Skip to main content
Poultry Science logoLink to Poultry Science
. 2024 Mar 28;103(6):103695. doi: 10.1016/j.psj.2024.103695

The beneficial impacts of nano-propolis liposomes as an anti-stressor agent on broiler chickens kept under cyclic heat stress

Jayda G Eldiasty *,1, Hanan MA Al-Sayed †,, Reem M Farsi §, Khloud M Algothmi §,#, Fatema S Alatawi ǁ, Areej J AlGhabban , Wareef H Alnawwar ⁎⁎, Asma O Alatawi ††, Haggag M Hamdy ‡‡
PMCID: PMC11036096  PMID: 38626693

Abstract

This research assessed the impacts of dietary nano-propolis liposomes (NPRL) inclusion on the growth, blood biochemical components, immune function, and oxidative status of broilers exposed to cyclic heat stress (HS). Birds were fed with a basal diet supplemented with various levels of NPRL at 0 (HS), 100 (NPRL100), 250 (NPRL250) and 400 (NPRL400) mg/kg diets. Diets supplemented with NPRL significantly improved the growth indices and feed utilization, hemoglobin and red blood cells (P < 0.01). White blood cells, lymphocytes and monocytes were significantly decreased by NPRL inclusion (P < 0.001). Dietary supplementation of 250 or 400 mg of NPRL /kg reduced the pathogenic bacteria counts (Salmonella, E. coli and Enterococci) (P < 0.01). The birds fed diets with NPRL (400 mg/kg diet) significantly downregulated the mRNA IFNγ gene (p < 0.001), while both groups (NPRL100 and NPRL250) had similar results (P > 0.05). The iNOS gene was significantly decreased by the dietary NPRL inclusion in a dose-dependent manner. Birds in NRPL groups had inferior levels of the mRNA of interleukin-4 and tumor necrosis factor genes. The lysosome activity was significantly reduced by dietary 250 or 400 mg of NPRL inclusion (P < 0.001). Birds in NPRL250 and NPRL100 had greater IgG (P < 0.05) than the other groups. Regarding oxidative-related biomarkers, dietary NPRL inclusion decreased myeloperoxidase and malondialdehyde levels significantly compared to those with the HS group (P < 0.001). Broilers in the NPRL400 group had the lowest levels of total bilirubin and gamma-glutamyl transferase. NPRL250 had the lowest values of urea compared with other groups (P < 0.001). Dietary NPRL inclusion improved the broiler's hepatic and intestinal architecture exposed to cyclic heat stress. These results indicate that employing NPRL in the diets of stressed broilers can enhance heat resistance by enhancing blood metabolites and immunity, reducing inflammation and oxidative stress.

Key words: heat stress, broiler, microbiota, hepatic health, nanoliposomes

INTRODUCTION

Undoubtedly, global warming poses a considerable obstacle to the poultry industry, especially in regions with tropical climates. This occurrence subjects animals to heat stress (HS) conditions, resulting in a range of biological alterations (Kpomasse et al., 2021; Part et al., 2016). Therefore, HS represents a significant environmental hurdle in the field of poultry farming (da Silva et al., 2014). Additionally, HS decreases body weight meat yield and modifies redox homeostasis, health status, survival, and overall poultry welfare (Liu et al., 2022). Furthermore, HS has detrimental effects on the immune reactions of the animals and triggers inflammatory responses (Awad et al., 2020). Heat stress also promotes changes in the transcriptomic level, DNA damage and lipid peroxidation and finally modifies the proteomic alterations (Lu et al., 2019; Awad et al., 2020; Rafeeq et al., 2023). Several mitigation approaches have been established to reduce these harmful influences of HS on broilers via dietary manipulation.

For instance, recent findings have demonstrated that incorporating bioactive natural antioxidants into the diet is an advantageous approach to combat the adverse effects of oxidative stress (OS) induced by HS (Puvača et al., 2022). Phytochemicals are among the most applied natural antioxidants used for growth enhancement and boosting the immunity of birds in adverse environments (Seven et al., 2008; Awad et al., 2019). However, there are limitations to using phytochemicals in these proposes due to their volatility instability, poor aqueous solubility, and inadmissible taste (Aytekin et al., 2020; Abdelnour et al., 2023). To solve these issues, the use of nanotechnology, such as liposomes as colloidal constructions with a spherical shape prepared of phospholipid bilayer membranes (Refaat et al., 2021; Sheikholeslami et al., 2022) and an internal aqueous partition could be used to increase their functionality, stability, and bioactivities and vanquish OS effects.

