmid; expressing T25:MelBSt hybrid |
| Recombinant DNA reagent (plasmid) |
pCS19/Nb725:T18 | PMID:37380079 | Expression plasmid hybrid derived from pCS19/X:T18/FX; no ccdB gene, ampr | Two-hybrid assay plasmid; expressing Nb725:T18 hybrid |
| Recombinant DNA reagent (plasmid) |
pCS19/Nb725_4:T18 | This study | Expression plasmid derived from pCS19/X:T18/FX; no ccdB gene, ampr | Two-hybrid assay plasmid; expressing Nb725_4:T18 hybrid |
| Recombinant DNA reagent (plasmid) |
pK95ΔAH/MelBSt/CHis10 | PMC3057838 | Constitutive expression plasmid | MelBSt protein expression |
| Recombinant DNA reagent (plasmid) |
pCS19/Nb725 | PMID:37380079 | Expression plasmid for Nb725 derived from pCS19/FX; no ccdB gene, ampr | Nb725 protein expression |
| Recombinant DNA reagent (plasmid) |
pCS19/Nb725_4 | This study | Expression plasmid for Nb725_4 derived from pCS19/FX; no ccdB gene, ampr | Nb725_4 protein expression |
| Recombinant DNA reagent (plasmid) |
pET26b(+) | Novagen (EMD Millipore) |
Periplasmic expression plasmid with a N-terminal pelB signal sequence; Kanr | For expression Nb725_4 and anti-Fab Nb |
| Recombinant DNA reagent (plasmid) |
pET26/Nb725_4 | This study | Periplasmic expression plasmid derived from pET26b(+); Kanr | Nb725_4 protein production |
| Recombinant DNA reagent (plasmid) |
pET26/Anti-Fab Nb | This study | Anti-Fab Nb periplasmic expression plasmid; Kanr | Anti-Fab Nb protein expression |
| Recombinant DNA reagent (plasmid) |
p7XC3H/Nb725 | PMID:37380079 | Cytoplasmic expression plasmid; Kanr | Nb725 protein production |
| Recombinant DNA reagent (plasmid) |
p7XNH3/EIIAGlc | PMID:25296751 | Cytoplasmic expression plasmid; Kanr | EIIAGlc protein production |
| Recombinant DNA reagent (plasmid) |
pR2.2/NabFab | PMID:34782475 | Periplasmic expression of NabFab; Ampr | NabFab protein production |
| Recombinant DNA reagent (plasmid) | pMSP1E3D1 | Addgene/20066 | Expressing SP1E3D1; Kanr | MSP1E3D1 production |
| Recombinant DNA reagent (plasmid) | pRK792 | Addgene/8830 | Expressing TEV protease; Ampr | TEV protease production |
| Sequence-based reagent (primers) |
MelB_Nb725_4_T18 | This study |
Fwd: 5′- ATATATGCTCTTCTAGTCAACGTCAATTGGTAG -3′
Rev: 5′- TATATAGCTCTTCATGCGCTGCTCACGGTCAC -3′ |
FX cloning primers to contrast pCS19/Nb725_4:T18; addition of a C-terminal ‘A’ of Nb725_4 enabling the C-terminal T18 in-frame fusion |
| Sequence-based reagent (primer) |
MelB_Nb725_4 | This study |
Fwd: 5′-ATATATGCTCTTCTAGTATGCAACGTCAATTGGTAG-3′
Rev: 5′-TATATAGCTCTTCATGCTTAGTGGTGATGATGGTGGTGGCT GCTCACGGTCAC-3′ |
FX cloning primers to construct pCS19:Nb725_4-CTH with a C-terminal 6x His-tag |
| Sequence-based reagent (primer) |
Nb-PelB-NdeI | This study | Fwd: 5′-TTTAAGAAGGAGATATACATATG-3′ | Insert NdeI restriction site for Nb725_4 and anti-Fab Nb construction |
| Sequence-based reagent (primer) |
Nb-STRP-XhoI | This study | Rev: 5′-TTTGTTCTAGACTCGAGTTATTTCTC-3′ | Add XhoI restriction site for Nb725_4 and anti-Fab Nb construction |
| Chemical compound, drug | [3H]Melibiose | PerkinElmer | (5.32 Ci/mmol) | Transport assay S |
| Chemical compound, drug | UDM | Anatrace | Cat# D300HA | MelBSt purification |
| Chemical compound, drug | DDM | Anatrace | Cat# D310 | MelBSt purification |
| Chemical compound, drug | Melibiose | Acros Organics | Cat# 125375000 | Fermentation and Binding assay |
| Chemical compound, drug | α-NPG | Acros Organics | Cat# 33733500 | Binding assay |
| Chemical compound, drug | E. coli lipids | Avanti Polar Lipids, Inc | Extract Polar, 100600 | Nanodiscs |
| Software, algorithm | CryoSPARC | CryoSPARC | 2-4.01 | CryoEM data processing |
| Software, algorithm | USF ChimeraX | USF ChimeraX | 1.6 | Mask preparation |
| Software, algorithm | Phenix | Phenix | 1.20-4459 | Map sharpen and model refinement |
| Software, algorithm | Coot | Coot | 0.9 | Model building |
| Software, algorithm | Pymol | Pymol | 2.5 | Model visualization |
| Software, algorithm | Qscore | Qscore | Q score calculation | |
| Software, algorithm | NanoAnalyze | TA Instruments | 3.7.5 | Data fitting |
| Software, algorithm | HDExaminer | Trajan Scientific and Medical | 3.3 | HDX data analysis |
| Software, algorithm | BioPharma Finder | Thermo | 5.1 | HDX data analysis and peptide mapping |