Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (D. melanogaster) | 10xUAS-IVS- myristoylated-GFP | Bloomington Drosophila Stock Center | RRID: BDSC_32199 | w[1118]; P{y[+t7.7] w[+mC]=10XUAS-IVS-myr::GFP}su(Hw)attP5 |
| Strain, strain background (D. melanogaster) | R27G05GAL4 | Bloomington Drosophila Stock Center | RRID: BDSC_48073 | w[1118]; P{y[+t7.7] w[+mC]=GMR27 G05-GAL4}attP2 |
| Strain, strain background (D. melanogaster) | UAS-Bsh-RNAi | Bloomington Drosophila Stock Center | RRID: BDSC_29336 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF02498}attP2 |
| Strain, strain background (D. melanogaster) | yw; UAS-mCD8-GFP, UAS-rCD2i, FRT40A/ CyO; TM3, Sb/TM6B, Tb |
Bloomington Drosophila Stock Center | RRID: BDSC_56185 | y[1] w[*]; P{y[+t7.7] w[+mC]=UAS-mCD8.GFP.UAS-rCD2i}attP40 P{ry[+t7.2]=neoFRT}40 A/CyO; TM3, Sb[1]/TM6B, Tb[1] |
| Strain, strain background (D. melanogaster) | yw, hsFlp122; frt40a, UAS-CD2-RFP, UAS-GFP-miRNA | Gift from Claude Desplan Lab | yw, hsFLP; uas-CD2::RFP, UAS-GFP-miRNA/cyo; tm2/tm6b,tb | |
| Strain, strain background (D. melanogaster) | UAS-Notch-RNAi | Bloomington Drosophila Stock Center | RRID: BDSC_33611 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.HMS00001}attP2 |
| Strain, strain background (D. melanogaster) | UAS-Notch-ICD | Struhl and Greenwald, 2001 | ;UAS-Notch-ICD; +/+ | |
| Strain, strain background (D. melanogaster) | Hey-ORF-T2A-FlpD5 | Mark et al., 2021 | w; Hey-ORF-T2A-FLP(RFP+)/cyo, wg-LacZ; +/+ | |
| Strain, strain background (D. melanogaster) | UAS-FRT-STOP-FRT-myrGFP | Bloomington Drosophila Stock Center | RRID: BDSC_55810 | w[1118]; P{y[+t7.7] w[+mC]=10XUAS(FRT.stop)GFP.Myr}su(Hw)attP5 |
| Strain, strain background (D. melanogaster) | w; Brp-FRT-STOP-FRT-smGdP-v5-T2A-LexA; LexAop-Tomato | Peng et al., 2018; Xu et al., 2019 | w; Brp-FRT-STOP-FRT-smGdP-v5-T2A-LexA/cyo; LexAop-myrtdTomato/tm6b | |
| Strain, strain background (D. melanogaster) | UAS-Svp-RNAi | Bloomington Drosophila Stock Center | RRID: BDSC_28689 | y[1] v[1]; P{y[+t7.7] v[+t1.8]=TRiP.JF03105}attP2 |
| Strain, strain background (D. melanogaster) | 6–60 Gal4 | Gift from Lawrence Zipursky | W; Bl/cyo; 6–60 Gal4/tm6b | |
| Strain, strain background (D. melanogaster) | Bsh-L-Gal4 | Gift from Makoto Sato | ;Bsh-L-Gal4/cyo; +/+ | |
| Strain, strain background (D. melanogaster) | tubP-GAL80[ts] | Bloomington Drosophila Stock Center | RRID: BDSC_7017 | w[*]; P{w[+mC]=tubP-GAL80[ts]}2/TM2 |
| Strain, strain background (D. melanogaster) | UAS-Zfh1-RNAi | Vienna Drosophila Resource Center | VDRC 103205 | P{KK109931}VIE-260B |
| Strain, strain background (D. melanogaster) | 31C06-Gal4, UAS-myristoylated-tdTomato | Gift from Lawrence Zipursky | ;Bl/cyo; 31c06-Gal4, UAS- myristoylated-tdTomato/tm6b | |
| Strain, strain background (D. melanogaster) | E(spl)-mγ-GFP | Gift from Sarah Bray (Almeida and Bray, 2005) | w; +/+; E(spl)mγ-GFP/tm6b | |
| Strain, strain background (D. melanogaster) | VALIUM20-mCherry | Bloomington Drosophila Stock Center | RRID: BDSC_35785 | y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=VALIUM20-mCherry}attP2 |
| Strain, strain background (D. melanogaster) | Bsh-ORF-3XHA (86Fb) | FlyORF Webshop | Cat#F000054 | M{UAS-bsh.ORF.3xHA.GW}ZH-86Fb |
| Strain, strain background (D. melanogaster) | flyORF-TaDa | Bloomington Drosophila Stock Center | RRID: BDSC_91637 | w[1118]; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb |
| Strain, strain background (D. melanogaster) | hs-FlpD5; FlyORF-TaDa | Bloomington Drosophila Stock Center | RRID: BDSC_91638 | w[1118]; P{y[+t7.7] w[+mC]=hs-FLPD5}attP40; M{RFP[3xP3.PB] w[+mC]=FlyORF-TaDa}ZH-86Fb |
| Strain, strain background (D. melanogaster) | Bsh-TaDa | Xu et al., 2023 | w; +/CyO; UAS-GFP-Bsh-DAM/tm6b | |
| Antibody | Chicken polyclonal | Abcam | Cat#ab13970, RRID_300798 |
Anti-GFP (1:1000) |
| Antibody | Rabbit polyclonal | Medical & Biological Laboratories Co. | Code#PM005 | Anti-RFP (1:500) |
| Antibody | Rabbit polyclonal | Gift from Claude Desplan (Özel et al., 2021) |
Anti-Bsh (1:1000) | |
| Antibody | Guinea pig polyclonal | Gift from Lawrence Zipursky (Tan et al., 2015) & Makoto Soto | Anti-Bsh (1:1000) | |
| Antibody | Rat monoclonal | This study | Anti-Bsh (1:750); see methods section- generating Bsh antibody | |
| Antibody | Rabbit polyclonal | Gift from Markus Affolter (Bieli et al., 2015) |
Anti-Apterous (1:1000) | |
| Antibody | Rat monoclonal | Gift from Cheng-Ting Chien (Chen et al., 2012) | Anti-Pdm3 (1:200) | |
