TABLE 2.
Oligonucleotide primers used in this study
| Primer | Sequence (5′–3′) | Derivationa | Strand | Function (restriction site on 5′ end) |
|---|---|---|---|---|
| RAG198 | GGGGTACCGGAACGCTTCACGAA | Complementary to RNA linker cDNA and DNA linker | Linker PCR primer (KpnI) | |
| RAG199 | CATGGAGCTCTGAGGAGAGGCATGA | Ty1 GAG, bp 497–511 | Minus | RT and PCR primer for decapped full-length RNA, PCR primer for full-length (or paused) minus-strand DNA (SacI) |
| RAG208 | TTCGTGAAGCGTTCCGGTACCCCGC | DNA linker (5′ phosphorylated, 3′ blocked) | ||
| RAG228 | AAAAGAGCTCGACGCAAATGATGAGAAATAG | Ty1 U3, bp 5664–5684 | Plus | PCR primer for plus-strand strong-stop (includes full-length and PPT2-primed) DNA (SacI) |
| RAG233 | AAAAGAGCTCAGAATTGGGTGAATGTTGAG | Ty1 U5, bp 313–332 | Minus | PCR primer for decapped full-length RNA, minus-strand strong-stop (includes full-length) DNA (SacI) |
| RAG266 | AAAAGAGCTCCGAGACCAAGAAGAACATTG | Ty1 POL, bp 5475–5494 | Plus | PCR primer for plus-strand full-length (and PPT2-primed) DNA (SacI) |
| RAG321 | GCTGAAACGTCTAACGGATC | Ty1 GAG, bp 384–403 (gel purified) | Minus | RT primer for decapped full-length RNA |
| RAG322 | AGAATTGGGTGAATGTTGAG | Ty1 U5, bp 313–332 (gel purified) | Minus | Primer extension primer for U3/R region |
| RAG340 | ACACGGTACCGGGGGGGGGG | Complementary to poly(C)-tailed templates | TdT-PCR poly(G) primer (KpnI) | |
| RAG347 | GGAACGCUUCACGAA | RNA linker (gel purified) | ||
| RAG400 | CATGGAGCTCAAGCAGGTTGAGGAG | Ty2 GAG, bp 503–517 | Minus | PCR primer for full-length or paused minus-strand Ty2 DNA (SacI) |
| RAG478 | TACTCGAGACACGGTACCCCCCCCCC | Complementary to poly(G)-tailed templates | TdT-PCR poly(C) primer (KpnI) |
a
Numbering is based on the standard Ty1-H3 sequence (4). Except for RAG199, which is specific for Ty1, and RAG400, which is specific for Ty2, these sequences are identical for Ty1 and Ty2.