Skip to main content
PMC home page
Microbiology Resource Announcements logoLink to Microbiology Resource Announcements
. 2024 Feb 27;13(4):e01295-23. doi: 10.1128/mra.01295-23

Whole-genome sequencing of SARS-CoV-2 from the initial cases of domestic cat infections in Canada

Asma Sultana 1,2, Dorothee Bienzle 3, Scott Weese 3, Brad Pickering 2,4, Peter Kruczkiewicz 2, Greg Smith 2, Mathieu Pinette 2, Oliver Lung 1,2,✉
Editor: Simon Roux5
PMCID: PMC11008122  PMID: 38411070

ABSTRACT

Two cat nasal swabs from Canada’s earliest confirmed SARS-CoV-2 positive domestic cats were sequenced to over 99% SARS-CoV-2 genome coverage. One cat had lineage A.23.1 SARS-CoV-2 not reported before in animals. Both sequences have multiple spike gene mutations and clustered closely with human-derived sequences in the global SARS-CoV-2 phylogenetic tree.

KEYWORDS: SARS-CoV2; WGS; cat; pets, coronavirus

ANNOUNCEMENT

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (genus Betacoronavirus, family Coronaviridae), the causative agent of the COVID-19 pandemic, had a profound impact on public health. Natural and experimental infections confirmed the susceptibility of 29 species, including free-living, domestic, captive, and farmed animals (1–6). Natural infections have been reported in nine feline species, including domestic cat (Felis catus), tiger (Panthera tigris), lynx (Lynx lynx and L. canadensis), and lion (P. leo) (6–8). Furthermore, animal-to-human transmission of SARS-CoV-2 has been reported for hamsters, mink, cats, and white-tailed deer (3, 8–10). Characterization of SARS-CoV-2 in animals improves our understanding of potential intermediate hosts.

From October 2020 to April 2021, the Animal Health Laboratory, University of Guelph, sent 11 samples (oral, nasal, and rectal swabs) from four cats to the National Centre for Foreign Animal Disease for confirmatory testing. RNA was extracted from the swab samples using the MagMax CORE Nucleic Acid Purification Kit (ThermoFisher Scientific), and qRT-PCR targeting the E (3) and RdRp genes [Forward primer-GTGAAATGGTCATGTGTGGCGG, Reverse primer- CAAATGTTAAAAACACTATTAGCATA and probe-FAM/BHQ-1-CAGGTGGAACCTCATCAGGAGATGC) of SARS-CoV-2 was performed (unpublished)].

The qRT-PCR-positive samples (n = 9, Ct values 26–36) were amplified using a 1,200 bp tiled PCR amplicon protocol (11). Amplicons for four samples, including sample NCFAD-2020-0085 (0085; sampled in November 2020), were sequenced on a FLO-MIN106 flow cell with a GridION sequencer following library preparation with the Native barcoding (EXP-NBD104) and Ligation sequencing (SQK-LSK109) kits (Oxford Nanopore Technologies) (12). SPRI beads were used for the selection of >1,200 bp fragmented DNA. Basecalling, barcode demultiplexing, adapter trimming, and read quality control were performed with Guppy (v4.0.11) using the high-accuracy model. 1.6M reads were generated and the estimated N50 was 1.24 kb. Error correction was not performed since a high allele fraction threshold of 75% was selected for calling high-confidence variants from read alignments. Amplicons for the other five samples, including sample WIN-AH-2021-OTH-Kari-0029-OS-1 (0029) from Ontario, were sequenced on an Illumina MiSeq after processing with the Nextera XT DNA kit, producing 150 bp paired-end reads. Nanopore and Illumina sequencing reads were analyzed with the Nextflow (v23.10.0) (13) pipelines, CFIA-NCFAD/nf-virontus (v2.0.0dev1) (14), and nf-core/viralrecon (v2.6.0) (15, 16), respectively, using SARS-CoV-2 Wuhan-Hu-1 reference sequence (MN908947.3). Nextclade was used to find mutations from the consensus sequence. Over 99% of the genomes were recovered from 0029 and 0085, with 2543.7X and 14,164X depth of coverage, respectively (Fig 1).

