FIG. 1.

Binding of NC to single- and double-stranded DNA. (A) A chip containing 312 RU of biotinylated, immobilized 28-base single-stranded DNA (i.e., GACTTGTGGAAAATCTCTAGCAGTGCAT) was exposed successively to 5, 10, 25, 50, 100, and 200 nM NC solutions. In each cycle, buffer was applied to the chip for the first 160 s. This was followed by the NC solution, which was applied for the next 160 s (the washon phase). The NC solution was followed by SPR buffer, which was allowed to flow past the chip for 700 s (the washout phase). Finally, all NC was removed with SDS (not shown). The successive binding curves are all superimposed in the figure. The horizontal line shows the RU expected if one NC molecule bound to each oligonucleotide molecule. (B) A chip containing 441 RU of biotinylated 28-base-pair double-stranded DNA was tested with the same NC concentration series as that used for panel A.