Skip to main content
. Author manuscript; available in PMC: 2025 Feb 1.
Published in final edited form as: Cell. 2024 Feb 1;187(3):733–749.e16. doi: 10.1016/j.cell.2023.12.037

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
7-AAD BD Biosciences Cat # 559925, RRID:AB_2869266
FITC anti-mouse CD4 (clone GK1.5) BioLegend Cat # 100406, RRID:AB_312690
TruStain FcX PLUS (anti-mouse CD16/32, clone S17011E) BioLegend Cat # 156604, RRID:AB_2783137
APC anti-mouse CD45 (clone 30-F11) BioLegend Cat # 103112, RRID:AB_312977
Mouse Xist Stellaris® FISH Probes with Quasar® 570 Dye LGC Biosearch Technologies SMF-3011-1, RRID: AB_3076254
R-Phycoerythrin labelled Goat anti-Human IgG Fc Invitrogen 12-4998-82; AB_465926
Bacterial and virus strains
Biological samples
Human whole blood (healthy control serum) Stanford Blood Center https://stanfordbloodcenter.org/researchlabs/research-productsand-services/bloodproducts/
SLE patient sera This paper; Johns Hopkins NA
DM patient sera This paper; Stanford University NA
SSc patient sera This paper; Johns Hopkins, Stanford University NA
Chemicals, peptides, and recombinant proteins
Pristane Sigma-Aldrich P9622-10X1ML
PBS 1x Thermo Fisher Scientific Cat # 10010049
Doxycyline hyclate Sigma-Aldrich D9891-5G
DNAse I Thermo Fisher Scientific Cat# 18068015
O.C.T. Compound Tissue-Tek Cat# 4583
Fisherbrand Superfrost Plus Microscope Slides Fisher Scientific Cat# 12-550-15
Paraformaldehyde Fisher Scientific Cat# 50-980-487
TritonX-100 Acros Organics AC327371000
Ethanol Gold Shield Cat# 412804
Stellaris® RNA FISH Wash Buffer A LGC Biosearch Technologies SMF-WA1-60
Stellaris® RNA FISH Hybridization Buffer LGC Biosearch Technologies SMF-HB1-10
VECTASHIELD Mounting Medium with DAPI Vector Laboratories H-1200
VWR® Micro Cover Glasses VWR 48366-227
HypoThermosol FRS BioLifeSolutions Cat# 101102
CellTrics® Disposable Cell Strainers Sysmex 04-004-2327
eBioscience 1X RBC Lysis Buffer Thermo Fisher
Scientific
Cat# 00-4333-57
BAMBANKER Wako Cat# 203-14681
Fetal Bovine Serum Thermo Fisher Scientific A3160502
Protector RNase Inhibitor Sigma-Aldrich Cat# 3335399001
Critical commercial assays
EasySep Mouse CD4+ T cell Isolation Kit STEMCELL Technologies Cat# 19852
Mouse Anti-Nuclear Antibody Kit MyBioSource.com MBS731183
RNeasy Plus Mini Kit Qiagen Cat# 74136
High-Capacity cDNA Reverse Transcription Kit Applied Biosystems Cat# 4368814
TruSeq® Stranded mRNA Library Prep Illumina Cat# 20020594
Chromium Single Cell Multiome ATAC + Gene Expression Reagent Bundle 10x Genomics PN-1000283
Chromium Next GEM Chip J Single Cell Kit 10x Genomics PN-1000234
Single Index Kit N Set A, 96 rxns 10x Genomics PN-1000212
Dual Index Kit TT Set A, 96 rxns 10x Genomics PN-1000215
Deposited data
Raw and processed sequencing data (single cell) This paper GEO database: GSE249830
Raw and processed bulk ATAC-seq data This paper GEO database: GSE249830
Raw and processed bulk RNA-seq data This paper GEO database: GSE249830
Raw and processed SLE antigen array data This paper Table S3
Raw and processed XIST antigen array data (patients) This paper Table S4
Raw and processed XIST antigen array data (mouse) This paper Table S6
Experimental models: Cell lines
Experimental models: Organisms/strains
SJL/J mouse Jackson Laboratories Strain# 000686; RRID:IMSR_JAX:000686
C57BL6/J mouse Jackson Laboratories Strain# 000664; RRID:IMSR_JAX:000664
ΔRepA-Xist transgenic mouse This paper Anton Wutz
Oligonucleotides
Mouse Xist Forward (qRT-PCR) GACAACAATGGGAGCTGGTT Elim Biopharmaceuti cals, Inc. Custom Oligos
Mouse Xist Reverse (qRT-PCR) GCAACCCCAGCAATAGTCAT Elim Biopharmaceuti cals, Inc. Custom Oligos
Mouse GAPDH Forward (qRT-PCR) TGTGCAGTGCCAGCCTCGTC Elim Biopharmaceuti cals, Inc. Custom Oligos
Mouse GAPDH Reverse (qRT-PCR) TGCCACTGCAAATGGCAGCC Elim Biopharmaceuti cals, Inc. Custom Oligos
Neomycin Forward (genotyping) AGGATCTCCTGTCATCTCACCTTGCTCCTG Elim Biopharmaceuti cals, Inc. Custom Oligos
Neomycin Reverse (genotyping) AAGAACTCGTCAAGAAGGCGATAGAAGGCG Elim Biopharmaceuti cals, Inc. Custom Oligos
CMV (genotyping, Forward) GCTGGTTTAGTGAACCGTCAG Elim Biopharmaceuti cals, Inc. Custom Oligos
Mouse Xist (genotyping, Reverse) ACAAAGATTGGGCTGTCGAG Elim Biopharmaceuti cals, Inc. Custom Oligos
Recombinant DNA
Software and algorithms
Cellranger 10x Genomics https://support.10xgenomics.com/single-cellgeneexpression/software/overview/welcome
Prism Graphpad https://www.graphpad.com/scientific-software/prism/software/prism/
CIBERSORT Newman et al.28 https://cibersortx.stanford.edu/cshome.php
STAR Dobin et al.86 https://github.com/alexdobin/STAR
RSEM Li et al.87 https://github.com/deweylab/RSEM
Bowtie2 Langmead and Salzberg88 http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
Samtools Li et al.89 http://www.htslib.org/
MACS2 Zhang et al.90 https://github.com/macs3-project/MACS
DESeq2 Love et al.92 https://bioconductor.org/packages/release/bioc/html/DESeq2.html
g:profiler Raudvere et al.93 https://biit.cs.ut.ee/gprofiler/gost
Seurat Hao et al.94 https://satijalab.org/seurat/
ArchR Granja JM, Corces MR et al.95 https://www.archrproject.com/