Pangolin (v4.2) (17) classified sample 0085 as lineage B.1.2 and 0029as lineage A.23.1. The A.23.1 lineage was first reported in Uganda in late 2020 (18) but has never been reported in animals (GISAID and SARS-ANI VIS database search on 2024-01-24) 26 synonymous and non-synonymous mutations were present in 0029, whereas 22 mutations were identified in 0085 (Table 1). Phylogenetic placement analysis with UShER (19) using 16,490,767 SARS-CoV-2 sequences from GISAID, GenBank, COG-UK, and CNCB (2023-12-05) revealed that the human-derived SARS-CoV-2 sequence Canada/2021/EPI_ISL_1742841 (lineage A.23.1; Fig. 1) was the most closely related to 0029 while USA/2020/MZ908099.1 (lineage B.1.2) was the most closely related human derived sequence to 0085. Default parameters were used for all data analysis software.

TABLE 1.

The non-synonymous mutations observed in cat-derived SARS-CoV-2 sequences WIN-AH-2021-OTH-Kari-0029-OS-1 and NCFAD-2020-0085 relative to the Wuhan-Hu-1 reference sequence (MN908947.3)

Sample Gene Nucleotide mutation Amino acid mutation
WIN-AH-2021-OTH-Kari-0029-OS-1 ORF1ab G1820A G519S
(29,655 nucleotides) (38% GC content) ORF1ab C10038T T3258I
ORF1ab G10540A M3425I
ORF1ab G11230T M3655I
ORF1ab G11266T L3667F
ORF1ab G11521T M3752I
ORF1ab C16575T T5437I
ORF1ab C17745T T5827I
ORF1ab A18102G H5946R
S G21777A G72E
S G21867T R102I
S C22033A F157L
S G22661T V367F
S G23401T Q613H
S C23604G P681R
ORF8 T28144C L84S
N G28307A A12T
N G28878A S202N
NCFAD-2020-0085 ORF1a C1059T T265I
(29,786 nucleotides) (38% GC content) ORF1a G8083A M2606I
ORF1a C10319T L3352F
ORF1b C14407T P314S
ORF1b C14408T P314L
ORF1b A18424G N1653D
ORF1b C21304T R2613C
S A23403G D614G
S G23593T Q677H
ORF3a G25563T Q57H
ORF3a G25907T G172V
M G26775T A85S
ORF8 C27964T S24L
N C28472T P67S
N C28869T P199L
N G29402T D377Y
Open in a new tab

Fig 1.

Fig 1

Open in a new tab

(A) A barplot of the sequencing coverage depth across the SARS-CoV-2 genome of the lineage A.23.1 sequence recovered from a Canadian cat (sample WIN-AH-2021-OTH-Kari-0029-OS-1) generated using wgscovplot (https://github.com/nhhaidee/wgscovplot). The x-axis shows the SARS-CoV2 genome position, and the y-axis shows genome coverage depth. At the bottom, the whole genome of the SARS-CoV2 reference strain, including gene features, is attached. (B) A maximum-likelihood phylogenetic tree using the whole genome of lineage A.23.1 SARS-CoV-2 sequence from a Canadian cat (sample WIN-AH-2021-OTH-Kari-0029-OS-1; denoted as 0029 in the tree) along with 25 most closely related lineage A.23.1 sequences from GISAID (20) as identified by UShER phylogenetic placement analysis (2023-12-07) which are collected from different geographic regions but at the similar time. Sequence alignment was performed using MAFFT (v7.511) under the default settings (Method- FFT-NS-2) (21), and the maximum-likelihood phylogenetic tree was inferred using IQ-TREE (v1.6.12) with the K3Pu + F model (determined by IQ-TREE’s ModelFinder) and 1,000 ultra-fast bootstraps (22–24). SARS-CoV-2 Wuhan-Hu-1 reference sequence (MN908947.3) has been used as the outgroup.

ACKNOWLEDGMENTS

The authors acknowledge funding support from the Canadian Safety and Security Program project CSSP-2018-CP-2339, CSSP-2018-TA-2362, CFIA projects 2721 and 2722, and Laboratories Canada project “Enhancing the throughput for genomics of known, emerging, and unknown viruses in wild and cultured terrestrial and aquatic animals: infectious disease surveillance, outbreak investigations and applications to support a one health approach” to OL, and the University of Manitoba Graduate Fellowship to AS.

Contributor Information

Oliver Lung, Email: oliver.lung@inspection.gc.ca.

Simon Roux, DOE Joint Genome Institute, USA.

