TABLE 1.
Oligonucleotide primers used for RT PCR and sequence analysis
| Primer | Sequence (5′ to 3′) | Positiona | Orientation | Derived from |
|---|---|---|---|---|
| 294 | CTTACATGGAGACACTCAACCA | 616 to 637 | Negative | ETV |
| 293 | AGCAACCTTGAGGTTGGGTCTGT | 502 to 524 | Positive | ETV |
| 253 | GAGAAAGAGCCAAGATGATT | −14 to 6 | Positive | ETV |
| 542 | GAGACACTATCTTTAG | −29 to −14 | Positive | ETV |
| 620 | CGCCAAACTCTGCAACTCAGGTGGA | 340 to 365 | Negative | PoTV |
| 593 | GTCAGAATAGATCACGCATT | 170 to 189 | Positive | PoTV |
a
Numerical position on the PoTV genome as determined from the start codon of the N protein gene.