Skip to main content
Parasites & Vectors logoLink to Parasites & Vectors
. 2024 Apr 2;17:171. doi: 10.1186/s13071-024-06255-z

Comparison of a multiplex PCR with DNA barcoding for identification of container breeding mosquito species

Julia Reichl 1,2, Christina Prossegger 2, Sarah Petutschnig 1, Maria Sophia Unterköfler 2, Karin Bakran-Lebl 1, Mateusz Markowicz 1, Alexander Indra 1, Hans-Peter Fuehrer 2,
PMCID: PMC10985852  PMID: 38566239

Abstract

Background

Identification of mosquitoes greatly relies on morphological specification. Since some species cannot be distinguished reliably by morphological methods, it is important to incorporate molecular techniques into the diagnostic pipeline. DNA barcoding using Sanger sequencing is currently widely used for identification of mosquito species. However, this method does not allow detection of multiple species in one sample, which would be important when analysing mosquito eggs. Detection of container breeding Aedes is typically performed by collecting eggs using ovitraps. These traps consist of a black container filled with water and a wooden spatula inserted for oviposition support. Aedes mosquitoes of different species might lay single or multiple eggs on the spatula. In contrast to Sanger sequencing of specific polymerase chain reaction (PCR) products, multiplex PCR protocols targeting specific species of interest can be of advantage for detection of multiple species in the same sample.

Methods

For this purpose, we adapted a previously published PCR protocol for simultaneous detection of four different Aedes species that are relevant for Austrian monitoring programmes, as they can be found in ovitraps: Aedes albopictus, Aedes japonicus, Aedes koreicus, and Aedes geniculatus. For evaluation of the multiplex PCR protocol, we analysed 2271 ovitrap mosquito samples from the years 2021 and 2022, which were collected within the scope of an Austrian nationwide monitoring programme. We compared the results of the multiplex PCR to the results of DNA barcoding.

Results

Of 2271 samples, the multiplex PCR could identify 1990 samples, while species determination using DNA barcoding of the mitochondrial cytochrome c oxidase subunit I gene was possible in 1722 samples. The multiplex PCR showed a mixture of different species in 47 samples, which could not be detected with DNA barcoding.

Conclusions

In conclusion, identification of Aedes species in ovitrap samples was more successful when using the multiplex PCR protocol as opposed to the DNA barcoding protocol. Additionally, the multiplex PCR allowed us to detect multiple species in the same sample, while those species might have been missed when using DNA barcoding with Sanger sequencing alone. Therefore, we propose that the multiplex PCR protocol is highly suitable and of great advantage when analysing mosquito eggs from ovitraps.

Graphical Abstract

graphic file with name 13071_2024_6255_Figa_HTML.jpg

Supplementary Information

The online version contains supplementary material available at 10.1186/s13071-024-06255-z.

Keywords: Multiplex PCR, Aedes, Aedes albopictus, Mosquitoes, Austria, Monitoring, Identification

Background

Identification of mosquito species has become increasingly important in the last decades, due to the spread of (potentially) invasive species [1]. Container breeding mosquito species, which use natural or artificial containers for oviposition [2], are of particular concern due to their potential to be competent vectors for a variety of pathogens. The increase in global transport and traffic enables the introduction and spread of those container breeding mosquitoes worldwide while climate change and concomitant warmer temperatures facilitate establishment of stable populations [3, 4]. Additionally, container breeding Aedes mosquitoes can lay eggs that can withstand desiccation and cold temperatures, which allows overwintering in temperate regions, such as Europe [57]. In the last decades, three container breeding Aedes species have become particularly important for Europe, namely the Asian bush mosquito (Aedes japonicus), the Korean bush mosquito (Aedes koreicus) and the Asian tiger mosquito (Aedes albopictus).

Aedes albopictus, the Asian tiger mosquito, is the most relevant mosquito of these three for human and veterinary health. It is a competent vector for viruses, such as dengue, Zika and chikungunya [810], as well as for filarioid helminths, namely Dirofilaria repens and Dirofilaria immitis [1114]. The native regions of Ae. albopictus are the tropical and subtropical Asian-Pacific regions from where it spread over all continents except the Antarctica [6, 8]. In Europe, the Asian tiger mosquito was first found in Albania in 1979 and later in Italy in 1990/1991. Since then, it has spread to more than 25 European countries [1518].

Aedes japonicus originates from temperate regions of Eastern Asia [19] and was first reported in Europe in 2000 in northern France [20]. Under laboratory conditions, it is able to transmit viruses such as Japanese encephalitis virus [21, 22] and La Crosse virus [23], while West Nile virus has been identified multiple times in field-collected Ae. japonicus mosquitoes in the USA [24, 25]. Additionally, Austria reported the first natural infection of field-collected Ae. japonicus with Usutu virus in 2019 [26].

The Korean bush mosquito is native to Korea, Japan, north-eastern China and the far eastern parts of Russia [19, 2729]. In 2008, Ae. koreicus was first found in Europe, in eastern Belgium [30]. Since then, a few other European countries, such as Italy [31, 32], Germany [33, 34], Switzerland [35], Hungary [36], the European part of Russia [37] and Austria [38] reported the presence of Ae. koreicus. The role of Ae. koreicus in transmission of pathogens remains unclear. However, studies suggest that this species is able to transmit Japanese encephalitis and Dirofilaria immitis, as well as some viruses such as chikungunya, under laboratory conditions [3942].

In Austria, the first report of an exotic Aedes species showed the presence of Ae. japonicus in Styria in 2011 [43]. Aedes japonicus has been found in all provinces in Austria since its first report, has established stable populations, and can now be found in high numbers in all parts of Austria [44, 45]. Aedes albopictus was the second exotic Aedes species to be reported in Austria. It was first identified in Burgenland in 2012 [43]. After some initial single reports of Ae. albopictus mainly in Western Austria along the motorways, the number of reports has rapidly increased recently [38, 45]. In 2020, Ae. albopictus was first identified in Vienna, the capital city of Austria [46], and was found in the city of Graz in 2021 [47]. In 2022, the Asian tiger mosquito was found in every province in Austria if highway stations are included. However, stable populations are currently only documented in Vienna and Graz [48]. Aedes koreicus was first identified in Austria in 2017 in Carinthia [49]. Since then, there were some single reports in Carinthia, Styria and Tyrol [38, 48].

