Key resources table.

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Sequence-based reagent	WTISB_F	This Paper	PCR primer	3’ - TGAGATCCGAATTCGAGCTCTAATTTTG - 5’
Sequence-based reagent	WTISB_R	This paper	PCR primer	3’ - GCTGTGATGATGATGATGATGGCTGCTG - 5’
Sequence-based reagent	ISBMut6_F	This paper	PCR primer	3’ - CTTGAGCGTATCCAAGAGGAGGCCCGACGCATGTTCACC - 5’
Sequence-based reagent	ISBMut6_R	This paper	PCR primer	3’ - GGTGAACATGCGTCGGGCCTCCTCTTGGATACGCTCAAG - 5’
Sequence-based reagent	ISBMut7_F	This paper	PCR primer	3’ - CGTATCCAAGAGCGAGCCGAGCGCATGTTCACCAGAGAA - 5’
Sequence-based reagent	ISBMut7_R	This paper	PCR primer	3’ - TTCTCTGGTGAACATGCGCTCGGCTCGCTCTTGGATACG - 5’
Sequence-based reagent	WTISB_F_2	This paper	PCR primer	3’ - CCGTCTCGCCCAAATCTGCA - 5’
Sequence-based reagent	WTISB_R_2	This paper	PCR primer	3’ - GCTGTGATGATGATGATGATGGCTGCTG - 5’
Sequence-based reagent	IMut1SB_G_Block	This paper	Oligonucleotide	See Supplementary file 2
Sequence-based reagent	IMut2SB_G_Block	This paper	Oligonucleotide	See Supplementary file 2
Sequence-based reagent	IMut3SB_G_Block	This paper	Oligonucleotide	See Supplementary file 2
Sequence-based reagent	IMut4SB_G_Block	This paper	Oligonucleotide	See Supplementary file 2
Sequence-based reagent	IMut5SB_G _Block	This paper	Oligonucleotide	See Supplementary file 2
Sequence-based reagent	ISBMut_G_Block	This paper	Oligonucleotide	See Supplementary file 2
Sequence-based reagent	IMut6SBMut_G_Block	This paper	Oligonucleotide	See Supplementary file 2
Strain, strain background (Escherichia coli)	Rosetta 2 (DE3) plysS	Novagen	71403	Electrocompetent cells
Cell line (Homo sapiens)	T-Rex HeLa Cell Line	Thermo Fisher Scientific	R71407
Recombinant DNA reagent	pET28a_ISB	Trivedi et al., 2019		6xHis-INCENP1-58, FL Survivin and FL Borealin
Commercial assay, kit	NEB Hifi DNA Assembly Kit	New England Biolabs	E5520S	For molecular cloning
Other	HisTrap HP Column	Cytiva/GE Life Sciences	17524801	For protein purification
Other	Hi-Load 16/60 Superdex-200 pg	Cytiva/GE Life Sciences	28989335	For protein purification
Other	C18 HPLC Column, 0.3×75 mm2	Agilent		For HXMS experimentation
Other	TARGA C8 5 µM Piccolo HPLC column	Higgins Analytical		For HXMS experimentation
Other	Leica DMI6000 B	Leica Microsystems		For differential interference contrast microscopy
Other	Discovery M120SE Sorvall Ultracentrifuge	New Life Scientific		For sedimentation and saturation concentration assays
Other	LTQ Orbitrap XL Mass Spectrometer	Thermo Fisher Scientific		For HXMS data acquisition
Other	Exactive Plus EMR Orbitrap Mass Spectrometer	Thermo Fisher Scientific		For HXMS data acquisition
Other	NanoDrop 2000 UV-Vis Spectrophotometer	Thermo Fisher Scientific	ND2000CLAPTOP	For turbidity measurements
Other	Zeiss Observer-Z1 Microscope	Zeiss		For optoDroplet assay
Software	XCalibur	Thermo Fisher Scientific	OPTON-30965	For HXMS data acquisition
Software	ExMS2	Kan et al., 2019		For HXMS data processing
Software	MATLAB	Mathworks		For HXMS data processing
Software	RStudio	Posit		For HXMS data processing
Software	Bioworks 3.3	Thermo Fisher Scientific		For HXMS data processing
Software	HDExaminer	Sierra Analytics		For HXMS data processing
Software	GelQuant Express Analysis Software	Fisher Scientific		For densitometry measurements
Software	Fiji (ImageJ)	National Institutes of Health (NIH)		To analyze images
Software	Prism	GraphPad		For data processing