Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Drosophila melanogaster) | 10xUAS-IVS- myristoylated-GFP | Bloomington Drosophila Stock Center | RRID: BDSC_32199 | w[1118]; P{y[+t7.7] w[+mC]=10XUAS-IVS-myr::GFP}su(Hw)attP5 |
| Strain, strain background (D. melanogaster) | R27G05GAL4 | Bloomington Drosophila Stock Center | RRID: BDSC_48073 | w[1118]; P{y[+t7.7] w[+mC]=GMR27 G05-GAL4}attP2 |
| Strain, strain background (D. melanogaster) | UAS-Bsh-RNAi | Bloomington Drosophila Stock Center | RRID: BDSC_29336 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02498}attP2 |
| Strain, strain background (D. melanogaster) | Bsh-LexA | Bloomington Drosophila Stock Center | RRID: BDSC_52834 | w[1118]; P{y[+t7.7] w[+mC]=GMR64B07-lexA}attP40 |
| Strain, strain background (D. melanogaster) | 13xLexAop-IVS-myr::GFP | Bloomington Drosophila Stock Center | RRID: BDSC_32211 | y[1] w[*] P{y[+t7.7] w[+mC]=13XLexAop2-IVS-myr::GFP}su(Hw)attP8 |
| Strain, strain background (D. melanogaster) | UAS-Cas9 (attp40) | Bloomington Drosophila Stock Center | RRID: BDSC_58985 | P{ry[+t7.2]=hsFLP}12, y w[*]; P{y[+t7.7] w[+mC]=UAS-Cas9.P2}attP40 |
| Strain, strain background (D. melanogaster) | UAS-Cas9 (attp2) | Bloomington Drosophila Stock Center | RRID: BDSC_58986 | P{ry[+t7.2]=hsFLP}12, y[1] w[*]; P{y[+t7.7] w[+mC]=UAS-Cas9.P2}attP2/TM6B, Tb[1] |
| Strain, strain background (D. melanogaster) | UAS-Bsh-sgRNA | Vienna Drosophila Resource Center | VDRC 341537 | P{ry[+t7.2]=hsFLP}1, y[1] () w[1118]; P{y[+t7.7] w[+mC]=HD_CFD00611}attP40/CyO-GFP |
| Strain, strain background (D. melanogaster) | UAS-Ap-RNAi | Bloomington Drosophila Stock Center | RRID: BDSC_41673 | y[1]sc[*] v[1] sev[21] ; P{y[+t7.7] v[+t1.8]=TRiP.HMS02207}attP2 |
| Strain, strain background (D. melanogaster) | 20xUAS-RSR.PEST | Bloomington Drosophila Stock Center | RRID: BDSC_55795 | w[1118]; P{y[+t7.7] w[+mC]=20XUAS-RSR.PEST}attP2 |
| Strain, strain background (D. melanogaster) | UAS-Ap-shRNA | Vienna Drosophila Resource Center | VDRC 330463 | P{VSH330463}attP40 |
| Strain, strain background (D. melanogaster) | UAS-Bsh-HA | Bloomington Drosophila Stock Center | RRID: BDSC_83310 | y[1] w[1118]; PBac{y[+mDint2] w[+mC]=UAS-bsh.ORF.3xHA.GW}VK00018/CyO |
| Strain, strain background (D. melanogaster) | tubP-GAL80[ts] | Bloomington Drosophila Stock Center | RRID: BDSC_7017 | w[*]; P{w[+mC]=tubP-GAL80[ts]}2/TM2 |
| Strain, strain background (D. melanogaster) | UAS-Zfh1-RNAi | Vienna Drosophila Resource Center | VDRC 103205 | P{KK109931}VIE-260B |
| Strain, strain background (D. melanogaster) | Brp-rst-stop-rst-smFPV5-2a-GAL4 | Jing Peng (Harvard Medical School) | W; Bl/CyO-GFP; Brp-rst-stop-rst-smFPV5-2A-Gal4/tm6b | |
| Strain, strain background (D. melanogaster) | 31C06AD (III), 34G07DBD (III) | Gift from Janelia Research Campus (Tuthill et al., 2013) | w; UAS-FLP/CyO; 31c06A, 34G07DBD/tm6b | |
| Strain, strain background (D. melanogaster) | 31C06-Gal4, UAS-myristoylated-tdTomato | Gift from Lawrence Zipursky | ;Bl/CyO; 31c06-Gal4, UAS- myristoylated-tdTomato/tm6b | |
| Strain, strain background (D. melanogaster) | VALIUM20-mCherry | Bloomington Drosophila Stock Center | RRID: BDSC_35785 | y[1] sc[*]v[1] sev[21]; P{y[+t7.7] v[+t1.8]=VALIUM20-mCherry}attP2 |