Propolis (PRO) is one of the most widely used beekeeping products. It's composed of various constituents such as phenolic acids, terpenoids, and flavonoids, considered PRO's main biologically active substances (AL-Kahtani et al., 2022; Kasote et al., 2022). PRO is a natural polyphenol biomolecule with robust antioxidant impacts (Kasote et al., 2022). As a share of the natural options supporting general health and immune status (AL-Kahtani et al., 2022). Propolis has anti-inflammatory, anti-viral (Refaat et al., 2021), antibacterial (Aytekin et al., 2020), and antioxidant (AL-Kahtani et al., 2022) impacts that contribute to the conservation of cellular integrity in various organs. Encapsulation of PRO with the support of liposomes is favorable for their biological and chemical purposes, as stated by Abdelnour et al. (2023), who observed that nano-propolis-liposomes (NPRL) improved the sperm quality and freezing ability in buffalo.

Moreover, Refaat et al. (2021) clarified the anti-viral action of NPRL against COVID-19. In light of this, liposomes are reflected biocompatible transporters that can be made from lipids with biophysical functions and loaded with molecules of several hydrophilic and lipophilic environments (Sheikholeslami et al., 2022). Lipophilic constituents, such as PRO, are often incorporated into the lipid bilayer for regulation (Refaat et al. 2021). NPRL has exhibited several biological events such as anti-viral effects (Refaat et al. 2021), antimicrobial properties and antioxidant effects (Aytekin et al., 2020). After screening the literature, no data are available on the use of NPRL in combating the adverse impacts of cyclic HS on broiler health and performance. Several previous works (Shalmany and Shivazad 2006; Attia et al., 2014; Shaddel et al., 2017; AL-Kahtani et al., 2022; Hsiao et al., 2022) have revealed that fortified broiler diets with PRO could be favorable for broiler health and performance via minimizing the inflammation/oxidative stress and boosting the immune function and antioxidant responses. We hypothesized that dietary NPRL would support broiler chickens' health, immunity, and growth performance subjected to cyclic HS. To our comprehension, no investigation has explored the impact of NPRL on blood components, growth, immune features, and microbiota modulation in heat-stressed broiler chickens. Hence, this research is targeted at assessing the impact of NPRL on growth, serum redox status, microbiota, and inflammatory-related genes of broilers exposed to cyclic heat stress.

MATERIALS AND METHODS

Ethics Statement

All animal trials were achieved, conferring to the procedures approved by the Institutional Animal Care and Use Committee. The research was carried out at the University of Tabuk, Saudi Arabia.

Preparation of Nano-Propolis Liposomes

PRO was procured from Nature Care Company (Riyadh, Saudi Arabia). Following the protocol of (Mutalik et al., 2014), the NPRL was prepared via the conventional thin-film hydration technique with slight modifications. In brief, PRO, cholesterol, and soybean lecithin were mixed and dissolved in the organic solvent mixture (methanol and chloroform, 1:2 v/v). Then, the mixture was exposed to a rotary evaporator until the organic solvent mixture was fully evaporated. After that, the nanoliposomal of PRO was obtained. The NPRL was added to the diet according to the study protocol. The morphology of NPRL was detected by JEM-2100F TEM (JEOL, Japan) (Fig. 1).

Figure 1.

Figure 1

The morphology of nano-propolis liposomes was detected by JEM-2100F TEM (JEOL, Japan), and the TEM image showed that NPRL had a spherical morphology and no aggregated (A). A particle size distribution (mean/nm) histogram determined from the TEM (B).

Experimental Design and Bird Management

A total of 240 one-day-old male Ross-308 broiler chicks were weighed individually and randomly distributed into 4 identical investigational treatments (6 replicates of 10 birds each). During the study period, the birds were exposed to cyclic heat stress conditions (34°C from 9:00 am to 17:00 pm and 24°C for the rest of the time, 65–70% RH). Birds were fed with a basal diet supplemented with various levels of NPRL at 0 (HS), 100 (NPRL100), 250 (NPRL250) and 400 (NPRL400) mg/kg diets. The dosage of NPRL was added according to the previous study (Meligy et al., 2023). All birds were housed in stainless steel cages with continuous light exposure and unrestricted access to water and feed. According to the guidelines outlined in the Ross Broiler Commercial Management Guide, the broiler chicks were raised from 1 to 10 d of age. From 10 to 35 d of age, the groups followed the recommendations provided in the same guide (Corzo et al., 2008). The diets (Table 1) were formulated in mash form and divided into 3 phases (starter for 1–10 d of age, grower for 11–25 d of age, and finisher for 26–35 d of age) to fulfill the specific nutritional requirements of chicken.

Table 1.

The ingredients and chemical composition of the experimental starter, grower, and finisher diets used in this experiment.

