Table 1.

Oligonucleotide primers used.

Primer	Sequence	Description
sGFP-Rnq-Df	gatgaactgtacaaaggccaaagatctgaaATGgatacgga	sGFP to RNQ1 junction
Yes-Rnq-Rf	tacatgatgcggccctctaga atcatcgtTCAgtagcggt	RNQ1 to pYes2 junction
Yes-Rnq277x-Rf	catgatgcggccctctagaTTAgtaagattgagccatggag	RNQ1-277 to pYes2 junction
Yes-Rnq355x-Rf	catgatgcggccctctagaTTAatactcattagcctgttgctg	RNQ1-355 to pYes2 junction
Yes-Rnq381-Rf	catgatgcggccctctaga TCAgtagcgattggagttctggtttccgcc	RNQ1-381 to pYes2 junction
Yes-Rnq392-Rf	catgatgcggccctctaga TCAgtagcggttgccagaaaaattgaagga	RNQ1-392 to pYes2 junction
sGfp-Rnq72cDf	ctgtacaaaggccaaagatcctacctgggcaataactcc	sGFP to RNQ72C junction
Rnq1-CrC-D	gacttacggaagaccgcaatacgg	CRISPR spacer for pWS172 plasmid
Rnq1-CrC-R	aaacccgtattgcggtcttccgta	CRISPR spacer for pWS172
Rnq1-CR2-D	gactactgaatcatcgttcagtag	CRISPR spacer for pWS172
Rnq1-CR2-R	aaacctactgaacgatgattcagt	CRISPR spacer for pWS172
Yes-Rnq1-Df	cggatcggactactagcag caaagatctgaaATGgatacg	pYes2 to RNQ1 junction
Yes-GFP65-Rf	atgatgcggccctctaga cgcgccctatttgtatagtt	pYes2 to GFP junction
Rnq1-Din	gggagccaaagtatgggtg	RNQ1 inside ORF
Rnq1-R1	gggcatcctgcagagataca	RNQ1 terminator
YesXba-Rnq3′D	tctagagggccgcatcatg cgatgattcagttcgccttc	PCR of RNQ1 3′ region

Sequences related to pYes2 are italicized, those related to GFP are underlined, and those related to RNQ1 are bold. RNQ1 start and stop codons are in uppercase. Primers ending with D or Df are on the coding strand, those ending with R or Rf are reverse primers. The first four nucleotides of the CRISPR oligonucleotides form sticky ends for ligation to the Esp3I site of pWS172 [37].