Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Flow cytometry lipid-modified oligos (LMOs)
| Reagent | Sequence | Company |
|---|---|---|
| LMO001A Lignoceric Anchor with DNA Oligo | Commercial source | Sigma-Aldrich |
| LMO001B Palmitic Co-anchor with DNA Oligo | Commercial source | Sigma-Aldrich |
| A647_Oligos | 5′-CCTTGGCACCCGAGAATTCCA-A_647-3 (complementary to the Anchor) or /5Alex647N/CCTTAGCCGCTAATAGGTGAGC (Complementary to Capture sequence of Barcoded Oligo CCTTGGCACCCGAGAATTCCA[Barcode]GCTCACCTATTAGCGGCTAAGG) | Oligo from IDT |