Ingredient Starter Grower Finisher
(1–10 d) (11–25 d) (26–35 d)
Soybean meal, 46% 37 32.2 24.4
Soya oil 2.7 2.5 3.7
Yellow corn 52.6 56.8 62.7
Corn gluten meal, 60% 3.5 4.2 5.1
Calcium carbonate 1.1 1.1 1.05
Sodium becarnonate 0.15 0.15 0.2
Dl Methionine, 99% 0.28 0.32 0.3
l-Lysine HCl, 98% 0.18 0.21 0.32
Dicalcium phosphate 1.8 1.8 1.8
Salt 0.3 0.3 0.3
Choline chloride, 60% 0.04 0.04 0.04
L-Threonine 0.05 0.08 0.09
Premix 0.3 0.3 0.3
Chemical analysis on DM basis
AME kcal 3000 3050 3150
Crude protein, % 23.02 21.05 19.04
Available P, % 0.48 0.48 0.44
Sodium, % 0.18 0.18 0.18
Calcium, % 0.96 0.96 0.87
Chloride, % 0.24 0.24 0.24

Hero mix (Hero pharm, Cairo, Egypt). Composition (per 3 kg): Vitamin A 12,000,000 IU, vitamin D3 2,500,000 IU, vitamin E 10,000 mg., vitamin K3 2000 mg., vitamin B2 5000 mg., vitamin B1 1000 mg., vitamin B6 1500 mg, vitamin B12 10 mg, folic acid 1000 mg., biotin 50 mg, pantothenic acid 10,000 mg, niacin 30,000 mg, iodine 300 mg, manganese 60,000 mg., iron 30,000 mg., zinc 50,000 mg., selenium 100 mg, copper 4,000 mg., and cobalt 100 mg.

Growth Indices

At the end of the trial, we estimated all growth-related indices, including final body weight (FBW), the feed conversion ratio (FCR), and body weight gain (BWG). The FBW was considered at the end of the trial (after 35 d of treatments). The final BWG was determined by subtracting the FBW of each week from the initial body weight (IBW, g). The feed intake was calculated weekly for each pen, and the total feed intakes (TFI, g) were considered. According to the data obtained for FBWG (g), and the TFI (g), we calculated the FCR as follows (TFI, g/FBWG, g).

Carcass Traits

After 35 d of treatment, birds were fasted for 12 h. Five birds from each group were randomly selected and slaughtered following the Islamic process (Addeen et al., 2014). The carcass, liver, and gizzard weights were assessed and reported as grams per kilogram of live weight at the time of slaughter. Measurements were taken for the carcass, dressed weight, and giblets. The dressed weight was calculated by dividing the sum of the carcass weight and giblet weight by the live body weight.

Sample Collection

Blood samples (n = 6 in each group) were collected into sterilized tubes from the wing veins, and then the collected blood was left at room temperature to separate the serum. After 2 h, the samples were exposed to centrifugation at 3000 g for 20 minutes. Animals were sacrificed by dislocating the cervical spine following the Islamic process. After exsanguination and evisceration, the entire gastrointestinal region was quickly separated. Samples of the cecal content were gathered and preserved at −20°C for microbiota assessment. Hepatic tissues were extracted and frozen at −80°C until used for gene expression analysis. For assessing histopathological examination, hepatic and intestinal samples were picked up and immediately placed in 10% formalin.

Blood Metabolites Assay

Creatinine, urea, gamma-glutamyl transferase (GGT) and total bilirubin were evaluated using the colorimetric method with commercial kits provided by Diamond Diagnostics Com., (Giza Egypt), conferring to the manufacturer's guidelines. The serum lysosome activity (LYZ) activity was assessed based on the Micrococcus lysodeikticus procedure following the methodology of (Zhang et al., 2005; Liu et al., 2010). The ELISA kits for serum immunoglobulins IgG (Cat No. MBS260043) and IgM (Cat No. MBS687565) were provided by the Biosourece Company using the double antibody sandwich ELISA technique following the previous method of Zhang et al. (2005). Nitric oxide (NO; ab272517) and myeloperoxidase (MYO; ab285308) were assessed in the serum of broiler according to the colorimetric method following the protocol of (Liu et al., 2010) and (Zhang et al., 2005), respectively using the kits provided by ABcam company. Malondialdehyde (MDA) was assessed to identify lipid peroxidation in the serum following (Richard et al., 1992). The antioxidant-related biomarkers, including superoxide dismutase (SOD), glutathione (GSH) and catalase (CAT) were assessed (Marklund et al., 1974) by colorimetric method using commercial kits (Diamond Diagnostics, Egypt) according to the producer's guidelines in the serum of broiler.

