Reagents and tools table
| Reagent/resource | Reference or source | Identifier or catalogue # |
|---|---|---|
| Antibodies | ||
| Mouse anti-β-Actin | Sigma-Aldrich | Cat# A2228; RRID:AB_476697 |
| Rabbit anti-GLUT1 | Millipore | Cat# 07-1401; RRID:AB_1587074 |
| Rabbit anti-GAPDH | Cell Signaling Technology | Cat# 2118; RRID:AB_561053 |
| Rabbit anti-GOT1 | Proteintech Group | Cat# 14886-1-AP; RRID:AB_2113630 |
| Rabbit anti-HA, Clone C29F4 | Cell Signaling Technology | Cat# 3724; RRID:AB_1549585 |
| Mouse anti-HIF1α, Clone 54 | BD Biosciences | Cat# 610958; RRID:AB_398271 |
| Rabbit anti-HIF-2α | Abcam | Cat# ab199; RRID:AB_302739 |
| Rabbit anti-HK2, Clone C64G5 | Cell Signaling Technology | Cat# 2867; RRID:AB_2232946 |
| Rabbit anti-hydroxy-HIF1α Pro564, Clone D43B5 | Cell Signaling Technology | Cat# 3434S; RRID:AB_2116958 |
| Rabbit anti-LDHA | Cell Signaling Technology | Cat# 2012S; RRID:AB_2137173 |
| Rabbit anti-MDH1 | Atlas Antibodies | Cat# HPA027296; RRID:AB_10611118 |
| Rabbit anti-PDH2, Clone D31E11 | Cell Signaling Technology | Cat# 4835S; RRID:AB_10561316 |
| Rabbit anti-PDHE-1α pSer293 | Abcam | Cat# ab92696; RRID:AB_10711672 |
| Rabbit anti-PDK1, Clone C47H1 | Cell Signaling Technology | Cat# 3820; RRID:AB_1904078 |
| Rabbit anti-PKM2, Clone D78A4 | Cell Signaling Technology | Cat# 4053; RRID:AB_1904096 |
| Mouse anti-Tubulin, Clone DM1A | Sigma-Aldrich | Cat# T9026; RRID:AB_477593 |
| Goat anti-rabbit IgG antibody conjugated to HRP | Millipore | Cat# AP132P |
| Goat anti-mouse IgG antibody conjugated to HRP | Millipore | Cat# AP127P |
| Bacterial strains | ||
| Subcloning efficiency DH5α competent cells | Thermo Fisher Scientific | Cat# 18265017 |
| Chemicals, peptides, and recombinant proteins | ||
| Acetic acid | Fisher Scientific | Cat# A10360/PB17 |
| Acetonitrile, Optima LC-MS grade | Fisher Scientific | Cat# A955-212 |
| Ammonium bicarbonate | Fisher Scientific | Cat# 10785511 |
| Antimycin A | Sigma-Aldrich | Cat# A8674 |
| BbsI | Thermo Fisher Scientific | Cat# ER1001 |
| β-Mercaptoethanol | Sigma-Aldrich | Cat# M6250 |
| Bromophenol blue | Sigma-Aldrich | Cat# B0126 |
| Bovine serum albumin | Sigma-Aldrich | Cat# A9647 |
| Blasticidin | Millipore | Cat# 203350 |
| N,O-bis(trimetylsilyl)trifluoroacetamide (BSTFA) + 1% trimethylchlorosilane (TMCS) | Sigma-Aldrich | Cat# 33148 |
| Chloroform | Acros Organics | Cat# 390760025 |
| Cholera toxin | Sigma-Aldrich | Cat# C-8052 |
| Crystal violet | Sigma-Aldrich | Cat# C3886 |
| DMEM, high glucose, no glutamine | Thermo Fisher Scientific | Cat# 11960085 |
| DMEM, no glucose, no glutamine, no phenol red | Thermo Fisher Scientific | Cat# A14430 |
| DMEM/F12 | Thermo Fisher Scientific | Cat# 21331046 |
| DMEM-F12 no glutamine, no glucose | Generon | Cat# L0091 |
| Ethanol | Fisher Scientific | Cat# E/650DF/17 |
| EGF | Preprotech | Cat# 100-15 |
| Foetal calf serum | Sigma-Aldrich | Cat# F7524 |
| FG-4592 | Cayman Chemical | Cat# 15294 |
| Fugene HD | Promega | Cat# E2691 |
| Glucose | Sigma-Aldrich | Cat# SLBC6575V |
| Glucose (4-2H) | Omicron Biochemicals | Cat# GLC-035 |
| Glucose (13C6) | Sigma-Aldrich | Cat# 389374 |
| Glutamine | Thermo Fisher Scientific | Cat# 25030-081 |
| Glycerol | Sigma-Aldrich | Cat# G5516 |
| Horse serum | Thermo Fisher Scientific | Cat# 16050-122 |
| Glutamine (13C5) | Cambridge Isotope Laboratories | Cat# CLM-1822 |
| Hydrocortisone | Sigma-Aldrich | Cat# H-0888 |
| Insulin | Sigma-Aldrich | Cat# I-1882 |
| Lactate | Sigma-Aldrich | Cat# L7022 |
| Methanol, Optima LC-MS grade | Fisher Scientific | Cat# A456-212 |
