Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-mouse CD4 (Clone: RM4–5) APC | BioLegend | Cat# 100516; RRID: AB_312719 |
| Anti-mouse CD4 (Clone: GK1.5) FITC | BioLegend | Cat# 10040;, RRID: AB_312690 |
| Anti-mouse CD4 (Clone: RM4–5) BV510 | BioLegend | Cat# 100559; RRID: AB_2562608 |
| Anti-mouse CD4 (Clone: RM4–5) BV711 | BioLegend | Cat# 100549; RRID: AB_11219396 |
| Anti-mouse CD4 (Clone: RM4–5) BV785 | BioLegend | Cat# 100552; RRID: AB_2563053 |
| Anti-mouse CD5 (Clone: 57–7.3) FITC | BioLegend | Cat# 100606; RRID: AB_312735 |
| Anti-mouse CD8 (Clone: 53–6.7) PE-eFluor 610 | Thermo Fisher Scientific | Cat# 61–0081-80; RRID: AB_2574523 |
| Anti-mouse CD8 (Clone:53–6.7) BV785 | BioLegend | Cat# 100749; RRID: AB_11218801 |
| Anti-Mouse CD8 (Clone: 53.6–7) PerCP-Cy5.5 | BioLegend | Cat# 100733; RRID: AB_2075239 |
| Anti-mouse CD8 (Clone:53–6.7) BV711 | BioLegend | Cat# 100744; RRID: AB_2562609 |
| Anti-mouse CD11b (Clone: M1/70) AF700 | BioLegend | Cat# 101222; RRID: AB_493705 |
| Anti-mouse CD11c (Clone: N418) BV785 | BioLegend | Cat# 117335; RRID: AB_11219204 |
| Anti-mouse CD24 (Clone : M1/69) Pe/Cy7 | BioLegend | Cat# 101821; RRID: AB_756047 |
| Anti-mouse CD25 (Clone: PC61) PerCP-Cy5.5 | BioLegend | Cat# 102030; RRID: AB_893288 |
| Anti-mouse CD25 (Clone: PC61) Pacific Blue | BioLegend | Cat# 102021; RRID: AB_493642 |
| Anti-mouse CD44 (Clone: IM7) BV785 | BioLegend | Cat# 103059; RRID: AB_2571953 |
| Anti-mouse CD44 (Clone: IM7) AF700 | BioLegend | Cat# 103026; RRID: AB_493713 |
| Anti-Mouse CD44 (Clone: IM7) PerCP-Cy5.5 | BioLegend | Cat# 103035; RRID: AB_10639933 |
| Anti-mouse CD45 (Clone: 30-F11) AF700 | BioLegend | Cat# 103128; RRID: AB_493715 |
| Anti-mouse CD45 (Clone: 30-F11) FITC | BioLegend | Cat# 103108; RRID: AB_312973 |
| Anti-mouse CD45RB (Clone: C363–16A) PE | BioLegend | Cat# 103307; RRID: AB_313014 |
| Anti-mouse CD62L (Clone: MEL-14) BV421 | BioLegend | Cat# 104435; RRID: AB_10900082 |
| Anti-mouse CD90.2 (Clone: 53–2.1) AF700 | BioLegend | Cat# 140324; RRID: AB_2566740 |
| Anti-rat CD90/mouse CD90.1 (Thy-1.1) (Clone: OX-7) APC/Fire™ | BioLegend | Cat# 202543; RRID: AB_2650816 |
| Anti-mouse/pig CD117 (Clone: 2B8) APC-eF780 | ThermoFisher Scientific | Cat# 47–1171-82; RRID: AB_1272177 |
| Anti-mouse CD193 (CCR3) (Clone: J07325) APC | BioLegend | Cat# 144511; RRID: AB_2565737 |
| Anti-mouse TCRb (Clone: H57–597) FITC | BD Biosciences | Cat# 553170; RRID: AB_394682 |
| Anti-mouse TCRb (Clone: H57–597) APC | BioLegend | Cat# 109212; RRID: AB_313435 |
| Anti-mouse TCRb (Clone: H57–597) PE | BioLegend | Cat# 109207; RRID: AB_313430 |
| Anti-mouse TCRb (Clone: H57–597) BB700 | BD Biosciences | Cat# 745846; RRID: AB_2743291 |