Cecal Microbiota

At the end of the test, the cecal content of birds (6 birds/ group) was collected to estimate the microbiota community in response to dietary NPRL inclusion under cyclic HS. The total bacterial count (TBC), Salmonella, Enterococci, total yeast, E. coli count, and LAB (Lactobacillus count) were estimated. The digesta samples were homogenized in PBS (1 mL) was serially diluted. Dilutions were therefore coated on duplicate selective agar media to count bacterial target clusters. The Salmonella, TBC, Enterococci, Lactobacillus spp., and total yeast counted expending nutrient agar, MacConkey agar, Lactobacillus MRS Agar (LMRS) agar, and potato dextrose agar, respectively, based on the method of (Tuohy et al., 2002) Dishes were then reserved at 37°C for 24 h under aerobic environments for microbial, and 1 wk at 25°C for fungi, and then clusters were calculated.

Histological Examination

After slaughtering, the abdominal cavity of birds (n = 3 from each group) was opened to obtain hepatic and intestinal tissues for histological examination. The samples were washed with PBS and placed in 10% formalin for 3 d. Subsequently, the specimens were dehydrated in gradual concentrations of ethanol, cleaned in xylene, and finally saturated in paraffin (Tarek et al., 2013). The specimens were cut into 2 μm thickness sections using a microtome. These sections were placed in a floating bath at 37°C, adhered to slides, and dried. The sections were then stained using the hematoxylin and eosin procedure. Microscopic examination was conducted to detect tissue alterations, and images were captured using a digital camera (Al-Mufarrej et al., 2019).

Genes Expression Analysis

Hepatic tissues were used to measure the expression of inflammatory genes such as interleukin-4 (IL-4), inducible nitric oxide synthase (iNOS), tumor necrosis factor α (TNFα), interferon-gamma (IFNγ), and nuclear factor kappa B (NFκB). RNA was isolated from hepatic tissues using TRIzol reagent (Invitrogen). The isolated RNA was checked for purity using a NanoDrop spectrophotometer (260/280). The QuantiTect reverse transcription kit was used with 2 μg of total RNA for cDNA synthesis, and a random primer hexamer was used in the 2-step RT-PCR reaction. Routine PCR and gel electrophoresis were performed to validate all the primers before real-time PCR (TaKaRa PCR Thermal Cycler Dices, Takara, Shiga, Japan). Real-time PCR was conducted, and the 2−ΔΔCT method was used for analysis (Livak and Schmittgen, 2001). The GAPDH gene was used as an endogenous control. The primer sequences used in this study are provided in Table 2.

Table 2.

The gene names, forward, and reverse primer sequences utilized in the present experiment.

Gene name1 Nucleotide sequence (5’ - 3’) Product length (bp) GenBank accession number
Inos F: ACCAAGGACTTACAGGTGTGG
R: CTCAGGTCCTGCTGAACAGT
153 NM_204961.2
IFNγ F: TTCAGCGGTTCATCAGAGGG
AGCCACAAGGGCTACTCCTA
214 NM_205149.2
IL-4 F: CCTCCCTCAAGGTAAGGCTC
R: GAGCAATGTGCCCAGAGTGT
156 NM_001007079
TNF-α F: CGCCGTGGTGAACAGACT
R: CGGTGCCATACCTCCATCTC
148 XM_046900549.1
NFκB F: CCCATGGTAACTCGGGACAG
R: ATACGGTCCATCTGCTGTTCG
208 NM_205134 131
GAPDH F: TCAAATGGGCAGATGCAGGT
R: TGATGGCATGGACAGTGGTC
230 NM205518
1

IL-4, Interleukin 4; IFNγ, interferon gamma; iNOS, inducible nitric oxide synthase; TNF-α, tumor necrosis factor alpha; NF-κB, nuclear factor kappa B.

Statistical Analysis

The data were edited in Microsoft Excel version 16 (Microsoft Corporation, Redmond, WA). The collected results were checked for normal distribution and homogeneity using the Shapiro–Wilk test. Data were analyzed by SPSS (Version 21.0; IBM CO., Chicago, IL) using a one-way ANOVA test. Multiple comparisons between means were conducted according to Duncan's multiple-range tests. P < 0.05 was considered significant. Data were presented as mean ± standard deviation. Figures were fitted using the GraphPad Prism software 9.0 (GraphPad, University of California San Diego).

RESULTS

Growth Performance

The FBW and FBWG of broilers fed with NPRL in their diets were greater (P < 0.05) than in broilers of the HS group (Table 3). NPRL250 and NPRL400 groups had the best results for FBW and FBWG. NPRL (250 or 400 mg/kg diet) improved significantly the FCR (P < 0.001). Stressed broilers had higher TFI and FCR than NPRL-treated groups. Overall, this indicates that the growth and feed utilization in the broiler were improved by NPRL supplementation during the HS condition (Table 3).

Table 3.

Impact of dietary NPRL inclusion on growth performance parameters in broiler chickens kept under cyclic heat stress.

Item (%) Experimental groups1
SEM P value
HS NPRL100 NPRL250 NPRL400
IBW (g) 41.75 42.00 42.00 41.50 0.277 0.924
FBW (g) 2330.00c 2428.75b 2505.00a 2523.75a 22.045 <0.001
BWG (g) 2288.25c 2386.75b 2463.00a 2482.25a 22.041 <0.001
TFI (g) 4377.50a 4202.50b 4110.00c 4107.50c 28.97 <0.001
FCR (g feed/ g gain) 1.91a 1.76b 1.66c 1.65c 0.027 <0.001
IBW (g) 41.75 42.00 42.00 41.50 0.277 0.924

Abbreviations: IBW, initial body weights; FBW, final body weight; BWG, body weight gain; TFI, total feed intake; FCR, feed conversion rations (g feed/g gain).

a–c

Mean values in rows carrying various letters vary statistically (P < 0.05). SEM: standard error of the mean.

1

Birds kept under cyclic heat stress and fed diets fortified with nano-propolis liposomes (NPRL) at various levels; 0 (HS), 100 (NPRL100), 250 (NPRL250), and 400 (NPRL400) mg/kg diet, respectively.

Blood Hematology

As illustrated in Table 4, the hemoglobin, red blood cells (RBCs, except for the NPRL400 group) and platelets were substantially strengthened in all NPRL-treated groups in opposite to HS group. NPRL250 and NPRL100 had greater RBCs than the other groups (P < 0.01), while NPRL400 had the greatest platelet values. The birds fed diets including 100, 250, or 400 of NPRL had lower values of lymphocytes (P < 0.01), white blood cells (WBCs; P < 0.001), and monocytes (P < 0.05) related to the untreated group. The other variables of hematology were not affected (P > 0.05) by the dietary NPRL inclusion.

Table 4.

Impact of dietary NPRL inclusion on blood hematology parameters in broiler chickens kept under cyclic heat stress.

Item2 Experimental groups1
SEM P value
HS NPRL100 NPRL250 NPRL400
Erythrogram indices
Hemoglobin, mg/dL 9.50b 11.640a 10.98a 10.79a 0.256 0.002
RBCs, 106/μL 3.56b 4.71a 4.36a 3.71b 0.148 0.000
Platelets, 103 34.23c 39.61b 39.67b 42.23a 1.221 0.149
PCV, % 27.47 29.33 28.00 28.66 0.468 0.664
Hematocrit, % 37.17 37.26 37.09 37.25 0.065 0.818
MCV, μm3 90.13 89.78 89.05 89.34 0.442 0.870
MCH, pg 90.13 89.78 89.01 89.34 0.241 0.500
MCHC, g/dL 29.01 30.63 29.45 29.21 0.359 0.587
Leukogram indices
WBCs, 103 /μL 10.48a 8.29b 7.92b 7.86b 0.376 0.009
Lymphocytes, % 86.25a 82.91b 81.28b 80.65b 0.780 0.017
Monocytes, % 1.22a 0.91b 0.933b 0.99b 0.042 0.005
Eosinophils, % 0.38 0.36 0.34 0.41 0.007 0.146
1

Birds kept under cyclic heat stress and fed diets fortified with nano-propolis liposomes (NPRL) at various levels; 0 (HS), 100 (NPRL100), 250 (NPRL250), and 400 (NPRL400) mg/kg diet, respectively.

2

RBCs, Red blood cells; PCV, packed cell volume; WBC, White blood cells, MCV, Mean corpuscular volume; MCH, Mean corpuscular hemoglobin; MCHC, Mean corpuscular hemoglobin concentration.

a–c

Mean values in rows carrying various letters vary statistically (P < 0.05). Each value represents the means of 6 birds per treatment. SEM: standard error of the mean. Data were analyzed by SPSS (Version 21.0; IBM CO., Chicago, IL) using a one-way ANOVA test. Multiple comparisons between means were conducted according to Duncan's multiple-range tests.

Carcass Traits

The effects of dietary fortified with NPRL (0, 100, 250, and 400 mg/kg diet) were clarified in Table 5. According to the data in Table 5, no significant alterations were noticed among all the carcass variables studied (liver, gizzard, dressing, and giblets) in response to NPRL supplementation under cyclic HS conditions (P > 0.05).

Table 5.

Impact of dietary NPRL inclusion on carcass traits in broiler chickens kept under cyclic heat stress.

Item (%)2 Experimental groups1
SEM P value
HS NPRL100 NPRL250 NPRL400
Carcass 77.12 78.00 77.71 77.60 0.149 0.200
Dressing 82.13 82.63 82.47 82.44 0.098 0.373
Liver 2.39 2.34 2.43 2.48 0.026 0.318
gizzard 1.89 1.91 1.90 1.92 0.005 0.433
Heart 0.44 0.46 0.46 0.463 0.004 0.222
Giblet 4.69 4.64 4.64 4.670 0.012 0.517
1

Birds kept under cyclic heat stress and fed diets fortified with nano-propolis liposomes (NPRL) at various levels; 0 (HS), 100 (NPRL100), 250 (NPRL250), and 400 (NPRL400) mg/kg diet. Mean values in rows carrying various letters vary statistically (P < 0.05). Each value represents the means of 5 birds per treatment. SEM: standard error of the mean. Data were analyzed by SPSS (Version 21.0; IBM CO., Chicago, IL) using a one-way ANOVA test. Multiple comparisons between means were conducted according to Duncan's multiple-range tests.