| MG-132 | Sigma-Aldrich | Cat# 474787 |
| MluI | Thermo Fisher Scientific | Cat# FD0564 |
| β-Nicotinamide adenine dinucleotide (NAD) | Sigma-Aldrich | Cat# N1511 |
| β-Nicotinamide adenine dinucleotide, reduced (NADH) | Sigma-Aldrich | Cat# N8129 |
| β-Nicotinamide mononucleotide (NMN) | BioVision | Cat #2733 |
| Nicotinamide riboside (NR) | Cayman Chemical | Cat #23132 |
| Oligomycin | Sigma-Aldrich | Cat# O4876 |
| Penicillin–streptomycin | Thermo Fisher Scientific | Cat# 15140-122 |
| Paraformaldehyde (PFA) | Sigma-Aldrich | Cat# 158127 |
| Polybrene | Sigma-Aldrich | Cat# H9268 |
| Pyromycin dihydrochloride | Sigma-Aldrich | Cat# P7255 |
| Pyridine | Sigma-Aldrich | Cat# 270970 |
| Pyruvate | Sigma-Aldrich | Cat# P5280 |
| Sodium dodecyl sulfate (SDS) | Sigma-Aldrich | Cat# 400036 |
| Scyllo-Inositol | Sigma-Aldrich | Cat# I8132 |
| Trizol | Thermo Fisher Scientific | Cat# 15596026 |
| Tween-20 | Sigma-Aldrich | Cat# P7949 |
| Valine (15N,13C) | Cambridge Isotope Laboratories | Cat# CNLM-442-H-PK |
| WZB-115 | Merck Millipore | Cat# 400036 |
| XhoI | Thermo Fisher Scientific | Cat# FD0694 |
| Critical commercial assays | ||
| BCA Protein Assay Kit | Thermo Fisher Scientific | Cat #23225 |
| CellTiter-Glo Luminescent Cell Viability Assay | Promega | Cat# G7570 |
| Glucose Uptake-Glo Assay | Promega | Cat# J1341 |
| Deposited data | ||
| RNA sequencing data: wild-type and HIF1α-mutant MCF7 cells in normoxia (21% O2), and in hypoxia (1% O2) for 3 h or 24 h | This study | GEO: GSE122059 |
| Experimental models: cell lines | ||
| Human: MCF7 | ATCC | Cat# CRL-12584; RRID:CVCL_0031 |
| Human: MCF10A | ATCC | Cat# CRL-10317; RRID:CVCL_0598 |
| Human: HEK-293T | ATCC | Cat# CRL-321; RRID:CVCL_0063 |
| Human: MDA- MC-231 | ATCC | Cat# CRM-HTB-26; RRID:CVCL_0062 |
| Human: BT-474 | ATCC | Cat# HTB-20; RRID:CVCL_0179 |
| Oligonucleotides | ||
|
Forward primer GOT1 cDNA amplification: cgcacgcgtaccATGGCACCTCCGTCAGTC |
This study | N/A |
|
Reverse primer GOT1 cDNA amplification: gcgctcgagCTGGATTTTGGTGACTGCTTC |
This study | N/A |
|
Forward primer LDHA cDNA amplification: cgcacgcgtaccATGGCAACTCTAAAGGATCAG |
This study | N/A |
|
Reverse primer LDHA cDNA amplification: gcgctcgagAAATTGCAGCTCCTTTTGGATC |
This study | N/A |
|
Forward primer HIF1α CRISPR sgRNA: caccgTTCTTTACTTCGCCGAGATC |
This study | N/A |
|
Reverse primer HIF1α CRISPR sgRNA: aaacGATCTCGGCGAAGTAAAGAAc |
This study | N/A |
|
Forward primer GOT1 CRISPR sgRNA: caccgAGTCTTTGCCGAGGTTCCGC |
This study | N/A |
|
Reverse primer GOT1 CRISPR sgRNA: aaacGCGGAACCTCGGCAAAGACTc |
This study | N/A |
|
Forward primer LHDA CRISPR sgRNA: caccGGCTGGGGCACGTCAGCAAG |
This study | N/A |
|
Reverse primer LHDA CRISPR sgRNA: aaacCTTGCTGACGTGCCCCAGCC |
This study | N/A |
| Forward primer HIF1α knockout validation: TTCCATCTCGTGTTTTTCTTGTTGT | This study | N/A |
| Reverse primer HIF1α knockout validation: CAAAACATTGCGACCACCTTCT | This study | N/A |
|
M13 forward primer: TGTAAAACGACGGCCAGT |
This study | N/A |
| Recombinant DNA | ||
| pMSCV-Peredox-mCherry-NLS | Addgene | Cat# 32385 |
| pSpCas9(BB)-2A-Puro (PX459) V2.0 | Addgene | Cat# 62988 |
| pUC57-LbNOX | Addgene | Cat# 75285 |
| pLenti-HA-IRES-BSD | Origene | Cat# PS100104 |
| pLenti-GFP-P2A-BSD | Origene | Cat# PS100103 |
| pOTB7-GOT1 | Dharmacon | Clone ID: BC000498 |
| pDNR-LIB-LDHA | Dharmacon | Clone ID: BC067223 |
| Software and algorithms | ||
| Prism v7.0c | GraphPad Software | N/A |
| Chemstation | Agilent | N/A |
| Masshunter | Agilent | N/A |
| Xcalibur QualBrowser | Thermo Fisher Scientific | N/A |
| Tracefinder v4.1 | Thermo Fisher Scientific | N/A |