| Anti-mouse TCRb (Clone: H57–597) PE/Cy7 | BioLegend | Cat# 109222; RRID: AB_893625 |
| Anti-mouse IFNγ (Clone: XMG1.2) PerCP/Cyanine5.5 | BioLegend | Cat# 505821; RRID: AB_961361 |
| Anti-mouse IFNγ (Clone: XMG1.2) - APC | BD Biosciences | Cat# 554413; RRID: AB_398551 |
| Anti-mouse IFNγ (Clone: XMG1.2) - AF700 | BD Biosciences | Cat# 557998; RRID: AB_396979 |
| Anti-mouse IL-13 Monoclonal Antibody (Clone: eBio13A) PE-eFluor™ 610 | Thermo Fisher Scientific | Cat# 61–7133-80; RRID: AB_2574653 |
| Anti-mouse IL-13 (Clone: eBio13A) efluor 450 | Thermo Fisher Scientific | Cat# 48–7133-80; RRID: AB_11218502 |
| Anti-mouse IL-13 (Clone: eBio13A) Alexa488 (FITC) | Thermo Fisher Scientific | Cat# 53–7133-82; RRID: AB_2016708 |
| Anti-mouse IL-17A (Clone: TC11–18H10.1) PE | BioLegend | Cat# 506903; RRID: AB_315463 |
| Anti-mouse IL-17A (Clone: TC11–18H10.1) BV785 | BioLegend | Cat# 506928; RRID: AB_2629787 |
| Anti-mouse IL-4 (Clone: 11B11) PE | BioLegend | Cat# 504103; RRID: AB_315317 |
| Anti-mouse IL-5 (Clone: TRFK5) PE | ThermoFisher Scientific | Cat# 12–7052-81; RRID: AB_763588 |
| Anti-mouse IL-5 (Clone: TRFK5) APC | BioLegend | Cat# 504305; RRID: AB_315329 |
| Anti-mouse Granzyme B (Clone: GB11) BV421 | BioLegend | Cat# 515407; RRID: AB_2562195 |
| T-bet Monoclonal Antibody (eBio4B10 (4B10)), PE-Cyanine7 | eBioscience (Thermo Fisher Scientific) | Cat# 25–5825-80; RRID: AB_11041809 |
| Anti-mouse/Human T-bet (Clone: 4B10) PE | eBioscience (Thermo Fisher Scientific) | Cat# 12–5825-80; RRID: AB_925762 |
| Anti-mouse/Human T-bet (Clone: 4B10) BV711 | BioLegend | Cat# 644819; RRID: AB_11218985 |
| Anti-mouse/Human T-bet (Clone: 4B10) BV421 | BioLegend | Cat# 644815; RRID: AB_10896427 |
| Anti-mouse/Human T-bet (Clone: 4B10) PeCy7 | Thermo Fisher Scientific | Cat# 25–5825-82; RRID: AB_11042699 |
| Anti-Mouse RORγt Antibody (Clone: Q31–378) BV421 | BD Biosciences | Cat# 562894; RRID: AB_2687545 |
| Anti-mouse RORγt (Clone: B2D) PE | Thermo Fisher Scientific | Cat# 12–6981-82; RRID: AB_10807092 |
| Anti-mouse RORγt (Clone: B2D) PE-eFluor 610 | Thermo Fisher Scientific | Cat# 61–6981-80; RRID: AB_2574649 |
| Anti-mouse Ly6G (Clone: 1A8) FITC | BioLegend | Cat# 127606; RRID: AB_1236494 |
| Anti-mouse Eomes (Clone: Dan11mag) APC | ThermoFisher Scientific | Cat# 17–4875-82; RRID: AB_2866428 |
| Anti-mouse GATA3 (Clone: L50–823) BV711 | BD Biosciences | Cat# 565449; RRID: AB_2739242 |
| Anti-mouse GATA3 (Clone: L50–823) PeCy7 | BD Biosciences | Cat# 560405; RRID: AB_1645544 |
| Anti-mouse FoxP3 (Clone: MF-14) BV421 | BioLegend | Cat# 126410; RRID: AB_2105047 |
| Anti-mouse FoxP3 (Clone: MF-14) PE | BioLegend | Cat# 126403; RRID: AB_1089118 |
| Anti-mouse NK1.1 (Clone: PK136) BV711 | BioLegend | Cat# 108745; RRID: AB_2563286 |