Serum Metabolites

Table 6 illustrates the influence of NPRL on stressed broiler blood metabolites, including creatinine, urea, total bilirubin, and gamma-glutamyl transferase. The lowest values of creatinine were noticed in NPRL250 and NPRL400 (P < 0.001), while there were no significant differences between the HS and NPRL100 treatments (P > 0.05) for blood creatinine and urea. NPRL250 had the lowest values of urea compared with other treatments (P < 0.001). Broiler in the NPRL400 group had the lowest levels of total bilirubin and GGT. Total bilirubin is similar in NPRL100 and NPRL250 (P > 0.05). NPRL-treated groups had lower GGT levels in the broiler's blood (P < 0.001) compared with the control group.

Table 6.

Impact of NPRL on blood metabolites in broiler chickens kept under cyclic heat stress.

Item2 Experimental groups1
SEM P value
HS NPRL100 NPRL250 NPRL400
liver function
Creatinine, mg/dL 1.87a 1.76a 1.42b 1.44b 0.062 <0.001
Urea, mg /dL 82.35a 82.79a 66.20c 80.39b 2.074 <0.001
Kideny function
Total bilirubin, mg/dL 0.96a 0.810b 0.786b 0.603c 0.039 <0.001
GGT2, IU/ L 108.00a 68.33c 87.67b 63.66d 5.319 <0.001
1

Birds kept under cyclic heat stress and fed diets fortified with nano-propolis liposomes (NPRL) at various levels; 0 (HS), 100 (NPRL100), 250 (NPRL250), and 400 (NPRL400) mg/kg diet.

2

Gamma-glutamyl transferase (GGT). Each value represents the means of 6 birds per treatment. Data were analyzed by SPSS (Version 21.0; IBM CO., Chicago, IL) using a one-way ANOVA test. Multiple comparisons between means were conducted according to Duncan's multiple-range tests.

a–d

Mean values in rows carrying various letters vary statistically (P < 0.05). SEM: standard error of the mean.

Immunological and Oxidative-Related Biomarkers

Table 7 clarifies the potential effects of dietary inclusion of NPRL on the immune-antioxidant responses of birds under cyclic HS. The LYZ activity in the broiler was significantly reduced by dietary 250 or 400 of NPRL inclusion (P < 0.001). The greatest values of LYZ were recorded in the HS group, while the NPRL100 groups exhibited intermediate values (P < 0.001). Birds in NPRL250 and NPRL100 had greater IgG (P < 0.05) than the other groups. Meanwhile, the broiler fed with 400 mg of NPRL exhibited the highest levels of IgM. Regarding oxidative-related biomarkers, dietary NPRL inclusion decreased MYO and MDA levels significantly compared to those with the HS group (P < 0.001). Nitric oxide (P < 0.001) was markedly improved dose-dependent. In the antioxidant status, SOD and GSH were significantly enhanced by the dietary NPRL inclusion in a dose-dependent manner (P < 0.001). No differences in serum level of CAT were found among all treated and HS groups (p = 0.79).

Table 7.

Impact of dietary NPRL inclusion on oxidative related biomarkers and adaptive immunity in broiler chickens kept under cyclic heat stress.

Item2 Experimental groups1
SEM P value
HS NPRL100 NPRL250 NPRL400
Immune function
LYZ, µg/mL 230.00a 174.66b 160.33c 160.33c 8.80 <0.0001
IgG, ng/mL 19.00c 39.00a 40.667a 35.00b 2.609 <0.0001
IgM, ng/mL 13.33c 31.66b 30.00b 44.66a 3.41 <0.0001
Oxidative stress
MYO, nmol/mL 23.33a 13.00b 12.66b 13.00b 1.416 <0.0001
NO, nmol/mL 1.73d 2.087b 1.99c 2.38a 0.071 <0.0001
MDA, nmol/mL 2.99a 2.60b 2.56b 2.43b 0.067 0.001
Antioxidant biomarkers
SOD, mM/L 3.43b 3.627b 3.65b 6.40a 0.372 <0.001
GSH, mM/L 1.46c 1.37bc 1.82b 5.50a 0.520 <0.0001
CAT, mM/L 2.44 2.47 2.49 2.397 0.031 0.794
1

Birds kept under cyclic heat stress and fed diets fortified with nano-propolis liposomes (NPRL) at various levels; 0 (HS), 100 (NPRL100), 250 (NPRL250), and 400 (NPRL400) mg/kg diet.