Identification of mosquitoes and their eggs greatly relies on morphological examination under a stereo microscope. Depending on the stage, some species might not be distinguishable with morphological methods. Therefore, it is important to incorporate molecular techniques for identification of mosquitoes [5052]. DNA barcoding uses polymerase chain reaction (PCR) techniques to amplify conserved regions of the DNA with subsequent sequencing of the amplicon. The sequence obtained can then be compared with reference sequences in databases such as NCBI GenBank [53] to identify the mosquito species [54]. The most common DNA barcode is the mitochondrial cytochrome c oxidase subunit I (mtCOI) gene, which can serve as a molecular marker as it generally shows a low level of intra-species variation, but a high level of inter-species variation [54, 55]. While DNA barcoding using Sanger sequencing can additionally help with identifying cryptic species [56, 57], it does not allow accurate identification of multiple species in one sample [58]. Collection of Aedes eggs from container breeding species is typically performed by using so-called ovitraps, which consist of a black container filled with water and a wooden spatula plunged inside for oviposition support [44]. Aedes mosquitoes of different species might lay single or multiple eggs on the spatula. Morphological differentiation is possible but might be difficult depending on the species [59]. As molecular identification with Sanger sequencing of the mtCOI gene does not allow for identification of multiple species in one sample [58], multiplex PCR protocols targeting the specific species of interest can be of advantage for this purpose.

Bang et al. [60] designed a multiplex PCR protocol for simultaneous detection of six different Aedes species: Ae. albopictus, Ae. koreicus, Ae. japonicus, Ae. flavopictus, Ae. togoi and Ae. hatorii. As only the first three species are relevant for Austria, we adapted the PCR protocol and further developed it so that identification of an Austrian native Aedes species, Ae. geniculatus, was also possible. Ovitrap mosquito samples from the years 2021 and 2022 deriving from an Austrian nationwide monitoring program [48, 61] were used for evaluation of the adapted multiplex PCR protocol and a comparison with morphological identification and DNA barcoding of the mtCOI gene.

Methods

Mosquito sampling

Aedes eggs were collected over the course of 2 years (2021, 2022) within the scope of a nationwide mosquito monitoring program. Ovitraps, representing the ideal habitat for breeding of Aedes mosquitoes, were set up in all nine provinces of Austria from the beginning of May until the end of October in both years. Black plastic containers (1 L) filled with tap water (approximately 0.75 L) served as ovitraps. For oviposition possibility, a wooden spatula, fixed with a stainless-steel clamp, was inserted into the water. The wooden spatula and the water were exchanged on a weekly basis, and the removed spatula was sent to the laboratory for further analysis.

Morphological analysis

Wooden spatulas were examined under the stereo microscope for the presence of mosquito eggs, more specifically Aedes eggs. Eggs were identified morphologically to species level, if possible, and subsequently removed from the spatula and collected in an Eppendorf tube (1.5 mL). Tubes were stored at −80 °C until molecular analysis was performed.

DNA extraction

For molecular analysis, all eggs from each wooden spatula were homogenized using one ceramic bead (2.8 mm Precellys Ceramic Beads, VWR, Darmstadt, Germany) and a TissueLyser II (Qiagen, Hilden, Germany) as described previously [38]. DNA of the samples from 2021 was extracted by the University of Veterinary Medicine, Vienna using the innuPREP DNA Mini Kit (Analytik Jena, Jena, Germany) according to the manufacturer’s instructions. In 2022, molecular analyses were performed by the Austrian Agency for Health and Food Safety, which is why the protocol was changed and adapted to the available equipment at that laboratory. DNA isolation of the samples from 2022 was carried out with the BioExtract SuperBall Kit (Biosellal, Dardilly, France) on a KingFisher Flex96 robot (Thermo Fisher Scientific, Waltham, USA) following an in-house protocol.

Multiplex PCR

The universal forward primer (Aedes-F), as well as the specific reverse primers for Ae. albopictus (ALB-R), Ae. japonicus (JAP-R) and Ae. koreicus (KOR-R), targeting the ribosomal ITS2 region were taken from the original protocol [60]. For Ae. geniculatus, we used all ITS2 reference sequences from the NCBI GenBank database to design a reverse primer (GEN-R) specific to that species and compatible with the other primers of the multiplex PCR. Primer design was performed with the software CLC Genomics Workbench 10 (Qiagen, Hilden, Germany). Primer sequences and details are shown in Table 1.

Table 1.

Primers used for the multiplex PCR protocol

Primer Sequence (5′–3′) Forward/reverse Source
Aedes-F AGGACACATGAACACCCACA Forward [60]
ALB-R GGAGCACACTGAGAGTTCCA Reverse [60]
JAP-R TATACTACGCTGCCGAGAGG Reverse [60]
KOR-R GCCTACTGATTGACGGGGTA Reverse [60]
GEN-R ATGTATTCACCAACCGGG Reverse This study

PCR reactions consisted of 10 µL REDTaq Ready Mix (Merck, Darmstadt, Germany), 7 µL nuclease-free water, 0.4 µL of each primer (10 µM) and 1 µL of DNA, while the PCR conditions described by Bang et al. [60] were applied (94 ℃/5 min; then 94 ℃/30 s, 56 ℃/30 s, 72 ℃/30 s for 35 cycles; and the final extension at 72 ℃ for 5 min). Gel electrophoresis (gel: 2.0% agarose gel in 0.5× TBE buffer; voltage: 100 V; run time: 90–120 min) and visualisation with the Gel Doc 2000 (Bio-Rad Laboratories, Hercules, USA) was performed to identify potential PCR products. The GeneRuler 100 bp DNA Ladder (Thermo Fisher Scientific, Waltham, USA) was used for sizing of PCR products. For confirming correct PCR conditions and successful primer binding, the PCR was first evaluated with representative DNA samples of the four relevant Aedes species (identified by DNA barcoding and morphological analysis) before the protocol was applied to the collected samples. The representative samples included Ae. koreicus larvae from the Viennese Central Cemetery [62], while the egg samples of the other species were obtained during the nationwide monitoring program in Austria [48, 61].

