Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| 7-AAD | BD Biosciences | Cat # 559925, RRID:AB_2869266 |
| FITC anti-mouse CD4 (clone GK1.5) | BioLegend | Cat # 100406, RRID:AB_312690 |
| TruStain FcX PLUS (anti-mouse CD16/32, clone S17011E) | BioLegend | Cat # 156604, RRID:AB_2783137 |
| APC anti-mouse CD45 (clone 30-F11) | BioLegend | Cat # 103112, RRID:AB_312977 |
| Mouse Xist Stellaris® FISH Probes with Quasar® 570 Dye | LGC Biosearch Technologies | SMF-3011-1, RRID: AB_3076254 |
| R-Phycoerythrin labelled Goat anti-Human IgG Fc | Invitrogen | 12-4998-82; AB_465926 |
| Bacterial and virus strains | ||
| Biological samples | ||
| Human whole blood (healthy control serum) | Stanford Blood Center | https://stanfordbloodcenter.org/researchlabs/research-productsand-services/bloodproducts/ |
| SLE patient sera | This paper; Johns Hopkins | NA |
| DM patient sera | This paper; Stanford University | NA |
| SSc patient sera | This paper; Johns Hopkins, Stanford University | NA |
| Chemicals, peptides, and recombinant proteins | ||
| Pristane | Sigma-Aldrich | P9622-10X1ML |
| PBS 1x | Thermo Fisher Scientific | Cat # 10010049 |
| Doxycyline hyclate | Sigma-Aldrich | D9891-5G |
| DNAse I | Thermo Fisher Scientific | Cat# 18068015 |
| O.C.T. Compound | Tissue-Tek | Cat# 4583 |
| Fisherbrand™ Superfrost™ Plus Microscope Slides | Fisher Scientific | Cat# 12-550-15 |
| Paraformaldehyde | Fisher Scientific | Cat# 50-980-487 |
| TritonX-100 | Acros Organics | AC327371000 |
| Ethanol | Gold Shield | Cat# 412804 |
| Stellaris® RNA FISH Wash Buffer A | LGC Biosearch Technologies | SMF-WA1-60 |
| Stellaris® RNA FISH Hybridization Buffer | LGC Biosearch Technologies | SMF-HB1-10 |
| VECTASHIELD Mounting Medium with DAPI | Vector Laboratories | H-1200 |
| VWR® Micro Cover Glasses | VWR | 48366-227 |
| HypoThermosol FRS | BioLifeSolutions | Cat# 101102 |
| CellTrics® Disposable Cell Strainers | Sysmex | 04-004-2327 |
| eBioscience™ 1X RBC Lysis Buffer | Thermo Fisher Scientific |
Cat# 00-4333-57 |
| BAMBANKER | Wako | Cat# 203-14681 |
| Fetal Bovine Serum | Thermo Fisher Scientific | A3160502 |
| Protector RNase Inhibitor | Sigma-Aldrich | Cat# 3335399001 |
| Critical commercial assays | ||
| EasySep Mouse CD4+ T cell Isolation Kit | STEMCELL Technologies | Cat# 19852 |
| Mouse Anti-Nuclear Antibody Kit | MyBioSource.com | MBS731183 |
| RNeasy Plus Mini Kit | Qiagen | Cat# 74136 |
| High-Capacity cDNA Reverse Transcription Kit | Applied Biosystems | Cat# 4368814 |
| TruSeq® Stranded mRNA Library Prep | Illumina | Cat# 20020594 |
| Chromium Single Cell Multiome ATAC + Gene Expression Reagent Bundle | 10x Genomics | PN-1000283 |
| Chromium Next GEM Chip J Single Cell Kit | 10x Genomics | PN-1000234 |
| Single Index Kit N Set A, 96 rxns | 10x Genomics | PN-1000212 |
| Dual Index Kit TT Set A, 96 rxns | 10x Genomics | PN-1000215 |
| Deposited data | ||
| Raw and processed sequencing data (single cell) | This paper | GEO database: GSE249830 |
| Raw and processed bulk ATAC-seq data | This paper | GEO database: GSE249830 |
| Raw and processed bulk RNA-seq data | This paper | GEO database: GSE249830 |
| Raw and processed SLE antigen array data | This paper | Table S3 |
| Raw and processed XIST antigen array data (patients) | This paper | Table S4 |
| Raw and processed XIST antigen array data (mouse) | This paper | Table S6 |
| Experimental models: Cell lines | ||
| Experimental models: Organisms/strains | ||
| SJL/J mouse | Jackson Laboratories | Strain# 000686; RRID:IMSR_JAX:000686 |
| C57BL6/J mouse | Jackson Laboratories | Strain# 000664; RRID:IMSR_JAX:000664 |
| ΔRepA-Xist transgenic mouse | This paper | Anton Wutz |
| Oligonucleotides | ||
| Mouse Xist Forward (qRT-PCR) GACAACAATGGGAGCTGGTT | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| Mouse Xist Reverse (qRT-PCR) GCAACCCCAGCAATAGTCAT | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| Mouse GAPDH Forward (qRT-PCR) TGTGCAGTGCCAGCCTCGTC | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| Mouse GAPDH Reverse (qRT-PCR) TGCCACTGCAAATGGCAGCC | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| Neomycin Forward (genotyping) AGGATCTCCTGTCATCTCACCTTGCTCCTG | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| Neomycin Reverse (genotyping) AAGAACTCGTCAAGAAGGCGATAGAAGGCG | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| CMV (genotyping, Forward) GCTGGTTTAGTGAACCGTCAG | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| Mouse Xist (genotyping, Reverse) ACAAAGATTGGGCTGTCGAG | Elim Biopharmaceuti cals, Inc. | Custom Oligos |
| Recombinant DNA | ||
| Software and algorithms | ||
| Cellranger | 10x Genomics | https://support.10xgenomics.com/single-cellgeneexpression/software/overview/welcome |
| Prism | Graphpad | https://www.graphpad.com/scientific-software/prism/software/prism/ |
| CIBERSORT | Newman et al.28 | https://cibersortx.stanford.edu/cshome.php |
| STAR | Dobin et al.86 | https://github.com/alexdobin/STAR |
| RSEM | Li et al.87 | https://github.com/deweylab/RSEM |
| Bowtie2 | Langmead and Salzberg88 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al.89 | http://www.htslib.org/ |
| MACS2 | Zhang et al.90 | https://github.com/macs3-project/MACS |
| DESeq2 | Love et al.92 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| g:profiler | Raudvere et al.93 | https://biit.cs.ut.ee/gprofiler/gost |
| Seurat | Hao et al.94 | https://satijalab.org/seurat/ |
| ArchR | Granja JM, Corces MR et al.95 | https://www.archrproject.com/ |