DATA AVAILABILITY

These two cat SARS-CoV-2 genomes (WIN-AH-2021-OTH-Kari-0029-OS-1 and NCFAD-2020-0085) were deposited in the GenBank (accession numbers: OR999078.1 and OR999071.1). The accession numbers for the Illumina MiSeq and Oxford Nanopore GridION sequencing raw reads in the NCBI Sequence Read Archive (SRA) are PRJNA1055551 (BioProject), SRR27318679 (SRA), and SAMN39052760 (BioSample) for WIN-AH-2021-OTH-Kari-0029-OS-1 sample and PRJNA1055563 (BioProject), SRR27319240 (SRA), and SAMN39053918 (BioSample) for NCFAD-2020-0085 sample.

REFERENCES

  • 1. Segalés J, Puig M, Rodon J, Avila-Nieto C, Carrillo J, Cantero G, Terrón MT, Cruz S, Parera M, Noguera-Julián M, Izquierdo-Useros N, Guallar V, Vidal E, Valencia A, Blanco I, Blanco J, Clotet B, Vergara-Alert J. 2020. Detection of SARS-CoV-2 in a cat owned by a COVID-19−affected patient in Spain. Proc Natl Acad Sci USA 117:24790–24793. doi: 10.1073/pnas.2010817117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Sit THC, Brackman CJ, Ip SM, Tam KWS, Law PYT, To EMW, Yu VYT, Sims LD, Tsang DNC, Chu DKW, Perera RAPM, Poon LLM, Peiris M. 2020. Infection of dogs with SARS-CoV-2. Nature 586:776–778. doi: 10.1038/s41586-020-2334-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Pickering B, Lung O, Maguire F, Kruczkiewicz P, Kotwa JD, Buchanan T, Gagnier M, Guthrie JL, Jardine CM, Marchand-Austin A, et al. 2022. Divergent SARS-CoV-2 variant emerges in white-tailed deer with deer-to-human transmission. Nat Microbiol 7:2011–2024. doi: 10.1038/s41564-022-01268-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Sia SF, Yan L-M, Chin AWH, Fung K, Choy K-T, Wong AYL, Kaewpreedee P, Perera RAPM, Poon LLM, Nicholls JM, Peiris M, Yen H-L. 2020. Pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature 583:834–838. doi: 10.1038/s41586-020-2342-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Shi J, Wen Z, Zhong G, Yang H, Wang C, Huang B, Liu R, He X, Shuai L, Sun Z, Zhao Y, Liu P, Liang L, Cui P, Wang J, Zhang X, Guan Y, Tan W, Wu G, Chen H, Bu Z. 2020. Susceptibility of ferrets, cats, dogs, and other domesticated animals to SARS–coronavirus 2. Science 368:1016–1020. doi: 10.1126/science.abb7015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Nerpel A, Käsbohrer A, Walzer C, Desvars-Larrive A. 2023. Data on SARS-CoV-2 events in animals: mind the gap!. One Health 17:100653. doi: 10.1016/j.onehlt.2023.100653 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Qiu X, Liu Y, Sha A. 2023. SARS‐CoV‐2 and natural infection in animals. J Med Virol 95:e28147. doi: 10.1002/jmv.28147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Yen H-L, Sit THC, Brackman CJ, Chuk SSY, Gu H, Tam KWS, Law PYT, Leung GM, Peiris M, Poon LLM, Cheng SMS, Chang LDJ, Krishnan P, Ng DYM, Liu GYZ, Hui MMY, Ho SY, Su W, Sia SF, Choy K-T, Cheuk SSY, Lau SPN, Tang AWY, Koo JCT, Yung L. 2022. Transmission of SARS-CoV-2 delta variant (AY.127) from pet hamsters to humans, leading to onward human-to-human transmission: a case study. Lancet 399:1070–1078. doi: 10.1016/S0140-6736(22)00326-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Ghai RR, Straily A, Wineland N, Calogero J, Stobierski MG, Signs K, Blievernicht M, Torres-Mendoza Y, Waltenburg MA, Condrey JA, et al. 2023. Epidemiologic and genomic evidence for zoonotic transmission of SARS-CoV-2 among people and animals on a Michigan mink farm, United States, 2020. Viruses 15:2436. doi: 10.3390/v15122436 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Sila T, Sunghan J, Laochareonsuk W, Surasombatpattana S, Kongkamol C, Ingviya T, Siripaitoon P, Kositpantawong N, Kanchanasuwan S, Hortiwakul T, Charernmak B, Nwabor OF, Silpapojakul K, Chusri S. 2022. Suspected cat-to-human transmission of SARS-CoV-2, Thailand, July–September 2021. Emerg Infect Dis 28:1485–1488. doi: 10.3201/eid2807.212605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Freed