| Antibody | Rabbit polyclonal | Gift from Cheng-Yu Lee (Janssens et al., 2014) | Anti-Erm (1:100) | |
| Antibody | Rat monoclonal | Gift from Jing Peng (Santiago et al., 2021) | Anti-Erm (1:70) | |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Seven-up D2D3, RRID_2618079 | Anti-Svp (1:10) |
| Antibody | Rabbit polyclonal | Gift from James Skeath (Tian et al., 2004) | Anti-Zfh1 (1:1000) | |
| Antibody | Rabbit polyclonal | Asian Distribution Center for Segmentation Antibodies | Code#812 | Anti-Tailless (1:200) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#Elav-9F8A9, RRID: AB_528217 |
Anti-Elav (1:200) |
| Antibody | Mouse monoclonal | Bio-Rad Laboratories | Cat#MCA1360A647, RRID: AB_770156 |
Anti-V5-TAG:Alexa Fluor 647 (1:300) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#nc-82, RRID: AB_2314866 |
Anti-Brp (1:50) |
| Antibody | Mouse monoclonal | Developmental Studies Hybridoma Bank | Cat#C594.9B, RRID: AB_528194 |
Anti-Delta (1:10) |
| Antibody | Mouse monoclonal | TaKaRa | Cat#632543 | Anti-Cherry (1:500) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat# 711-475-152 AB_2340616 |
DyLight 405 anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#703-545-155, RRID: AB_2340375 | Alexa Fluor 488 anti-chicken (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-545-148, RRID: AB_2340472 | Alexa Fluor 488 anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-545-152, RRID: AB_2313584 | Alexa Fluor 488 anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-545-150, RRID: AB_2340846 | Alexa Fluor 488 anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-295-151, RRID: AB_2340832 | Rhodamine Red-X anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-295-153, RRID: AB_2340676 | Rhodamine Red-X anti-rat (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-295-152, RRID: AB_2340613 | Rhodamine Red-X anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-295-148, RRID: AB_2340468 | Rhodamine Red-X donkey anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#711-605-152, RRID: AB_2492288 | Alexa Fluor 647 donkey anti-rabbit (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#715-605-151, RRID: AB_2340863 | Alexa Fluor 647 donkey anti-mouse (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#706-605-148, RRID: AB_2340476 | Alexa Fluor 647 anti-guinea pig (1:400) |
| Antibody | Donkey polyclonal | Jackson ImmunoResearch Lab | Cat#712-605-153, RRID: AB_2340694 | Alexa Fluor 647 anti-rat (1:400) |
| Sequence-based reagent | Oligonucloetide | Integrated DNA technologies | DamID Adaptor (top strand): CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA | |
| Sequence-based reagent | Oligonucloetide | Integrated DNA technologies | DamID Adaptor (bottom strand): TCCTCGGCCG | |
| Sequence-based reagent | Oligonucloetide | Integrated DNA technologies | DamID Primer for PCR: GGTCGCGGCCGAGGATC | |
| Commercial assay or kit | QIAamp DNA Micro Kit | Qiagen | Cat#56304 | |
| Commercial assay or kit | PCR Purification Kit | Qiagen | Cat#28104 | |
| Chemical compound, drug | EDTA | Sigma-Aldrich | Cat#E6758 | |
| Chemical compound, drug | DpnI and CutSmart buffer | NEB | Cat#R0176S | |
| Chemical compound, drug | DpnII and DpnII buffer | NEB | Cat#R0543S | |
| Chemical compound, drug | MyTaq HS DNA Polymerase | Bioline | Cat#BIO-21112 | |
| Chemical compound, drug | AlwI | NEB | Cat#R0513S | |
| Chemical compound, drug | RNase A (DNase free) | Roche | Cat#11119915001 | |
| Chemical compound, drug | T4 DNA ligase and 10 x buffer | NEB | Cat#M0202S | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | https://imagej.nih.gov/ij/download.html | |
| Software, algorithm | FastQC (v0.11.9) | The Babraham Bioinformatics group | https://www.bioinformatics.babraham.ac.uk/projects/download.html#fastqc | |
| Software, algorithm | damidseq_pipeline | Marshall and Brand, 2015 | https://owenjm.github.io/damidseq_pipeline/ | |
| Software, algorithm | Bowtie2 (v2.4.5) | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml | |
| Software, algorithm | IGV (v.2.13.2) | Robinson et al., 2011 | https://software.broadinstitute.org/software/igv/download | |
| Software, algorithm | SAMtools (v1.15.1) | Li et al., 2009 | http://www.htslib.org/download/ | |
| Software, algorithm | deepTools (v3.5.1) | Ramírez et al., 2016 | https://deeptools.readthedocs.io/en/develop/content/installation.html | |
| Software, algorithm | Find_peaks | Marshall et al., 2016 | https://github.com/owenjm/find_peaks; (Marshall, 2016) |