| Strain, strain background (Mus musculus) |
Bone marrow-derived macrophages (BMMs) |
KOATECH (Gyeonggi-do, South Korea) |
KOATECH:C5BL/6 |
|
| Genetic reagent (M. musculus) |
Arrdc5 shRNA |
This paper |
|
pLKO.1-puro-CMV-tGFP vector (SHC003; Sigma Aldrich) containing target sequence 5’-CCACACCTTTGAACTTCCATTT-3’ |
| Cell line (Homo sapiens) |
HeLa |
American Type Culture Collection (ATCC) |
ATCC:CCL-2 |
|
| Cell line (H. sapiens) |
HEK293 |
American Type Culture Collection (ATCC) |
ATCC:CRL-1573 |
|
| Cell line (H. sapiens) |
HEK293T |
American Type Culture Collection (ATCC) |
ATCC:CRL-3216 |
|
| Cell line (Drosophila melanogaster) |
S2R+ |
Drosophila Genomics Resource Center (DGRC) |
DGRC:Stock number 150 |
|
| Antibody |
TXNIP (D5F3E) Rabbit mAb |
Cell Signaling Technology |
Cell signaling:14715 |
|
| Antibody |
HDAC2 (D6S5P) Rabbit mAb |
Cell Signaling Technology |
Cell signaling:57156 |
|
| Antibody |
Histone H3ac (pan-acetyl) antibody (pAb) 100 µl |
Active Motif |
Active Motif:39139 |
|
| Antibody |
normal rabbit IgG |
Santa Cruz Biotechnology |
Santa Cruz:sc-2027 |
|
| Antibody |
Rabbit TrueBlot: Anti-Rabbit IgG HRP |
RockLand |
RockLand:18-8816-31 |
|
| Antibody |
Monoclonal Anti-ATP6V1A, (C-terminal) antibody produced in mouse, clone 4 F5, purified immunoglobulin, buffered aqueous solution |
Sigma Aldrich |
Sigma Aldrich:SAB1402125-100UG |
|
| Antibody |
Goat anti-Mouse IgM (Heavy chain) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 |
Invitrogen |
Invitrogen:A-21044 |
|
| Antibody |
Rabbit Anti-Mouse IgG H&L (HRP) |
Abcam |
Abcam:ab6728 |
|
| Antibody |
Goat Anti-Rabbit IgG H&L (HRP) |
Abcam |
Abcam:ab6721 |
|
| Antibody |
α-Tubulin (DM1A) Mouse mAb |
Cell Signaling Technology |
Cell Signaling:3873 |
|
| Antibody |
Fluorescein (FITC) AffiniPure Donkey Anti-Rabbit IgG (H+L) |
Jackson ImmunoResearch Laboratories |
Jackson ImmunoResearch:711-095-152 |
|
| Antibody |
Cy3 AffiniPure Donkey Anti-Rabbit IgG (H+L) |
Jackson ImmunoResearch Laboratories |
Jackson ImmunoResearch:711-165-152 |
|
| Antibody |
HDAC2 Antibody |
Cell Signaling Technology |
Cell Signaling:2540 |
|
| Antibody |
GAPDH (D16H11) XP Rabbit mAb |
Cell Signaling Technology |
Cell Signaling:5174 |
|
| Antibody |
Lamin B1 (D9V6H) Rabbit mAb |
Cell Signaling Technology |
Cell Signaling:13435 |
|
| Antibody |
Phospho-HDAC2 (Ser394) (E8O2Z) Rabbit mAb |
Cell Signaling Technology |
Cell Signaling:69238 |
|
| Antibody |
MTA1 (D40D1) XP Rabbit mAb |
Cell Signaling Technology |
Cell Signaling:5647 |
|
| Antibody |
MBD3 (N87) Antibody |
Cell Signaling Technology |
Cell Signaling:14540 |
|
| Antibody |
ATP6V1B2 (D2F9R) Rabbit mAb |
Cell Signaling Technology |
Cell Signaling:14617 |
|
| Antibody |
Anti-rabbit IgG, HRP-linked Antibody |
Cell Signaling Technology |
Cell Signaling:7074 S |
|
| Antibody |
Anti-mouse IgG, HRP-linked Antibody |
Cell Signaling Technology |
Cell Signaling:7076 S |
|
| Antibody |
GAPDH (G-9) |
Santa Cruz Biotechnology |
Santa Cruz:sc-365062 |
|
| Recombinant DNA reagent |
pCR8/GW/TOPO TA cloning kit |
Thermo Fisher Scientific |
Thermo Fisher:K250020 |
|
| Recombinant DNA reagent |
pMK33-Gateway-GFP destination vector |
Kwon et al., 2013
|
pMK33 |
|
| Recombinant DNA reagent |
pHAGE-GFP-Gateway destination vector |
Other |
|
Gift from Dr. Chanhee Kang at Seoul National University |
| Recombinant DNA reagent |
PEIPro DNA transfection reagent |
VWR international |
VWR:115010 |
|
| Recombinant DNA reagent |
Gateway LR Clonase II enzyme mix |
Thermo Fisher Scientific |
Thermo Fisher:11791020 |
|
| Sequence-based reagent |
α-tubulin RT-qPCR primers |
This paper |
|
"Forward:CTGGACCGCATCTCTGTGTACT;Reverse:GCCAAAAGGACCTGAGCGAACA" |
| Sequence-based reagent |
TXNIP RT-qPCR primers |
This paper |
|
"Forward:GCTCCTCCCTGCTATATGGAT;Reverse:AGTATAAGTCGGTGGTGGCAT" |
| Sequence-based reagent |
CD22 RT-qPCR primers |
This paper |
|
"Forward:GCGCAGCTTGTAATAGTTGGTGC;Reverse:CACATTGGAGGCTGACCGAGTT" |
| Sequence-based reagent |
L1CAM RT-qPCR primers |
This paper |
|
"Forward:TCGCCCTATGTCCACTACACCT;Reverse:ATCCACAGGGTTCTTCTCTGGG" |
| Sequence-based reagent |
OTULINL RT-qPCR primers |
This paper |
|
"Forward:GTGTGGAGGCAGAGGTTGAT;Reverse:ATGCCGCCAAAATAGCTCCT" |
| Sequence-based reagent |
PRR5L RT-qPCR primers |
This paper |
|
"Forward:GCGGCTGTTGAAGAGTGAAC;Reverse:AGCCAGAACCTCAATGCGAT" |
| Sequence-based reagent |
SDC3 RT-qPCR primers |
This paper |
|
"Forward:CTCCTGGACAATGCCATCGACT;Reverse:TGAGCAGTGTGACCAAGAAGGC" |
| Sequence-based reagent |
GAPDH1 RT-qPCR primers |
This paper |
|
"Forward:ATCACCATCTTCCAGGAGCGA;Reverse:CCTTCTCCATGGTGGTGAAGAC" |
| Sequence-based reagent |
CD22 ChIP-qPCR primers |
This paper |
|
"Forward#1:CGCTGGAGAAGTGAGTTCGG;Reverse#1:TCCCTGCCTCCACTGATAGC", "Forward#2:GACGCTGAGATGAGGGTTGG;Reverse#2:TGACTCAGGAGGTTGGCAGA", "Forward#3:TCCCCACTCTTCTCGCTCTC;Reverse#3:ATTTGCGAGGTTGAGGTTGTC" |
| Sequence-based reagent |
L1CAM ChIP-qPCR primers |
This paper |
|
"Forward#1:CAGCTCAGTGCCTCATGGAA;Reverse#1:GAGACTGCTTCCAGAGTGGG", "Forward#2:GGAATGCTTCACTGGGCAAC;Reverse#2:GGGGTAAGAATTCCGGAGCC", "Forward#3:CGTGTCTGAGAAAGGAAGCCA;Reverse#3:CGGCTTATCCCGATCTACCC" |
| Sequence-based reagent |
TXNIP siRNA |
Bioneer (Dajeon, South Korea) |
|
"Sense: 5’-GUCAGUCACUCUCAGCCAUdTdT–3';Anti-sense: 5'-AUGGCUGAGAGUGACUGACdTdT-3'" |
| Sequence-based reagent |
AccuTarget Negative control siRNA |
Bioneer (Dajeon, South Korea) |
|
|
| Peptide, recombinant protein |
Recombinant Human M-CSF |
PeproTech |
PeproTech:300–25 |
|
| Peptide, recombinant protein |
Recombinant Mouse TRANCE/RANK L/TNFSF11 |
R&D Systems |
R&D Systems:462-TEC |
|
| Peptide, recombinant protein |
Bafilomycin A1 |
Sigma Aldrich |
Sigma Aldrich:19–148 |
|
| Commercial assay or kit |
Pierce BCA Protein Assay Kit |
Thermo Fisher Scientific |
Thermo Fisher:23225 |
|
| Commercial assay or kit |
The ChIP-IT High Sensitivity (HS) Kit |
Active Motif |
Active Motif:53040 |
|
| Commercial assay or kit |
Effectene Transfection Reagent |
Qiagen |
Qiagen:301425 |
|
| Commercial assay or kit |
NE-PER Nuclear and Cytoplasmic Extraction Reagents |
Thermo Fisher Scientific |
Thermo Fisher:78833 |
|
| Commercial assay or kit |
Lipofectamine RNAiMAX |
Invitrogen |
Invitrogen:13778075 |
|
| Commercial assay or kit |
CRISPR & MISSION Lentiviral Packaging Mix |
Sigma Aldrich |
Sigma Aldrich:SHP002 |
|
| Commercial assay or kit |
TRAP Staining Kit |
Cosmo Bio Co., LTD |
Cosmo Bio:PMC-AK04F-COS |
|
| Commercial assay or kit |
dentin discs |
Immunodiagnostic Systems (IDS) |
IDS:AE-8050 |
|
| Commercial assay or kit |
ReverTra Ace qPCR RT Kit |
Toyobo |
Toyobo:FSQ-101 |
|
| Commercial assay or kit |
GoScript Reverse Transcriptase |
Promega |
Promega:A5001 |
|
| Commercial assay or kit |
TruSeq Stranded mRNA Sample Prep Kit |
Illumina |
Illumina:RS-122–2101 |
|
| Commercial assay or kit |
SuperScript II reverse transcriptase |
Invitrogen |
Invitrogen:18064014 |
|
| Commercial assay or kit |
Illumina Tagment DNA TDE1 Enzyme and Buffer Kits |
Illumina |
Illumina:20034197 |
|
| Commercial assay or kit |
Nextera DNA Flex kit |
Illumina |
Illumina#20018704 |
|
| Commercial assay or kit |
MinElute PCR purification Kit |
Qiagen |
Qiagen#28004 |
|
| Commercial assay or kit |
Mycoplasma PCR Detection Kit |
abm |
abm#G238 |
|
| Commercial assay or kit |
e-Myco plus Mycoplasma PCR Detecting Kit |
iNtRON Biotechnology |
iNtRON#25237 |
|
| Chemical compound, drug |
Histopaque |
Sigma Aldrich |
Sigma Aldrich:1077 |
|
| Software, algorithm |
SAINTexpress |
Teo et al., 2014
|
|
Version 3.6.1 |
| Software, algorithm |
COMPLEAT |
Vinayagam et al., 2013
|
|
|
| Software, algorithm |
DAVID |
Huang et al., 2009a; Huang et al., 2009b
|
|
|
| Software, algorithm |
DIOPT |
Hu et al., 2011
|
|
Version 7.1 |
| Software, algorithm |
Cytoscape |
Shannon et al., 2003
|
|
Version 3.5.1 and 3.8.2 |
| Software, algorithm |
ENCODE ATAC-seq pipeline |
Jin-Wook et al., 2018
|
|
Version 1.9.2 |
| Software, algorithm |
FastQC |
Andrews, 2010
|
|
Version 0.11.8 |
| Software, algorithm |
Sickle |
Joshi and Fass, 2011
|
|
Version 1.33 |
| Software, algorithm |
STAR |
Dobin et al., 2013
|
|
Version 2.5.3a |
| Software, algorithm |
RSEM |
Li and Dewey, 2011
|
|
Version 1.3.1 |
| Software, algorithm |
Comet search engine |
Eng et al., 2013
|
|
|
| Software, algorithm |
T-COFFEE |
Notredame et al., 2000
|
|
|
| Software, algorithm |
RAxML |
Stamatakis, 2014
|
|
Version 8.2.11 |
| Software, algorithm |
g:Profiler |
Raudvere et al., 2019
|
|
|
| Software, algorithm |
REVIGO |
http://revigo.irb.hr/
|
RRID:SCR_005825
|
|
| Software, algorithm |
Python |
https://www.python.org/
|
RRID:SCR_008394
|
Version 2.7.14 and 3.6.12 |
| Software, algorithm |
R |
https://www.r-project.org/
|
RRID:SCR_001905
|
Version 4.0.2 |