NE, Vlková M, Faisal MB, Silander OK. 2020. Rapid and inexpensive whole-genome sequencing of SARS-CoV-2 using 1200 bp tiled amplicons and Oxford nanopore rapid barcoding. Biol Methods Protoc 5:bpaa014. doi: 10.1093/biomethods/bpaa014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Fisher M, Nebroski M, Davies J, Janzen E, Sullivan D, Lung O. 2023. Discovery and comparative genomic analysis of a novel equine anellovirus, representing the first complete mutorquevirus genome. Sci Rep 13:3703. doi: 10.1038/s41598-023-30875-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Di Tommaso P, Chatzou M, Floden EW, Barja PP, Palumbo E, Notredame C. 2017. Nextflow enables reproducible computational workflows. Nat Biotechnol 35:316–319. doi: 10.1038/nbt.3820 [DOI] [PubMed] [Google Scholar]
  • 14. Kruczkiewicz P, Lung O. 2023. CFIA-NCFAD/Nf-Virontus V2.0.0Dev1 (2.0.0Dev1). Zenodo. doi: 10.5281/zenodo.10626229 [DOI]
  • 15. Patel H, Monzón S, Varona S, Espinosa-Carrasco J, Garcia MU, Heuer ML, Underwood A, Gabernet G, Ewels P, MiguelJulia K, S T, H F, Wilson S, Erika S, K W, M jcurado, Menden K. 2023. Nf-core/Viralrecon: Nf-core/Viralrecon V2.6.0 - Rhodium Raccoon (2.6.0). Zenodo. doi: 10.5281/zenodo.7764938 [DOI] [Google Scholar]
  • 16. Ewels PA, Peltzer A, Fillinger S, Patel H, Alneberg J, Wilm A, Garcia MU, Di Tommaso P, Nahnsen S. 2020. The nf-core framework for community-curated bioinformatics pipelines. Nat Biotechnol 38:276–278. doi: 10.1038/s41587-020-0439-x [DOI] [PubMed] [Google Scholar]
  • 17. O’Toole Á, Scher E, Underwood A, Jackson B, Hill V, McCrone JT, Colquhoun R, Ruis C, Abu-Dahab K, Taylor B, Yeats C, du Plessis L, Maloney D, Medd N, Attwood SW, Aanensen DM, Holmes EC, Pybus OG, Rambaut A. 2021. Assignment of epidemiological lineages in an emerging pandemic using the pangolin tool. Virus Evol 7:veab064. doi: 10.1093/ve/veab064 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Bugembe DL, Phan MVT, Ssewanyana I, Semanda P, Nansumba H, Dhaala B, Nabadda S, O’Toole ÁN, Rambaut A, Kaleebu P, Cotten M. 2021. Emergence and spread of a SARS-CoV-2 lineage a variant (A.23.1) with altered spike protein in Uganda. Nat Microbiol 6:1094. doi: 10.1038/s41564-021-00933-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Turakhia Y, Thornlow B, Hinrichs AS, De Maio N, Gozashti L, Lanfear R, Haussler D, Corbett-Detig R. 2021. Ultrafast sample placement on existing tRees (UShER) enables real-time phylogenetics for the SARS-CoV-2 pandemic. Nat Genet 53:809–816. doi: 10.1038/s41588-021-00862-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Shu Y, McCauley J. 2017. GISAID: global initiative on sharing all influenza data – from vision to reality. Euro Surveill 22:30494. doi: 10.2807/1560-7917.ES.2017.22.13.30494 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30:772–780. doi: 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol 32:268–274. doi: 10.1093/molbev/msu300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods 14:587–589. doi: 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Minh BQ, Nguyen MAT, von Haeseler A. 2013. Ultrafast approximation for phylogenetic bootstrap. Mol Biol Evol 30:1188–1195. doi: 10.1093/molbev/mst024 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

These two cat SARS-CoV-2 genomes (WIN-AH-2021-OTH-Kari-0029-OS-1 and NCFAD-2020-0085) were deposited in the GenBank (accession numbers: OR999078.1 and OR999071.1). The accession numbers for the Illumina MiSeq and Oxford Nanopore GridION sequencing raw reads in the NCBI Sequence Read Archive (SRA) are PRJNA1055551 (BioProject), SRR27318679 (SRA), and SAMN39052760 (BioSample) for WIN-AH-2021-OTH-Kari-0029-OS-1 sample and PRJNA1055563 (BioProject), SRR27319240 (SRA), and SAMN39053918 (BioSample) for NCFAD-2020-0085 sample.

Articles from Microbiology Resource Announcements are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES