Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Primary Ab-SYCP3 | Abcam | ab97672 |
| Alexa Fluor 488 Goat anti-Mouse IgG | Thermo Fisher Scientific | A-21121 |
| Bacterial and virus strains | ||
| Biological samples | ||
| WT C57BL/6J (P) × CAST/EiJ (M) F1 mouse embryo | This paper | N/A |
| WT CAST/EiJ (P) × C57BL/6J (M) F1 mouse embryo | This paper | N/A |
| XistXm/- female mouse embryo | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Acid Tyrode’s solution | Sigma-Aldrich | Cat#T1788-100ML |
| acetylated BSA | Sigma-Aldrich | Cat#B8894-5ML |
| RNase inhibitor | Roche | Cat#3335399001 |
| DTT | Thermo Fisher Scientific | Cat#P2325 |
| ATP | New England BioLabs | Cat#P0756S |
| Betaine | SIGMA-ALDRICH | Cat#B0300-5VL |
| Biotin-14-CTP | Thermo Fisher Scientific | Cat#19519-016 |
| RLT plus buffer | Qiagen | Cat#1053393 |
| Unmethylated lambda DNA | Promega | Cat#D1521 |
| 4-Thiouridine | Sigma-Aldrich | Cat#T4509-25MG |
| Iodoacetamide (IAA) | Sigma-Aldrich | Cat#I1149-5G |
| Cy3-dUTP | Enzo life Sciences | Cat#enz-42501 |
| Aminoallyl-dUTP-XX-AF647 | Jena BioScience | Cat#NU-803-XX-AF647-S |
| Tergitol | Sigma-Aldrich | Cat#NP40S-100ML |
| Ribonucleoside-vanadyl complex | New England BioLabs | Cat#S1402S |
| Critical commercial assays | ||
| Agencourt AMPure XP Beads | Beckman Coulter | Cat# A63881 |
| Streptavidin C1 beads | Thermo Fisher Scientific | Cat#65001 |
| Nextera XT DNA library preparation kit | Illumina | Cat#FC-131-1024 |
| Nextera XT Index Kit | Illumina | Cat#FC-131-1001 |
| Kapa high fidelity PCR mix | Kapa Biosystems | Cat# KK2601 |
| EZ methylation kit | Zyon | Cat# D5020 |
| PureLink PCR Purifiation kit | Thermo Fisher Scientific | Cat#K310001 |
| Qubit dsDNA Quantification Assay Kit | Thermo Fisher Scientific | Cat#Q32851 |
| Deposited data | ||
| Single embryo So-Smart-seq, 4SU-RNAseq, Bisulfite- DNAseq and bulk RNA-seq data | This paper | GSE168455 |
| Early embryo Hi-C data | Du et al.46 | GSE82185 |
| Early embryo H3K27me3 ChIP-seq data | Zheng et al.60 | GSE76687 |
| Early embryo ATAC-seq data | Wu et al.65 | GSE66390 |
| Male germline single-cell RNAseq | Chen et al.66 | GSE107644 |
| Sperm ATAC-seq | Jung et al.67 | GSE79230 |
| Experimental models: Cell lines | ||
| Mouse: ES cell line: TsixTST/+ | Ogawa et al.84 | N/A |
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6J: WT | Jackson Laboratory | Cat#000664 |
| Mouse: CAST/EiJ: WT | Jackson Laboratory | Cat#000928 |
| Mouse: 129S1/SvlmJ: Xist−/Y | Marahrens et al.32 | N/A |
| Oligonucleotides | ||
| Reverse-dT Primers for So-smart-seq: TTTCCCTACACGACGCTCTTCCGATCTNNNNNNTTTTTTTTTTTTTTTVVN | This paper | N/A |
| GGrG oligo iCiGiCGGAGTTCAGACGTGTGCTCTTCCGATCTrGrG+G |
This paper | N/A |
| Library PCR forward primer: GTGACTGGAGTTCAGACGTGTGCTCTTC | This paper | N/A |
| Library PCR reverse primer: ACACTCTTTCCCTACACGACGCTCTTC | This paper | N/A |
| oligo-dT for Alkylation-dependent RNAseq: /5Biotin-TEG/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN | Hendriks et al.44 | N/A |
| ISPCR Reverse primer: AAGCAGTGGTATCAACGCAGAGT | Hendriks et al.44 | N/A |
| NEBNext Multiplex Oligos for Illumina | New England BioLabs | E7335S |
| Oligos for ribosomal cDNA depletion (see Table S5) | This paper | N/A |
| Short oligo probes for FISH experiments (see Table S6) | This paper | N/A |
| Nextera XT Index Kit | Illumina | Cat#FC-131-1001 |
| Recombinant DNA | ||
| Software and algorithms | ||
| edgeR | Robinson et al.89 | N/A |
| Trim Galore | Babraham Bioinformatics Group | N/A |
| STAR | Dobin et al.87 | N/A |
| RepeatMasker | Smit et al.91 | N/A |
| featureCounts | Liao et al.88 | N/A |
| sam2tsv | Lindenbaum92 | N/A |
| Novoalign | Novocraft | N/A |
| DeepTools | Ramirez et al.93 | N/A |
| Bismark | Krueger et al.94 | N/A |
| Rstudio | Posit | N/A |
| SingleCellExperiment | Amezquita et al.95 | N/A |
| scran | Lun et al.96 | N/A |
| pheatmap | https://cran.r-project.org/web/packages/pheatmap/pheatmap.pdf | N/A |
| NbClust | Charrad et al.97 | N/A |
| gridExtra | https://cran.r-project.org/web/packages/gridxtra/index.html | N/A |
| ggplot2 | Wickham98 | N/A |
| IGV | Thorvaldsdottir et al.90 | N/A |
| R scripts for the plots generated in this paper | This paper | doi:10.7910/DVN/W7RJFI |
| Other | ||