| Anti-mouse NK1.1 (Clone: PK136) FITC | BioLegend | Cat# 108705; RRID: AB_313392 |
| Anti-Mouse CD1d-PE (PBS57 - NIH Core) | NIH Tetramer Core Facility | Item # 14461; RRID: N/A |
| Anti-mouse SiglecF (Clone: S17007L) PE | BioLegend | Cat# 155505; RRID: AB_2750234 |
| Anti-mouse Siglec-F (Clone: E50–2440) PE-CF594 | BD Biosciences | Cat# 562757; RRID: AB_2687994 |
| Anti-mouse T1/ST2 (Clone: DIH9) PeCy7 | BioLegend | Cat# 145304; RRID: AB_2561915 |
| Anti-CD3ε Armenian Hamster Monoclonal Antibody (LEAF - Clone: 145–2C11) | BioLegend | Cat# 100302; RRID: AB_312667 |
| Anti-CD28 Syrian Hamster Monoclonal Antibody (Clone: 37.51) |
BD Biosciences | Cat# 553294; RRID: AB_394763 |
| InVivoMab anti-mouse IFNγ (Clone: XMG1.2) | Bio X Cell | Cat# BE0055; RRID: AB_1107694 |
| InVivoMab anti-mouse IL-4 (Clone: 11B11) | Bio X Cell | Cat# BE0045; RRID: AB_1107707 |
| Anti-CTCF | Millipore | Cat# 07–729; RRID: AB_441965 |
| Anti-Acetyl-Histone H3 (Lys27) (D5E4) | Cell Signaling Technology | Cat# 8173; RRID: AB_10949503 |
| Anti-Ets1 (C-20) | Santa Cruz Biotechnology | Cat# sc-350; RRID: AB_2100688 |
| Anti-CD8 (biotin) (clone: 53–6.7) | BioLegend | Cat# 100704; RRID: AB_312743 |
| Anti-CD19 (biotin) (clone: 6D5) | BioLegend | Cat# 115504; RRID: AB_313639 |
| Anti-CD45R (biotin) (clone: RA3–6B2 | BioLegend | Cat# 103204; RRID: AB_312989 |
| Anti-Gr1 (biotin) (clone: RB6–8C5) | BioLegend | Cat# 108403; RRID: AB_313368 |
| Anti-TCRg/d (biotin) (clone: GL3) | BioLegend | Cat# 118103; RRID: AB_313827 |
| Anti-CD11c (biotin) (clone: N418) | BioLegend | Cat# 117303; RRID: AB_313772 |
| Anti-I-A/I-E (biotin) (clone: M5) | BioLegend | Cat# 107604; RRID: AB_313319 |
| Anti-CD25 (biotin) (clone: PC61) | BioLegend | Cat# 102003; RRID: AB_312852 |
| Anti-NK1.1 (biotin) (clone:PK136) | BioLegend | Cat# 108703; RRID:AB_313390 |
| Chemicals, peptides, and recombinant proteins | ||
| Recombinant IL-2 (mouse) | BioLegend | Cat# 575402 |
| Recombinant IL-12 (mouse) | BioLegend | Cat# 577002 |
| Recombinant TGFb (mouse) | BioLegend | Cat# 763102 |
| Recombinant IL-4 (mouse) | BioLegend | Cat# 574302 |
| Recombinant IL-6 (mouse) | BioLegend | Cat# 575702 |
| Viability Dye LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit | ThermoFisher Scientific | Cat# L34957 |
| Fixable Viability Dye eFluor™ 506 | ThermoFisher Scientific | Cat# 65–0866-14 |
| Fixable Viability Dye eFluor™ 520 | ThermoFisher Scientific | Cat# 65–0867-14 |
| Fixable Viability Dye eFluor™ 780 | ThermoFisher Scientific | Cat# 50–112-9035 |
| CellTrace™ Violet Cell Proliferation Kit, for flow cytometry | ThermoFisher Scientific | Cat# C34557 |
| HDM extracts (Dermatophagoides pteronyssinus extracts) | Fischer Scientific (Greer Laboratories) | Cat# NC9756554 (lot: 361863, 385930, 387032) |