DNA barcoding

DNA barcoding of the mitochondrial cytochrome oxidase subunit I (mtCOI) gene was performed as previously described [56]. In 2021, the PCR products amplified with the primers LepF1 (5′-ATTCAACCAATCATAAAGATAT-3′) and LepR1 (5′-TAAACTTCTGGATGTCCAAAAA-3′) were sequenced at LGC Genomics GmbH, Berlin, Germany.

In 2022, PCR amplification was performed at the Austrian Agency for Health and Food Safety with the primers M13F-LepF1 (5′-TGTAAAACGACGGCCAGATTCAACCAATCATAAAGATAT-3′) and M13R-LepR1 (5′-CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAA-3′). M13 sequences were added to the primers (without resulting in different primer binding properties) for facilitating the subsequent workflow. The PCR conditions of the protocol using the primers LepF1 and LepR1 were applied [56]. For PCR cleanup, 2 µL of the ExoSAP-IT Express reagent (Applied Biosystems, Waltham, USA) were mixed with 5 µL PCR product and incubated at 37 °C for 4 min and 80 °C for 1 min. Subsequent cycle sequencing reactions with the sequencing primer M13R (5′-CAGGAAACAGCTATGAC-3′) were set up using the BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Waltham, USA). The reactions contained 8 µL BigDye Terminator 3.1 Ready Reaction Mix, 9.68 µL ddH2O, 0.32 µL of the sequencing primer M13R (10 µM) and 2 µL of template. The conditions for the cycle sequencing were chosen as recommended by the manufacturer. After cycle sequencing, the reactions were purified by adding 90 µL of SAM solution (Applied Biosystems, Waltham, USA) and 20 µL of the XTerminator solution (Applied Biosystems, Waltham, USA). After shaking for 20 min at 1800 rpm on an Eppendorf MixMate (Eppendorf, Hamburg, Germany) and centrifugation at 1000g for 2 min, the sequencing reactions were analysed with an ABI Genetic Analyzer 3500 (PA Protocol: BDTv3.1_PA_Protocol_POP7, Basecall Version: KB 1.4.1.8) (Applied Biosystems, Waltham, USA). After analysis, the resulting sequences were compared to sequences of two public databases (NCBI Genbank, www.ncbi.nlm.nih.gov/genbank; BOLD Systems, www.boldsystems.org) for species identification.

Data analysis

All data obtained was documented in Microsoft Excel (Microsoft, Washington, USA) and analysed using the software R version 4.2.3 [63].

Results

Confirmation of PCR conditions and primer binding

For a first evaluation, a total of 31 DNA samples from ovitraps and larvae (8 Ae. koreicus larval samples, eight Ae. albopictus egg samples, eight Ae. japonicus egg samples, seven Ae. geniculatus egg samples) and one negative control (water) were analysed using the adapted multiplex PCR protocol. The samples were previously identified morphologically and by DNA barcoding. After gel electrophoresis (Fig. 1), all samples showed specific PCR products of the correct sizes according to the expected species (438 bp for Ae. albopictus, 361 bp for Ae. koreicus, 310 bp for Ae. geniculatus and 160 bp for Ae. japonicus). One sample, which was expected to be Ae. albopictus, showed an additional PCR product at 160 bp, indicating the presence of Ae. japonicus.

Fig. 1.

Fig. 1

Results of the multiplex PCR of representative DNA samples of the four relevant Aedes species. The 31 DNA samples (lanes 1–8: Ae. albopictus eggs; lanes 9–16: Ae. japonicus eggs; Lanes 17–24: Ae. koreicus larvae; lanes 25–31: Ae. geniculatus eggs) were previously identified morphologically and with DNA barcoding and subsequently analysed using the multiplex PCR protocol. All samples show specific PCR products of the correct sizes according to the expected species: 438 bp for Ae. albopictus, 361 bp for Ae. koreicus, 310 bp for Ae. geniculatus and 160 bp for Ae. japonicus. The sample in lane 3 (expected to be Ae. albopictus) shows an additional PCR product at 160 bp, indicating the presence of Ae. japonicus

Analysis of ovitrap samples from 2021 and 2022

In total, 2271 samples from the years 2021 and 2022 were analysed using morphology, the adapted multiplex PCR and DNA barcoding with Sanger sequencing. Morphological specification of the eggs revealed Ae. albopictus in 203 samples and Ae. geniculatus in 122 samples, while 104 samples were either classified as another species or not identified at all. Differentiation of Ae. japonicus and Ae. koreicus was not possible when morphologically looking at egg samples, which is why 1750 samples were classified as Ae. koreicus/Ae. japonicus. In an additional 92 samples, morphological examination revealed the presence of more than one species (5 Ae. albopictus/Ae. geniculatus, 8 Ae. albopictus/Ae. japonicus/Ae. koreicus, 79 Ae. geniculatus/Ae. japonicus/Ae. koreicus).

The results of the multiplex PCR analyses identified 162 Ae. albopictus, 1705 Ae. japonicus and 76 Ae. geniculatus samples. In those samples, DNA of only one species was present. 281 samples could not be identified, as no PCR product was visible on the gel. Aedes koreicus was not detected in any of the analysed samples. According to the multiplex PCR, DNA of multiple species was present in 47 samples. Of those, 18 were mixtures of Ae. albopictus and Ae. japonicus, while 29 samples contained DNA of Ae. japonicus and Ae. geniculatus.

DNA barcoding of mtCOI detected 163 Ae. albopictus, 88 Ae. geniculatus and 1281 Ae. japonicus, while Ae. koreicus was not identified. A total of 190 samples were classified as another species or organism. In 549 samples, DNA barcoding did not show any results due to low sequencing quality or lack of amplification of mtCOI. With DNA barcoding using Sanger sequencing, mixtures of different species could not be detected (Table 2).

Table 2.

Contingency tables for the three species Ae. albopictus, Ae. japonicus and Ae. geniculatus

Multiplex PCR
DNA barcoding Aedes albopictus Positive Negative Total
Positive 144 19 163
Negative 36 2072 2108
Total 180 2091 2271
Aedes japonicus Positive Negative Total
Positive 1251 30 1281
Negative 501 489 990
Total 1752 519 2271
Aedes geniculatus Positive Negative Total
Positive 68 20 88
Negative 37 2146 2183
Total 105 2166 2271

The table shows the amounts of samples positive or negative for the individual species, analysed with multiplex PCR and DNA barcoding

To compare the identification of container-breeding mosquitoes with DNA barcoding to the multiplex PCR protocol, contingency tables for the species Ae. albopictus, Ae. japonicus and Ae. geniculatus were created (Table 2). Due to the absence of Ae. koreicus in the analysed ovitrap samples, it was not possible to compare the two methods for this species. Percent agreement and Cohen’s Kappa coefficients (κ) were calculated to demonstrate the agreement between the two applied methods for each parameter/species: Ae. albopictus 97.58%, κ = 0.83 [95% confidence interval (CI) 0.78–0.87]; Ae. japonicus 76.62%, κ = 0.50 (95% CI 0.46–0.53); Ae. geniculatus 97.49%, κ = 0.69 (95% CI 0.62–0.77).

Samples that, according to the multiplex PCR, contained DNA of Ae. albopictus and Ae. japonicus (n = 18), were identified as Ae. albopictus in 10 cases and as Ae. japonicus in two cases when using DNA barcoding. Six of those samples showed no result with Sanger sequencing. While the multiplex PCR detected Ae. japonicus and Ae. geniculatus (n = 29), DNA barcoding showed no result (n = 4), Ae. japonicus (n = 8), Ae. geniculatus (n = 15) or another organism (n = 2).

The comparison of the molecular techniques with morphology was out of the scope of this study. However, to be able to better evaluate the performance of the two methods, additional contingency tables including morphological results were created for each species (Additional file 1: Tables S1, S2).

Discussion

DNA barcoding using Sanger sequencing offers the possibility to identify a wide variety of different mosquito species (and other organisms). However, in contrast to a multiplex PCR, the method is not suitable for detection of multiple species in one sample. In a total of 47 samples, Sanger sequencing either detected only one species or did not show any result, while the multiplex PCR revealed the presence of multiple species. In 8 of 18 cases, Ae. albopictus was not identified in a sample containing more than one species when using DNA barcoding. Based on the results of this study, it can be assumed that using DNA barcoding with Sanger sequencing can lead to an under-reporting when dealing with samples that might contain DNA of several species. Hence, we propose that the described multiplex PCR protocol is of great advantage for certain monitoring purposes (e.g. ovitrap monitoring).

A Cohen’s kappa coefficient between 0.40 and 0.59 indicates weak agreement, while values from 0.60–0.79 to 0.80–0.90 are to be interpreted as moderate and strong agreement, respectively [64]. Based on the Cohen’s kappa coefficients, the agreement between the two methods for detecting Ae. albopictus is quite high, which is also shown by the percent agreement (97.58%). In contrast, Cohen’s kappa coefficient of Ae. japonicus (κ = 0.50) indicates only little agreement between the PCR and DNA barcoding, demonstrated also by a lower percent agreement of 76.62%. The results further indicate moderate agreement between the two methods when looking at the identification of Ae. geniculatus, with a Cohen’s kappa coefficient of 0.69 and a percent agreement of 97.49%. Differences in the degree of agreement between the species might be caused due to possible biases (primer bias, PCR selection, PCR drift), which result in higher amplification of some templates due to their properties (e.g. GC content and gene copy numbers) [65]. Another reason might be the difference in sample size, as a considerably higher number of samples positive for Ae. japonicus was analysed. Additionally, Ae. japonicus is considered a species complex, which is (currently) composed of four subspecies [66]. PCR and/or sequencing primers could show different binding properties related to the different subspecies, affecting the overall performance of those methods. Recently, it has been suggested that Ae. geniculatus either has cryptic sibling species or that it is also a species complex comprised of multiple subspecies [67]. However, this still needs to be further investigated since currently there are only few DNA sequences available in public databases for this species. This also posed a challenge for designing the primer for Ae. geniculatus in this study.

When comparing the number of negative results (no species identification), the multiplex PCR performed better than DNA barcoding. A total of 281 samples could not be identified by PCR, while DNA barcoding with Sanger sequencing did not lead to a result in 549 cases. Inspection of the contingency table (Table 2) makes it clear that the multiplex PCR generally performed slightly better in identifying the relevant container-breeding Aedes species. The biggest difference in performance can be observed with Ae. japonicus. A total of 501 PCR positive samples could not be identified as Ae. japonicus by Sanger sequencing, while only 30 Ae. japonicus samples would have been overlooked when using the multiplex PCR. Other organisms (e.g. Ceratopogonidae eggs or Amoebozoa such as Vanella simplex), which can also be detected during DNA barcoding, might be present in some of the samples and thereby lower the detection rate of sequencing when looking at the four relevant Aedes species.