2

immunoglobulins IgM and IgG; MYO, myeloperoxidase, LYZ, lysosome activity, NO, nitric oxide, MDA, malondialdehyde; SOD superoxide dismutase; GSH, glutathione; CAT, catalase.

a–d

Mean values in rows carrying various letters vary statistically (P < 0.05). Each value represents the means of 6 birds per treatment. Data were analyzed by SPSS (Version 21.0; IBM CO., Chicago, IL) using a one-way ANOVA test. Multiple comparisons between means were conducted according to Duncan's multiple-range tests. SEM: standard error of the mean.

Microbiota Counts

Experimental diets significantly affect the intestinal microbial community (except yeats) in broiler chickens kept under cyclic HS (Figure 2). NPRL-treated groups significantly reduced the counts of Salmonella spp. (Figure 2B) and E. coli (Figure 2E) in the broilers compared with those in the HS group (P < 0.001). The highest counts of lactic acid-producing bacteria (Figure 2D) were observed in the NPRL250 and NPRL100 groups (P < 0.001). The TBC (Figure 2A) was significantly improved in all NPRL-treated groups, with the best results in the NPRL400 group. The counts of Enterococci (Figure 2C) in the broiler were significantly decreased by adding 250 or 400 mg of NPRL/kg. Dietary fortification with NPRL significantly decreased the pathogenic bacteria (Salmonella, E. coli, and Enterococci). NPRL significantly improved broilers' total bacteria counts and lactic acid-producing bacteria under cyclic HS. There was also no significant effect of the NPRL on yeast counts in the cecal microbiota of broilers, as presented in Figure 2F.

Figure 2.

Figure 2

(A–F). Impact of dietary NPRL inclusion on quantification of intestinal microbiota including total bacteria (A), salmonella spp (B), Enterococci (C), lactic acid (D), E. coli (E), and yeast (F) counts in interianl of broiler chickens. Birds kept under cyclic heat stress and fed diets fortified with nano-propolis liposomes (NPRL) at various levels; 0 (HS), 100 (NPRL100), 200 (NPRL200), and 400 (NPRL400) mg/kg diet. a–c Mean values in rows carrying various letters vary statistically (P < 0.05). Each value represents the means of 6 birds per treatment. SEM: standard error of the mean. Ony way ANOVA was used in this analysis. Figures were fitted using the GraphPad Prism software 9.0 (GraphPad).

Transcriptomic Modulation

Figure 3 clarifies the birds fed diets with NPRL (250 mg/kg diet) significantly downregulated the IFNγ gene (Figure 3B; P < 0.001), while both groups (NPRL100 and NPRL400) had similar results (P > 0.05). The inclusion of dietary NPRL significantly downregulated the expression of the iNOS gene (Figure 3A). All treated birds had lower expression of the IL-4 (Figure 3C) and TNF-α (Figure 3D) genes than the untreated group (P < 0.001). Moreover, NPRL100 exhibited the highest expression of TNF-α compared to other groups (P < 0.001).

Figure 3.

Figure 3

Transcriptional levels of genes encoding inflammation including iNOS (A), IFNγ (B), IL4 (C), TNFα (D) and NFκB (E) in hepatic tissues of broiler chickens exposed to cyclic heat stress and fed diets fortified with NPRL at various levels; 0 (HS), 100 (NPRL100), 250 (NPRL250), and 400 (NPRL 400) mg/kg diet. Each value represents the means of 6 birds per treatment. Results are expressed as means ± standard error of the mean (SEM, error bars). a-c mean values above column carrying various letters vary statistically (P < 0.05). Ony way ANOVA was used in this analysis. Figures were fitted using the GraphPad Prism software 9.0 (GraphPad).

Both the NPRL400 and NPRL250 groups significantly decreased the mRNA of NFκB (Figure 3E) compared to the NPRL100 and HS groups (P < 0.001). Overall, NPRL significantly decreased the expression of all the inflammatory genes.

Histological Examinations

As shown in Figure 4, cyclic HS induced overcrowded central veins with a noticeable degree of liver necrosis and accompanied by mononuclear inflammatory cells (Figure 4A). Likewise, the HS group revealed sinusoidal dilatations, degeneration of hepatocytes with bulky cytoplasmic vacuoles, blood infiltration and interstitial edema with Kupffer cells (Figure 4A). Broiler chicken-fed diets fortified with 100 mg of NPRL/kg diet (Figure 4B) displayed a moderate enhancement in their hepatic architectures. At the same time, other treated groups, NPRL250 (Figure 4C) and NPRL400 (Figure 4D), exhibited normal hepatic parenchyma hepato-portal structures and normal sinusoids. Broilers fed a control diet and exposed to HS (Figure 5A) exhibited necrosis of crypt cells and immature villous cells (CD, red arrows), moderate damage to villus height (VH, black arrows), and damage to epithelial cells. Figure 5B showed moderate alterations in intestinal morphometrics, with a few necrotic crypt cells noticed. Furthermore, birds exposed to cyclic HS and fed with 250 (Figure 5C) or 400 (Figure 5D) mg of NPRL/kg exhibited mostly normal histological appearances of CD (red arrows) and VH (black arrows), maintained intestinal permeability, and had healthy epithelial cells.