| Phorbol 12-myristate 13-acetate (PMA) | Sigma- Aldrich | Cat# P8139–1MG |
| Ionomycin calcium salt from Streptomyces conglobatus | Sigma- Aldrich | Cat# I0634–1MG |
| GolgiPlug Protein Transport Inhibitor | BD Biosciences | Cat# 555029 |
| RPMI 1640 medium | Invitrogen | Cat# 11875085 |
| Fetal Bovine Serum | Sigma- Aldrich | Cat# F2442 |
| GemCell™ - Fetal Bovine Serum | Gemini Bio | Cat# 100–500, Lot# A03HOOK |
| 2-bMercaptoethanol | Sigma | Cat# M6250–10ML |
| ACK Lysing Buffer | ThermoFisher Scientific | Cat# A1049201 |
| Deoxyribonuclease I from bovine pancreas | Sigma-Aldrich | Cat# D5025 |
| Collagenase D | Roche | Cat# 11088866001 |
| Dispase (5U/ml) | STEMCELL Technologies | Cat# 07913 |
| HEPES | ThermoFisher | Cat#15630080 |
| Non-Essential Amino Acids | ThermoFisher | Cat# 11140050 |
| Penicillin-Streptomycin | ThermoFisher | Cat# 15140122 |
| Sodium Pyruvate | ThermoFisher | Cat# 11360070 |
| L-Glutamine (200 mM) | ThermoFisher | Cat# 25030081 |
| Percoll® Density Gradient Media | VWR | Cat# 17–0891-01 |
| Formaldehyde solution 16% | Thermo | Cat# PI28908 |
| cOmplete™, EDTA-free Protease Inhibitor Cocktail | Roche | Cat# 11873580001 |
| Qubit dsDNA HS Assay Kit | Invitrogen | Cat# Q32851 |
| Phusion PCR Master Mix | NEB | Cat# M0531 |
| Nextera XT Index Kit | Illumina | Cat# FC-131–1001 |
| SPRIselect | Beckman Coulter | Cat# B2331 |
| Polybrene | Sigma | Cat# H9268 |
| Lipofectamine 3000 | Thermo | Cat# L3000008 |
| Chloroquine | Sigma | Cat# C6628–25G |
| Secondary Oligopaint probe: /5Alex647N/ TGATCGACCACGGCCAAGACGGAGAG CGTGTG/ 3AlexF647N/ | https://www.pnas.org/doi/full/10.1073/pnas.1714530115 | N/A |
| Secondary Oligopaint probe: /5ATTO565N/ ACACN/ACCTTGCACGTCGTGGACCTCC TGCGCTA/ 3ATTO565N/ | https://www.pnas.org/doi/full/10.1073/pnas.1714530115 | N/A |
| Secondary Oligopaint probe: /5Alex488N/ CACAN/ACGCTCTTCCGTTCTATGCGAC GTCGGTG/ 3AlexF488N/ | https://www.pnas.org/doi/full/10.1073/pnas.1714530115 | N/A |
| Polysine microscope slides | Thermo Scientific | Cat# P4981–001 |
| Silicone isolators | Electron Microscopy Sciences | Cat# 70339–05 |
| Ethanol | Decon Laboratories | Cat# 2716 |
| Dimethylformamide | Sigma-Aldrich | Cat# D4551 |
| Polyvinylsulfonic acid (PVSA) | Sigma Aldrich | Cat# 278424 |
| Coverslips | Fisher Scientific | Cat# 12–548-5M |
| Nowrinkle rubber cement | Elmer’s | N/A |
| Slowfade Gold Antifade Reagent | Invitrogen by Thermo Fisher Scientific | Cat# S36936 |
| Dries instantly top coat | Sally Hansen’s | Cat# 45114 |
| Fixation/Permeabilization Solution Kit | BD Biosciences | Cat#554714 |
| Foxp3/ Transcription Factor Staining Buffer Set | Thermo | Cat# 00–5523-00 |
| Critical commercial assays | ||
| CUTANA™ ChIC/CUT&RUN Kit | EpiCypher | Cat# 14–1048 |
| Tn5 Transposase | Illumina | Cat# FC-121–1030 |
| SMARTer Stranded Total RNA-Seq Kit – Pico Input Mammalian kit | Takara | Cat# 635006 |
| NEBNext Ultra II DNA Library Prep Kit for Illumina | NEB | Cat# E7645S |
| D1000 ScreenTape | Agilent | Cat# 5067–5582 |
| D1000 Reagents | Agilent | Cat# 5067–5583 |
| High Sensitivity D1000 ScreenTape | Agilent | Cat# 5067–5584 |
| High Sensitivity D1000 Reagents | Agilent | Cat# 5067–5585 |
| Genomic DNA ScreenTape | Agilent | Cat# 5067–5365 |
| Genomic DNA Reagents | Agilent | Cat# 5067–5366 |
| RNA ScreenTape | Agilent | Cat# 5067–5576 |
| RNA ScreenTape Ladder | Agilent | Cat# 5067–5578 |
| RNA ScreenTape Sample Buffer | Agilent | Cat# 5067–5577 |
| Arima HiC kit | Arima Genomics | N/A |
| Accel-NGS 2S Plus DNA Library Kit | Swift Biosciences | Cat# 21024 |
| MinElute Reaction Cleanup Kit | QIAGEN | Cat# 28204 |
| QIAQuick PCR Purification Kit | QIAGEN | Cat# 28104 |
| RNeasy Plus Micro Kit | QIAGEN | Cat# 74034 |
| EasySep™ Mouse Naïve CD4+ T Cell Isolation Kit | StemCell | Cat# 19765 |
| Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle, 16 rxns | 10X Genomics | PN-1000283 |
| Chromium Next GEM Chip J Single Cell Kit, 48 rxns | 10X Genomics | PN-1000234 |
| Single Index Kit N Set A, 96 rxns | 10X Genomics | PN-1000212 |
| Dual Index Kit TT Set A, 96 rxns | 10X Genomics | PN-1000215 |
| Deposited data | ||
| HiC, CUT&RUN, ATAC-seq and RNA-seq | This study | GEO: GSE211178 |
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6J | Jackson Laboratories | RRID:IMSR_JAX:000664 |
| Mouse: C57BL/6J-Ets1-SE−/− | This study | N/A |
| Mouse: CD4-cre (B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ) | The Jackson Laboratory | Cat#022071; RRID:IMSR_JAX:022071 |
| Mouse: Ets1fl/fl | Gift from Barbara L. Kee | N/A |
| Mouse: Rag1−/−mice (B6.129S7-Rag1tm1Mom/J) | Jackson Laboratories | Strain #:002216, RRID:IMSR_JAX:002216 |
| Recombinant DNA | ||
| Plasmid: MSCV-IRES-Thy1.1 DEST | Addgene | Cat# 17442 |
| Plasmid: pCL-Eco | (Naviaux et. al., 1996) | N/A |
| Software and algorithms | ||
| R 4.1.1 | R Core Team58 | https://www.R-project.org/ |
| Python 3.8 | Van Rossum & Drake59 | https://peps.python.org/pep-0569/ |
| FastQC v0.11.9 | Andrews60 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ |
| Trim_Galore v0.6.6 | Krueger61 | https://github.com/FelixKrueger/TrimGalore |
| BWA v0.7.17-r1188 | Li & Durbin 62 | https://bio-bwa.sourceforge.net |
| Picard v2.26.7 | Broad Institute63 | http://broadinstitute.github.io/picard/ |
| MACS2 v2.1.4 | Zhang et al.64 | https://pypi.org/project/MACS2/2.1.4/ |
| bamCoverage v3.3.2 | Ramirez et al.65 | https://deeptools.readthedocs.io/en/develop/content/tools/bamCoverage.html |