While the aim of this study was primarily to compare the two molecular methods with each other, morphological results were included for a better overview and evaluation of the techniques. Generally, morphological analysis resulted in less non-identifiable samples compared to the multiplex PCR and DNA barcoding. A reason for the weaker performance of the molecular techniques might be that there is not enough DNA present (e.g. in samples with few eggs or after errors during DNA extraction). Nonetheless, some samples would have been overlooked when using morphological inspection alone (especially if scientists are not experienced in morphological specification of mosquito eggs). Therefore, we suggest complementing morphological assessment with molecular techniques to decrease mis- or non-identifications. Due to its better performance and higher agreement with morphology, we propose to use the multiplex PCR as a second method for identification of eggs from ovitrap samples. The analysed ovitrap samples from 2021 to 2022 did not include any Ae. koreicus eggs. While larvae of Ae. koreicus were found in the Viennese Central Cemetery in 2021, ovitraps in the same region were negative for this species. Possible reasons for the absence of eggs might be that there were too few Ae. koreicus females present in the area or that they preferred other breeding sites [62]. A comparison between Sanger sequencing and the multiplex PCR protocol was therefore not possible for this species and needs to be investigated in further experiments. However, the proposed PCR protocol was validated with representative Ae. koreicus larval samples. As species-specific bands were observed on the agarose gel, it is highly likely that the PCR protocol is also suitable for identification of Ae. koreicus in ovitrap samples.

Differentiation of Ae. koreicus and Ae. geniculatus might be difficult in some cases, as the PCR products lie close together when being visualised by gel electrophoresis. It is therefore important to ensure that the run time of the gel electrophoresis is adequate (in our cases 1.5–2 h). Additionally, results of other methods (e.g. morphology) can be taken into account for evaluation of the PCR results. If interpretation of the results concerning Ae. koreicus and Ae. geniculatus is still not possible, a second PCR using the universal forward primer and only one reverse primer (specific to Ae. koreicus or Ae. geniculatus) can be carried out for confirmation. Alternatively, agarose gel electrophoresis can be substituted by a fragment analysis using a suitable instrument (e.g. ABI 3500 Genetic Analyzer, Applied Biosystems, Waltham, USA) and fluorescently labelled primers. Fragment analysis allows for separation of PCR products that show a size difference of only 1–2 nt and can thereby improve analysis and interpretation of multiplex PCR reactions. Furthermore, the protocol can be adapted for analysis with a real-time PCR (RT–PCR) machine using fluorescently labelled primers or probes. Additionally, a RT–PCR approach offers higher sensitivity for detecting the four species and provides results more quickly than a conventional PCR as there is no need for subsequent gel electrophoresis. Additionally, PCR products can be quantified when using RT–PCR [68]. In the future, mosquito species identification will most probably benefit from the recent emergence of next-generation sequencing applications. Using NGS technology, DNA metabarcoding can be performed, which allows detection of multiple species in the same sample while being able to identify a wide range of different species. At the moment, however, PCR approaches still score with less time-consuming protocols and fewer costs, when compared with NGS applications. Nonetheless, further development of new methods for mosquito identification (and pathogen detection) would likely improve current workflows.

Conclusions

The multiplex PCR protocol described in this study can serve as a powerful tool for large-scale analysis of container-breeding mosquitoes. Especially when detection of multiple species in the same sample might be necessary (e.g. ovitrap samples), the multiplex PCR is more suitable than DNA barcoding with Sanger sequencing. Additionally, PCR analyses are typically less time-consuming and cheaper compared to sequencing technologies. Therefore, we propose that this multiplex PCR protocol is highly suitable and of great advantage for analysing container-breeding mosquitoes.

Supplementary Information

13071_2024_6255_MOESM1_ESM.docx (16KB, docx)

Additional file 1: Table S1. Contingency table for the three species Ae. albopictus, Ae. japonicus and Ae. geniculatus for comparison of the multiplex PCR and morphological analysis. The samples positive or negative for the individual species, when examined morphologically and by the multiplex PCR, are depicted in this table. Table S2. Contingency table for the three species Ae. albopictus, Ae. japonicus and Ae. geniculatus for comparison of DNA barcoding and morphological analysis. The amount of positive and negative samples after DNA barcoding and morphological examination are shown in this table.

Acknowledgements

We wish to thank all citizen scientists and employees from AGES who conducted the sampling of the ovitraps.

Author contributions

HPF, KBL and AI supervised the study. JR, CP, SP and MSU performed molecular genetic laboratory work. KBL coordinated the sampling and carried out morphological analysis. MM acquired funding via the ESMOS project. JR wrote the first draft. All authors have reviewed the final manuscript.

Funding

Financial support was provided by the Climate and Energy Fund of the Austrian Federal Government via the ESMOS project (FFG 901442) within the framework of the Austrian Climate Research Programme (ACRP), 15th call.

Availability of data and materials

The datasets used and/or analysed during the current study are included in this published article (and its supplementary information files).

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Hoque MM, Valentine MJ, Kelly PJ, Barua S, Murillo DFB, Wang C. Modification of the Folmer primers for the cytochrome c oxidase gene facilitates identification of mosquitoes. Parasit Vectors. 2022;15:437. doi: 10.1186/s13071-022-05494-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Reinbold-Wasson DD, Reiskind MH. Comparative skip-oviposition behavior among container breeding Aedes spp. mosquitoes (Diptera: Culicidae) J Med Entomol. 2021;58:2091–100. doi: 10.1093/jme/tjab084. [DOI] [PubMed] [Google Scholar]
  • 3.Cunze S, Kochmann J, Koch LK, Klimpel S. Aedes albopictus and its environmental limits in Europe. PLoS ONE. 2016;11:e0162116. doi: 10.1371/journal.pone.0162116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Eritja R, Palmer JRB, Roiz D, Sanpera-Calbet I, Bartumeus F. Direct evidence of adult Aedes albopictus dispersal by car. Sci Rep. 2017;7:14399. doi: 10.1038/s41598-017-12652-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Juliano SA, Lounibos LP. Ecology of invasive mosquitoes: effects on resident species and on human health. Ecol Lett. 2005;8:558–574. doi: 10.1111/j.1461-0248.2005.00755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Paupy C, Delatte H, Bagny L, Corbel V, Fontenille D. Aedes albopictus, an arbovirus vector: from the darkness to the light. Microbes Infect. 2009;11:1177–1185. doi: 10.1016/j.micinf.2009.05.005. [DOI] [PubMed] [Google Scholar]
  • 7.Tippelt L, Werner D, Kampen H. Tolerance of three Aedes albopictus strains (Diptera: Culicidae) from different geographical origins towards winter temperatures under field conditions in northern Germany. PLoS ONE. 2019;14:e0219553. doi: 10.1371/journal.pone.0219553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bonizzoni M, Gasperi G, Chen X, James AA. The invasive mosquito species Aedes albopictus: current knowledge and future perspectives. Trends Parasitol. 2013;29:460–468. doi: 10.1016/j.pt.2013.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gloria-Soria A, Payne AF, Bialosuknia SM, Stout J, Mathias N, Eastwood G, et al. Vector competence of Aedes albopictus populations from the Northeastern United States for chikungunya, dengue, and Zika viruses. Am J Trop Med Hyg. 2020;104:1123–1130. doi: 10.4269/ajtmh.20-0874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Medlock JM, Hansford KM, Schaffner F, Versteirt V, Hendrickx G, Zeller H, et al. A review of the invasive mosquitoes in Europe: ecology, public health risks, and control options. Vector Borne Zoonotic Dis. 2012;12:435–447. doi: 10.1089/vbz.2011.0814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cancrini G, Romi R, Gabrielli S, Toma L, M DIP, Scaramozzino P. First finding of Dirofilaria repens in a natural population of Aedes albopictus. Med Vet Entomol. 2003;17:448–51. doi: 10.1111/j.1365-2915.2003.00463.x. [DOI] [PubMed] [Google Scholar]
  • 12.Fuehrer HP, Auer H, Leschnik M, Silbermayr K, Duscher G, Joachim A. Dirofilaria in humans, dogs, and vectors in Austria (1978–2014)-from imported pathogens to the endemicity of Dirofilaria repens. PLoS Negl Trop Dis. 2016;10:e0004547. doi: 10.1371/journal.pntd.0004547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fuehrer HP, Morelli S, Unterkofler MS, Bajer A, Bakran-Lebl K, Dwuznik-Szarek D, et al. Dirofilaria spp. and Angiostrongylus vasorum: current risk of spreading in Central and Northern Europe. Pathogens. 2021 doi: 10.3390/pathogens10101268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Nayar JK, Knight JW. Aedes albopictus (Diptera: Culicidae): an experimental and natural host of Dirofilaria immitis (Filarioidea: Onchocercidae) in Florida, USA. J Med Entomol. 1999;36:441–8. doi: 10.1093/jmedent/36.4.441. [DOI] [PubMed] [Google Scholar]
  • 15.Adhami J, Reiter P. Introduction and establishment of Aedes (Stegomyia) albopictus skuse (Diptera: Culicidae) in Albania. J Am Mosq Control Assoc. 1998;14:340–343. [PubMed] [Google Scholar]
  • 16.ECDC. Aedes albopictus - current known distribution: March 2022: European Centre for Disease Prevention and Control. 2022. https://www.ecdc.europa.eu/en/publications-data/aedes-albopictus-current-known-distribution-march-2022.
  • 17.Medlock JM, Hansford KM, Versteirt V, Cull B, Kampen H, Fontenille D, et al. An entomological review of invasive mosquitoes in Europe. Bull Entomol Res. 2015;105:637–663. doi: 10.1017/S0007485315000103. [DOI] [PubMed] [Google Scholar]
  • 18.Battaglia V, Agostini V, Moroni E, Colombo G, Lombardo G, Rambaldi Migliore N, et al. The worldwide spread of Aedes albopictus: new insights from mitogenomes. Front Genet. 2022;13:931163. doi: 10.3389/fgene.2022.931163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.A revision of the adult and larval mosquitoes of Japan (including the Ryukyu Archipelago and the Ogasawara Islands) and Korea (Diptera: Culicidae). Mosquito News. 1980;40:2.
  • 20.Schaffner F, Chouin S, Guilloteau J. First record of Ochlerotatus (Finlaya) japonicus japonicus (Theobald, 1901) in metropolitan France. J Am Mosq Control Assoc. 2003;19:1–5. [PubMed] [Google Scholar]
  • 21.Faizah AN, Kobayashi D, Amoa-Bosompem M, Higa Y, Tsuda Y, Itokawa K, et al. Evaluating the competence of the primary vector, Culex tritaeniorhynchus, and the invasive mosquito species, Aedes japonicus japonicus, in transmitting three Japanese encephalitis virus genotypes. PLoS Negl Trop Dis. 2020;14:e0008986. doi: 10.1371/journal.pntd.0008986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Van den Eynde C, Sohier C, Matthijs S, De Regge N. Japanese encephalitis virus interaction with mosquitoes: a review of vector competence, vector capacity and mosquito immunity. Pathogens. 2022 doi: 10.3390/pathogens11030317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Harris MC, Dotseth EJ, Jackson BT, Zink SD, Marek PE, Kramer LD, et al. La Crosse virus in Aedes japonicus japonicus mosquitoes in the Appalachian region, United States. Emerg Infect Dis. 2015;21:646–649. doi: 10.3201/eid2104.140734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.DeCarlo CH, Campbell SR, Bigler LL, Mohammed HO. Aedes japonicus and West Nile virus in New York. J Am Mosq Control Assoc. 2020;36:261–263. doi: 10.2987/20-6958.1. [DOI] [PubMed] [Google Scholar]
  • 25.Centers for Disease Control and Prevention. Mosquito species in which West Nile virus has been detected, United States, 1999–2016. Centers for Disease Control and Prevention; 2016.
  • 26.Camp JV, Kolodziejek J, Nowotny N. Targeted surveillance reveals native and invasive mosquito species infected with Usutu virus. Parasit Vectors. 2019;12:46. doi: 10.1186/s13071-019-3316-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Key to the Insects of the Russian Far East. Vol. IV Diptera and fleas. Part 2. Vladivostok: Dal'nauka; 2001.
  • 28.Knight KL. Contributions to the mosquito fauna of Southeast Asia.—IV. Species of the subgroup chrysolineatus of group D, genus Aedes, subgenus Finlaya Theobald. Contribut Am Entomol Inst. 1968;2:1–45. [Google Scholar]
  • 29.Ward RA. Fauna of the U.S.S.R. Diptera, Vol. III, No. 4, mosquitoes family culicidae. Bullet Entomol Soc Am. 1975;21:147. [Google Scholar]
  • 30.Versteirt V, De Clercq EM, Fonseca DM, Pecor J, Schaffner F, Coosemans M, et al. Bionomics of the established exotic mosquito species Aedes koreicus in Belgium, Europe. J Med Entomol. 2012;49:1226–1232. doi: 10.1603/me11170. [DOI] [PubMed] [Google Scholar]
  • 31.Capelli G, Drago A, Martini S, Montarsi F, Soppelsa M, Delai N, et al. First report in Italy of the exotic mosquito species Aedes (Finlaya) koreicus, a potential vector of arboviruses and filariae. Parasit Vectors. 2011;4:188. doi: 10.1186/1756-3305-4-188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Negri A, Arnoldi I, Brilli M, Bandi C, Gabrieli P, Epis S. Evidence for the spread of the alien species Aedes koreicus in the Lombardy region, Italy. Parasit Vectors. 2021;14:534. doi: 10.1186/s13071-021-05031-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Werner D, Zielke DE, Kampen H. First record of Aedes koreicus (Diptera: Culicidae) in Germany. Parasitol Res. 2016;115:1331–1334. doi: 10.1007/s00436-015-4848-6. [DOI] [PubMed] [Google Scholar]
  • 34.Pfitzner WP, Lehner A, Hoffmann D, Czajka C, Becker N. First record and morphological characterization of an established population of Aedes (Hulecoeteomyia) koreicus (Diptera: Culicidae) in Germany. Parasit Vectors. 2018;11:662. doi: 10.1186/s13071-018-3199-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Suter T, Flacio E, Farina BF, Engeler L, Tonolla M, Muller P. First report of the invasive mosquito species Aedes koreicus in the Swiss-Italian border region. Parasit Vectors. 2015;8:402. doi: 10.1186/s13071-015-1010-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kurucz K, Kiss V, Zana B, Schmieder V, Kepner A, Jakab F, et al. Emergence of Aedes koreicus (Diptera: Culicidae) in an urban area, Hungary, 2016. Parasitol Res. 2016;115:4687–4689. doi: 10.1007/s00436-016-5229-5. [DOI] [PubMed] [Google Scholar]
  • 37.Ganushkina LA, Patraman IV, Rezza G, Migliorini L, Litvinov SK, Sergiev VP. Detection of Aedes aegypti, Aedes albopictus, and Aedes koreicus in the Area of Sochi, Russia. Vector Borne Zoonotic Dis. 2016;16:58–60. doi: 10.1089/vbz.2014.1761. [DOI] [PubMed] [Google Scholar]
  • 38.Fuehrer HP, Schoener E, Weiler S, Barogh BS, Zittra C, Walder G. Monitoring of alien mosquitoes in Western Austria (Tyrol, Austria, 2018) PLoS Negl Trop Dis. 2020;14:e0008433. doi: 10.1371/journal.pntd.0008433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ganassi S, De Cristofaro A, Di Criscio D, Petrarca S, Leopardi C, Guarnieri A, et al. The new invasive mosquito species Aedes koreicus as vector-borne diseases in the European area, a focus on Italian region: what we know from the scientific literature. Front Microbiol. 2022;13:931994. doi: 10.3389/fmicb.2022.931994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Montarsi F, Ciocchetta S, Devine G, Ravagnan S, Mutinelli F, di Frangipane Regalbono A, et al. Development of Dirofilaria immitis within the mosquito Aedes (Finlaya) koreicus, a new invasive species for Europe. Parasit Vectors. 2015;8:177. doi: 10.1186/s13071-015-0800-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Jansen S, Cadar D, Luhken R, Pfitzner WP, Jost H, Oerther S, et al. Vector competence of the invasive mosquito species Aedes koreicus for arboviruses and interference with a novel insect specific virus. Viruses. 2021 doi: 10.3390/v13122507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.ECDC. Aedes koreicus - Factsheet for experts: European Centre for Disease Prevention and Control. 2014. https://www.ecdc.europa.eu/en/disease-vectors/facts/mosquito-factsheets/aedes-koreicus.
  • 43.Seidel B, Duh D, Nowotny N, Allerberger F. Erstnachweis der Stechmücken Aedes (Ochlerotatus) japonicus japonicus (Theobald, 1901) in Österreich und Slowenien in 2011 und für Aedes (Stegomyia) albopictus (Skuse, 1895) in Österreich 2012 (Diptera: Culicidae) Entomol Z. 2012;122:223–226. [Google Scholar]
  • 44.Bakran-Lebl K, Pree S, Brenner T, Daroglou E, Eigner B, Griesbacher A, et al. First nationwide monitoring program for the detection of potentially invasive mosquito species in Austria. Insects. 2022 doi: 10.3390/insects13030276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Schoener E, Zittra C, Weiss S, Walder G, Barogh BS, Weiler S, et al. Monitoring of alien mosquitoes of the genus Aedes (Diptera: Culicidae) in Austria. Parasitol Res. 2019;118:1633–1638. doi: 10.1007/s00436-019-06287-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Bakran-Lebl K, Zittra C, Harl J, Shahi-Barogh B, Gratzl A, Ebmer D, et al. Arrival of the Asian tiger mosquito, Aedes albopictus (Skuse, 1895) in Vienna, Austria and initial monitoring activities. Transbound Emerg Dis. 2021;68:3145–3150. doi: 10.1111/tbed.14169. [DOI] [PubMed] [Google Scholar]
