Table 1. Target genes, oligonucleotide primer sequences, amplicons, and cycling conditions used for PCR.

Target gene	Specificity	Primer sequence (5’–3’)	Amplified product size (bp)	PCR cycling condition	Reference
16S rRNA	Housekeeping gene	F: ACTGGGACTGAGACACGG R: GATAACGCTTGCCACCTA	242	First, denaturation for 5 minutes at 94°C was followed by 35 cycles of 30 seconds at 94°C, 1 minute at 52°C, and 30 seconds at 55°C. Finally, elongation took place for 7 minutes at 72°C.	Huang et al., 2021
plcR	Pleiotropic regulator	F: ACCCGACATTAAAATCGTTTG R: TAGTATGCCTTGCGCAGTTG	200	First, denaturation for 2 minutes at 94°C was followed by 30 cycles of 30 seconds at 94°C, 1 minute at 52°C, and 30 seconds at 72°C. Finally, elongation took place for 10 minutes at 72°C.	Oltuszak-Walczak, et al., 2013
tasA	Amyloid like fiber	F: AGCAGCTTTAGTTGG TGG AG R: GTA ACT TAT CGC CTT GGA ATTG	488	First, denaturation for 5 minutes at 94°C was followed by 40 cycles of 30 seconds at 94°C, 45 seconds at 59°C, and 45 seconds at 72°C. Finally, elongation took place for 5 minutes at 72°C.	Caro-Astorga et al., 2015
sipW	Signal peptidase	F: AGA TAA TTA GCA ACG CGA TCTC R: AGA AAT AGC GGA ATA ACC AAGC	488	First, denaturation for 5 minutes at 94°C was followed by 40 cycles of 30 seconds at 94°C, 45 seconds at 54°C, and 45 seconds at 72°C. Finally, elongation took place for 5 minutes at 72°C.