| STAR v2.7.7a | Dobin et al.66 | https://github.com/alexdobin/STAR |
| HiC-Pro v2.8 | Servant et al.67 | https://github.com/nservant/HiC-Pro/ |
| Homer | Heinz, Benner, Spann, Bertolino et al.68 | http://homer.ucsd.edu/homer/ |
| DESeq2 v1.34.0 | Love, Huber & Anders 69 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| bedtools v2.30.0 | Quinlan & Hall 70 | https://bedtools.readthedocs.io/en/latest/content/installation.html |
| GSEA v4.3.2 | Subramanian et al.71 | https://www.gsea-msigdb.org/gsea/index.jsp |
| Mango v1.2.0 | Phanstiel et al. 72 | https://github.com/dphansti/mango |
| igraph v1.3.5 | Csardi & Nepusz73 | https://igraph.org |
| Seurat v4.3.0 | Hao et al.45 | https://satijalab.org/seurat/ |
| Integrative Genome Browser v2.9.13 | Robinson et al.74 | https://software.broadinstitute.org/software/igv/ |
| Cell Ranger-ARC v2.0.0 | https://support.10xgenomics.com/single-cell-multiome-atac-gex/software/pipelines/latest/what-is-cell-ranger-arc | |
| Sushi v1.32.0 | Phanstiel75 | http://bioconductor.riken.jp/packages/3.1/bioc/html/Sushi.html |
| RajLabImageTool v1.0 | Raj et al.76 | https://github.com/arjunrajlaboratory/rajlabimagetools |
| Mustache v1.2.7 | Ardakany et al.77 | https://github.com/ay-lab/mustache |
| Deeptools v3.5.1 | Ramirez et al.65 | https://deeptools.readthedocs.io/en/develop/ |
| Oligominer | Beliveau et al.41 | https://github.com/beliveau-lab/OligoMiner |
| Cooltools | Open2C et al.78 | https://github.com/open2c/cooltools |
| Cool_compartment.py | Wang, Chandra, Goldman, Yoon & Ferrari et al. 79 | https://github.com/VahediLab/TCF13D_code/blob/master/Figure4/cool_compartment.py |
| GenomicRanges v1.46.1 | Lawrence et al.80 | https://bioconductor.org/packages/release/bioc/html/GenomicRanges.html |
| Matrix2insulation.pl | Crane et al.81 | https://github.com/dekkerlab/cworld-dekker/commit/09dd804f8cf9f7522351b97d6b22296b75d2d7f8 |
| Insulation2tads.pl | Crane et al.81 | https://github.com/dekkerlab/cworld-dekker/blob/master/scripts/perl/insulation2tads.pl |
| Stripenn v1.1.65.15 | Yoon et al.14 | https://github.com/ysora/stripenn |
| Coolpup.py v0.9.5 | Flyamer et al.82 | https://github.com/open2c/coolpuppy |
| Signac v1.9.0 | Stuart et al.83 | https://cran.r-project.org/web/packages/Signac/ |
| Samtools 1.11 | LI et al.84 | https://samtools.sourceforge.net |
| ImmGen | The Immunological Genome Project85 | https://www.immgen.org |
| ImageJ | Schneider et al.86 | https://imagej.net |
| ChIP-Atlas | Zou et al.87 | https://chip-atlas.org |
| FlowJo v10.8.2 | TreeStar | https://www.flowjo.com/solutions/flowjo/downloads |
| GraphPad Prism 9 Version 9.5.1 (528), January 24, 2023 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |