KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-ALK (D5F3) | Cell Signaling Technology | Cat#3633 |
| anti-R1α/β | Cell Signaling Technology | Cat#3927 |
| anti-R1α | Cell Signaling Technology | Cat#5675 |
| Alexa Fluor® 790 AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson | Jackson ImmunoResearch | Cat#711-655-152 |
| IgG (H+L) Cross-Adsorbed Goat anti-Rabbit, DyLight™ 650 | Invitrogen | Cat# 84545 |
| IgG (H+L) Cross-Adsorbed Goat anti-Rabbit, DyLight™ 488 | Invitrogen | Cat# 35553 |
| Bacterial and virus strains | ||
| Biological samples | ||
| Chemicals, peptides, and recombinant proteins | ||
| purified GFP | Abcam | Cat#AB84191 |
| crizotinib | Sigma-Aldrich | Cat#PZ0191 |
| biliverdin hydrochloride | Sigma-Aldrich | Cat#30891 |
| Hoechst 33342 | Sigma-Aldrich | Cat# 14533 |
| Critical commercial assays | ||
| Lipofectamine™ 3000 Transfection Reagent | ThermoFisher Scientific | Cat# L3000001 |
| Lipofectamine™ MessengerMAX | ThermoFisher Scientific | Cat# LMRNA001 |
| Deposited data | ||
| Experimental models: Cell lines | ||
| Lenti X HEK 293T | Takara Bio | # 632180 |
| H3122 | Lab of Dr. Trever Bivona | n/a |
| Experimental models: Organisms/strains | ||
| Oligonucleotides | ||
| R1α intron 2 sgRNA 1: ACCTGTATGCTAACTGTACT | this paper | N/A |
| R1α intron 2 sgRNA 2: GCAGCATTCAAGAAAAGCAA | this paper | N/A |
| R1α intron 2 sgRNA 3: CCTCACTTAAAGAGCTGAGG | this paper | N/A |
| R1α intron 2 sgRNA 4: GTGGGAGGTAATTTAATCAC | this paper | N/A |
| Recombinant DNA | ||
| pHR PGK LaG17-mCh-HOTag3 | this paper | N/A |
| pHR PGK LaG6-mCh-HOTag3 | this paper | N/A |
| pHR PGK LaG18-mC-HOTag3 | this paper | N/A |
| pHR PGK LaG17-mCh-HOTag6 | this paper | N/A |
| pHR PGK LaG17-mCh-FUS(LC) | this paper | N/A |
| pHR PGK LaG17-mCh-RGG | this paper | N/A |
| pHR PGK LaG17-mCh-Xvelo | this paper | N/A |
| pHR PGK LaG17-mCh | this paper | N/A |
| pHR PGK LaG17-mCh-HOTag3-NLS(c-MYC) | this paper | N/A |
| pHR PGK LaG17-miRFP670-HOTag6 | this paper | N/A |
| pCMV Cry2-EGFP | ||
| pCMV EGFP-sspB | this paper | N/A |
| pCMV EGFP-miRFP670 | this paper | N/A |
| pCMV miRFP670-iLid-iLid | this paper | N/A |
| pCMV miRFP670-iLid-iLid-iLid | this paper | N/A |
| pCMV miRFP670-iLid-iLid-iLid-iLid | this paper | N/A |
| pCMV miRFP670-iLid-iLid-iLid-iLid-iLid | this paper | N/A |
| pCMV miRFP670-iLid-iLid-iLid-iLid-iLid-iLid | this paper | N/A |
| pCMV EGFP-TDP43 | this paper | N/A |
| pCMV SARS-CoV-2 Nucleocapsid-EGFP | this paper | N/A |
| pCMV EML4-ALK-EGFP | this paper | N/A |
| pCMV iLid-FTH1–2A-EGFP-sspB | this paper | N/A |
| pCMV ALFA-Cry2–2A-BFP | this paper | N/A |
| pCMV LaG17-mRuby2-HOTag3 | this paper | N/A |
| pCS DEST Gab1(263–451)-mCh-HOTag3 | this paper | N/A |
| pCS DEST Gab1(263–451)-mCh | this paper | N/A |
| pCMV BcLOV-EGFP | ||
| pCMV nbALFA-EGFP-HOTag3 | this paper | N/A |
| pCMV iRFP-ALFA-ALFA-ALFA-ALFA | this paper | N/A |
| pCMV EGFP | ||
| pCMV EGFP-EGFP | this paper | N/A |
| pCMV EGFP-EGFP-EGFP | this paper | N/A |
| pCMV EGFP-EGFP-EGFP-EGFP-EGFP | this paper | N/A |
| pCMV FUS(LC)-GFP | this paper | N/A |
| pCMV RGG-GFP | this paper | N/A |
| Software and algorithms | ||
| MATLAB | MathWorks | https://www.mathworks.com/products/matlab.html |
| Python | Van Rossum et al 87 | https://www.python.org/ |
| Other | ||