  • 47.Reichl J, Prossegger C, Eichholzer B, Plauder P, Unterkofler MS, Bakran-Lebl K, et al. A citizen science report-tiger mosquitoes (Aedes albopictus) in allotment gardens in Graz, Styria, Austria. Parasitol Res. 2023;123:79. doi: 10.1007/s00436-023-08106-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Bakran-Lebl K, Reichl J. Ovitrap-Monitoring gebietsfremder Gelsenarten in Österreich - Jahresbericht 2022. Vienna: AGES - Austrian Agency for Health and Food Safety, Institute for Medical Microbiology und Hygiene DfVBD; 2023.
  • 49.Seidel B, Hufnagl P, Nowotny N, Allerberger F, Indra A. Long-term field study on mosquitoes in Austria, in particular the invasive Korean bush-mosquito Aedes (Finlaya) koreicus (Edwards, 1917) Beiträge zur Entomofaunistik. 2020;21:237–240. [Google Scholar]
  • 50.Gunay F, Alten B, Simsek F, Aldemir A, Linton YM. Barcoding Turkish Culex mosquitoes to facilitate arbovirus vector incrimination studies reveals hidden diversity and new potential vectors. Acta Trop. 2015;143:112–120. doi: 10.1016/j.actatropica.2014.10.013. [DOI] [PubMed] [Google Scholar]
  • 51.Weeraratne TC, Surendran SN, Parakrama Karunaratne SHP. DNA barcoding of morphologically characterized mosquitoes belonging to the subfamily Culicinae from Sri Lanka. Parasit Vectors. 2018;11:266. doi: 10.1186/s13071-018-2810-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Hernandez-Triana LM, Brugman VA, Nikolova NI, Ignacio RA, Barrero E, Thorne L, et al. DNA barcoding of British mosquitoes (Diptera, Culicidae) to support species identification, discovery of cryptic genetic diversity and monitoring invasive species. Zookeys. 2019;832:57–76. doi: 10.3897/zookeys.832.32257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2022;50:D20–D26. doi: 10.1093/nar/gkab1112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Hebert PD, Cywinska A, Ball SL, deWaard JR. Biological identifications through DNA barcodes. Proc Biol Sci. 2003;270:313–321. doi: 10.1098/rspb.2002.2218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Hebert PD, Ratnasingham S, deWaard JR. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc Biol Sci. 2003;270:S96–9. doi: 10.1098/rsbl.2003.0025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Hebert PD, Penton EH, Burns JM, Janzen DH, Hallwachs W. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc Natl Acad Sci USA. 2004;101:14812–14817. doi: 10.1073/pnas.0406166101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Ruiz-Lopez F, Wilkerson RC, Conn JE, McKeon SN, Levin DM, Quinones ML, et al. DNA barcoding reveals both known and novel taxa in the Albitarsis group (Anopheles: Nyssorhynchus) of neotropical malaria vectors. Parasit Vectors. 2012;5:44. doi: 10.1186/1756-3305-5-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Batovska J, Cogan NO, Lynch SE, Blacket MJ. Using next-generation sequencing for DNA barcoding: capturing allelic variation in ITS2. G3. 2017;7:19–29. doi: 10.1534/g3.116.036145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Anicic N, Steigmiller K, Renaux C, Ravasi D, Tanadini M, Flacio E. Optical recognition of the eggs of four Aedine mosquito species (Aedes albopictus, Aedes geniculatus, Aedes japonicus, and Aedes koreicus) PLoS ONE. 2023;18:e0293568. doi: 10.1371/journal.pone.0293568. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Bang WJ, Won MH, Cho ST, Ryu J, Choi KS. A multiplex PCR assay for six Aedini species, including Aedes albopictus. Parasit Vectors. 2021;14:380. doi: 10.1186/s13071-021-04871-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Bakran-Lebl K. Ovitrap-Monitoring gebietsfremder Gelsenarten in Österreich - Jahresbericht 2021. Vienna: AGES - Austrian Agency for Health and Food Safety, Institute for Medical Microbiology und Hygiene DfVBD; 2022.
  • 62.Unterkofler MS, Schreier L, Wiesbauer U, Zittra C, Grätzl A, Prossegger C, et al. Nachweis von heimischen und potenziell invasiven Stechmücken am Wiener Zentralfriedhof im Jahr 2021. Entomologica Austriaca. 2022:359–60.
  • 63.R Core Team . R: a language and environment for statistical computing. Vienna: R Foundation for Statistical Computing; 2021. [Google Scholar]
  • 64.McHugh ML. Interrater reliability: the kappa statistic. Biochem Med. 2012;22:276–282. [PMC free article] [PubMed] [Google Scholar]
  • 65.Acinas SG, Sarma-Rupavtarm R, Klepac-Ceraj V, Polz MF. PCR-induced sequence artifacts and bias: insights from comparison of two 16S rRNA clone libraries constructed from the same sample. Appl Environ Microbiol. 2005;71:8966–8969. doi: 10.1128/AEM.71.12.8966-8969.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Kaufman MG, Fonseca DM. Invasion biology of Aedes japonicus japonicus (Diptera: Culicidae) Annu Rev Entomol. 2014;59:31–49. doi: 10.1146/annurev-ento-011613-162012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Prudhomme J, Fontaine A, Lacour G, Gantier JC, Diancourt L, Velo E, et al. The native European Aedes geniculatus mosquito species can transmit chikungunya virus. Emerg Microbes Infect. 2019;8:962–972. doi: 10.1080/22221751.2019.1634489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Kralik P, Ricchi M. A basic guide to real time PCR in microbial diagnostics: definitions, parameters, and everything. Front Microbiol. 2017;8:108. doi: 10.3389/fmicb.2017.00108. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13071_2024_6255_MOESM1_ESM.docx (16KB, docx)

Additional file 1: Table S1. Contingency table for the three species Ae. albopictus, Ae. japonicus and Ae. geniculatus for comparison of the multiplex PCR and morphological analysis. The samples positive or negative for the individual species, when examined morphologically and by the multiplex PCR, are depicted in this table. Table S2. Contingency table for the three species Ae. albopictus, Ae. japonicus and Ae. geniculatus for comparison of DNA barcoding and morphological analysis. The amount of positive and negative samples after DNA barcoding and morphological examination are shown in this table.

Data Availability Statement

The datasets used and/or analysed during the current study are included in this published article (and its supplementary information files).


Articles from Parasites & Vectors are provided here courtesy of BMC

RESOURCES