| Strain, strain background (D. melanogaster) | Bsh-ORF-3XHA (86Fb) | FlyORF Webshop | Cat#F000054 | M{UAS-bsh.ORF.3xHA.GW}ZH-86Fb |
| Strain, strain background (D. melanogaster) | flyORF-TaDa | Bloomington Drosophila Stock Center | RRID: BDSC_91637 | w[1118]; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb |
| Strain, strain background (D. melanogaster) | hs-FlpD5; FlyORF-TaDa | Bloomington Drosophila Stock Center | RRID: BDSC_91638 | w[1118]; P{y[+t7.7] w[+mC]=hs-FLPD5}attP40; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb |
| Strain, strain background (D. melanogaster) | Bsh-null mutant | Gift from Makoto Sato | ||
| Strain, strain background (D. melanogaster) | Bsh-TaDa | This paper | w; +/CyO; UAS-GFP-Bsh-DAM/tm6b; See Generating Bsh-TaDa fly line in Materials and methods | |
| Antibody | Chicken polyclonal | Abcam | Cat#ab13970, RRID_300798 |
Anti-GFP (1:1000) |
| Antibody | Rabbit polyclonal | Gift from Claude Desplan (Özel et al., 2021) |
Anti-Bsh (1:1000) | |
| Antibody | Guinea pig polyclonal | Gift from Lawrence Zipursky (Tan et al., 2015) and Makoto Soto | Anti-Bsh (1:1000) | |
| Antibody | Rabbit polyclonal | Gift from Markus Affolter (Bieli et al., 2015) |
Anti-Apterous (1:1000) | |
| Antibody | Rat monoclonal | Gift from Cheng-Ting Chien (Chen et al., 2012) | Anti-Pdm3 (1:200) | |
| Antibody | Rabbit polyclonal | Gift from Cheng-Yu Lee (Janssens et al., 2014) | Anti-Erm (1:100) | |
| Antibody | Rat monoclonal | Gift from Jing Peng (Santiago et al., 2021) | Anti-Erm (1:70) | |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Seven-up D2D3, RRID_2618079 | Anti-Svp (1:10) |
| Antibody | Rabbit polyclonal | Gift from James Skeath (Tian et al., 2004) | Anti-Zfh1 (1:1000) | |
| Antibody | Rabbit polyclonal | Asian Distribution Center for Segmentation Antibodies | Code#812 | Anti-Tailless (1:200) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#mAbdac1-1, RRID: AB_579773 |
Anti-Dac (1:100) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Elav-9F8A9, RRID: AB_528217 |
Anti-Elav (1:200) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Rat-Elav-7E8A10 anti-elav, RRID: AB_528218 |
Anti-Elav (1:50) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#24B10, RRID: AB_528161 |
Anti-Chaoptin (1:20) |
| Antibody | Guinea pig polyclonal | Gift from Matthew Pecot Lab (Xu et al., 2019) | Anti-DIP- β (1:300) | |
| Antibody | Mouse monoclonal | Bio-Rad Laboratories | Cat#MCA1360A647, RRID: AB_770156 |
Anti-V5-TAG:Alexa Fluor 647 (1:300) |
| Antibody | Rat monoclonal | Sigma-Aldrich | Cat#12158167001, RRID: AB_390915 | Anti-HA (1:100) |
| Antibody | Guinea pig polyclonal | Gift from Richard Mann (Casares and Mann, 1998) | Anti-Hth (1:2000) | |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#nc-82, RRID: AB_2314866 |
