| Strain, strain background (Peromyscus leucopus) |
Outbred LL stock; adults of both sexes |
Peromyscus Genetic Stock Center of the University of South Carolina |
|
|
| Strain, strain background (Mus musculus) |
Outbred CD-1 breed; adults of both sexes |
Charles River Laboratories |
Crl:CD1(ICR) IGS |
|
| Strain, strain background (Rattus norvegicus) |
Inbred Fischer F344 strain; adult females |
Charles River Laboratories |
F344/NHsd |
|
| Strain, strain background (Borrelia hermsii) |
Genomic group II, strain MTW |
Balderrama-Gutierrez et al., 2021 (reference 3) |
|
Provided by Tom Schwan, Rocky Mountain Laboratories |
| Sequence-based reagent |
Arg1_F for P. leucopus
|
This paper |
PCR primer |
TCCGCTGACAACCAACTCTG
|
| Sequence-based reagent |
Arg1_R for P. leucopus
|
This paper |
PCR primer |
GACAGGTGTGCCAGTAGATG
|
| Sequence-based reagent |
Arg1_F for M. musculus
|
This paper |
PCR primer |
TGTGAAGAACCCACGGTCTG
|
| Sequence-based reagent |
Arg1_R for M. musculus
|
This paper |
PCR primer |
ACGTCTCGCAAGCCAATGTA
|
| Sequence-based reagent |
Nos2_F for P. leucopus and M. musculus
|
Balderrama-Gutierrez et al., 2021 (reference 3) |
PCR primer |
GACTGGATTTGGCTGGTCCC
|
| Sequence-based reagent |
Nos2_R for P. leucopus and M. musculus
|
Balderrama-Gutierrez et al., 2021 (reference 3) |
PCR primer |
GAACACCACTTTCACCAAGAC
|
| Sequence-based reagent |
Gapdh_F for P. leucopus and M. musculus
|
Balderrama-Gutierrez et al., 2021 (reference 3) |
PCR primer |
TCACCACCATGGAGAAGGC
|
| Sequence-based reagent |
Gapdh_R for P. leucopus and M. musculus
|
Balderrama-Gutierrez et al., 2021 (reference 3) |
PCR primer |
GCTAAGCAGTTGGTGGTGCA
|
| Commercial assay or kit |
Invitrogen Mouse RiboPure-Blood RNA Isolation Kit |
Invitrogen |
AM1951 |
|
| Commercial assay or kit |
TruSeq Stranded mRNA kit for cDNA |
Illumina |
20020594 |
|
| Commercial assay or kit |
Power Sybr Green RNA-to-Ct 1-Step Kit for RT-qPCR |
Applied Biosystems |
ThermoFisher 4389986 |
|
| Chemical compound, drug |
Lipopolysaccharide, Escherichia coli O111:B4, ion-exchange chromatography purified |
Sigma-Aldrich |
L3024 |
|
| Chemical compound, drug |
Lipopolysaccharide, Escherichia coli O111:B4, cell culture grade” |
Sigma-Aldrich |
L4391 |
|
| Chemical compound, drug |
0.9% sodium chloride sterile-filtered, endotoxin-tested |
Sigma-Aldrich |
S8776 |
|
| Software, algorithm |
FastQC, version 0.12.0 |
Babraham Bioinformatics |
|
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
|
| Software, algorithm |
Trimmomatic, version 0.40 |
USADELLAB.org; Usadel and Bolger, 2023
|
|
https://github.com/usadellab/Trimmomatic
|
| Software, algorithm |
CLC Genomics Workbench, version 23.1 |
Qiagen |
|
|
| Software, algorithm |
EnrichR (Enrichment of Gene Ontology) |
Metascape |
|
https://metascape.org
|
| Software, algorithm |
SYSTAT, version 13.1 |
Systat Software, Inc |
|
|
| Software, algorithm |
False Discovery Rate Online Calculator |
Carbocation Corporation |
|
https://tools.carbocation.com/FDR
|