Anti-Brp (1:50) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-545-153, RRID: AB_2340684 | Alexa Fluor 488 anti-rat (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#703-545-155, RRID: AB_2340375 | Alexa Fluor 488 anti-chicken (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-545-148, RRID: AB_2340472 | Alexa Fluor 488 anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-545-152, RRID: AB_2313584 | Alexa Fluor 488 anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-545-150, RRID: AB_2340846 | Alexa Fluor 488 anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-295-151, RRID: AB_2340832 | Rhodamine Red-X anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-295-153, RRID: AB_2340676 | Rhodamine Red-X anti-rat (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-295-152, RRID: AB_2340613 | Rhodamine Red-X anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-295-148, RRID: AB_2340468 | Rhodamine Red-X donkey anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-605-152, RRID: AB_2492288 | Alexa Fluor 647 donkey anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-605-151, RRID: AB_2340863 | Alexa Fluor 647 donkey anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-605-148, RRID: AB_2340476 | Alexa Fluor 647 anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-605-153, RRID: AB_2340694 | Alexa Fluor 647 anti-rat (1:400) |
| Sequence-based reagent | Oligonucloetide | Integrated DNA Technologies | DamID Adaptor (top strand): CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA | |
| Sequence-based reagent | Oligonucloetide | Integrated DNA Technologies | DamID Adaptor (bottom strand): TCCTCGGCCG | |
| Sequence-based reagent | Oligonucloetide | Integrated DNA Technologies | DamID Primer for PCR: GGTCGCGGCCGAGGATC | |
| Commercial assay or kit | QIAamp DNA Micro Kit | QIAGEN | Cat#56304 | |
| Commercial assay or kit | PCR Purification Kit | QIAGEN | Cat#28104 | |
| Chemical compound, drug | EDTA | Sigma-Aldrich | Cat#E6758 | |
| Chemical compound, drug | DpnI and CutSmart buffer | NEB | Cat#R0176S | |
| Chemical compound, drug | DpnII and DpnII buffer | NEB | Cat#R0543S | |
| Chemical compound, drug | MyTaq HS DNA Polymerase | Bioline | Cat#BIO-21112 | |
| Chemical compound, drug | AlwI | NEB | Cat#R0513S | |
| Chemical compound, drug | RNase A (DNase free) | Roche | Cat#11119915001 | |
| Chemical compound, drug | T4 DNA ligase and 10x buffer | NEB | Cat#M0202S | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | https://imagej.nih.gov/ij/download.html | |
| Software, algorithm | FastQC (v0.11.9) | The Babraham Bioinformatics group | https://www.bioinformatics.babraham.ac.uk/projects/download.html#fastqc | |
| Software, algorithm | MATLAB | Mathworks | https://www.mathworks.com/products/matlab.html | |
| Software, algorithm | damidseq_pipeline | Marshall and Brand, 2015 | https://owenjm.github.io/damidseq_pipeline/ | |
| Software, algorithm | Bowtie2 (v2.4.5) | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | |
| Software, algorithm | IGV (v.2.13.2) | Robinson et al., 2011 | https://software.broadinstitute.org/software/igv/download | |
| Software, algorithm | SAMtools (v1.15.1) | Li et al., 2009 | http://www.htslib.org/download/ | |
| Software, algorithm | deepTools (v3.5.1) | Ramírez et al., 2016 | https://deeptools.readthedocs.io/en/develop/content/installation.html | |
| Software, algorithm | Find_peaks | Marshall et al., 2016 | https://github.com/owenjm/find_peaks |