Figure 4.

Figure 4

(A–D). Impact of dietary NPRL inclusion on hepatic tissues of stressed broiler chickens. Birds were kept under cyclic heat stress and fed diets fortified with NPRL at various levels; 0 (HS; Figure A), 100 (NPRL100; Figure B), 250 (NPRL250; Figure C), and 400 (NPRL400; Figure D) mg/kg diet. Scale bar = 20 μm, and n = 3. The hepatic tissue of the stressed birds (Fig. 4A) exhibited dilated and congested central veins, with a marked degree of hepatic necrosis and associated mononuclear inflammatory cell infiltration (black arrow). Birds fed with 100 mg of NPRL show a moderate improvement in their hepatic architectures (Figure 4B). The hepatic sections of the birds in the groups (NPRL250; Figure C and NPRL400; Figure D) showed normal hepato-portal structures, comprising the central vein and parenchymal cells, reducing the inflammatory cells induced by HS (Figure 4A).

Figure 5.

Figure 5

(A–D). Impact of dietary NPRL inclusion on intestinal tissues of stressed broiler chickens. Birds were kept under cyclic heat stress and fed diets fortified with NPRL at various levels; 0 (HS; Figure A), 100 (NPRL100; Figure B), 250 (NPRL250; Figure C), and 400 (NPRL400; Figure D) mg/kg diet. Scale bar =100 μm, and n = 3. Broiler fed control diet and exposed to HS (Figure 5A) exhibited necrosis of crypt cells and immature villous cells (CD, red arrows) and moderate damages of villus height (VH, black arrows). Figure 5B exhibited the moderate alterations of intestinal morphometric with few necrosis of crypt cells were noticed. The treated groups (NPRL250; Figure C) and (NPRL400; Figure D) mostly a normal histological appearance of CD (red arrows) and VH (black arrows).

DISCUSSION

Broiler chickens serve as an exceptional source of animal-derived protein for human intake. Nevertheless, climate change harms broilers' health and growth, leading to significant economic losses in the broiler business. Consequently, it is essential to relieve HS in broilers by applying sustainable approaches. Existing research has found that cyclic HS diminishes the FBW, ADG, and TFI, while increasing the FCR in broilers. Nevertheless, fortifying diets with NPRL can increase the ADG, FBW, and TFI, and improve FCR.

Additionally, this study reveals that the dietary inclusion of NPRL enhanced the blood hematology redox scheme, modulated the microbiota, and reduced the inflammation/oxidative stress pathways of stressed broilers. This affirmative consequence of the research proposes that nanotechnology could be considered a favorable food supplement for broilers to fight the harmful effects of cyclic HS. Similar to our results, adding propolis (up to 250 mg/kg) to the broiler diets substantially boosted body weights and feed intake (Açıkgöz et al., 2005; Shalmany and Shivazad, 2006). Moreover, Attia et al. (2014) clarified that the dietary inclusion of propolis (300 mg/kg diet) improved FBW and FCR compared with control. PRO can reduce the negative effects of HS, as reported by Mahmoud et al. (2015), who found that PRO (250 or 300 mg/kg diet) can be used as a safe feed additive for enhancing heat resistance by improving walking activities of bird and reducing panting behaviors. Moreover, adding ethanol extracts of PRO (0.5-3 g) to the broiler diets exposed to HS (41°C) improved the BW and feed utilization (Prakatur et al., 2019). PRO can stimulate digestive enzymes, improving nutrient digestibility and enhancing TFI and growth indices in broiler chickens.

Shaddel et al. (2017) stated that PRO (2 g/kg diet) enhanced broiler chickens' growth indices and feed efficiency. PRO treatments (1 g/kg diet) markedly augmented broilers' FBWG, FBW, and TFI (AL-Kahtani et al. 2022). The enhancement of FBW demonstrated in the existing research can reflect the potential efficacy of PRO as an effective growth promoter in broilers as well as in other poultry species (Attia et al., 2014; Refaat et al., 2021; AL-Kahtani et al., 2022). Overall, feed efficiency (high feed intake and lower FCR) was also enhanced in broilers fed PRO (Shalmany and Shivazad, 2006; Shaddel et al., 2017; AL-Kahtani et al., 2022). Nano-emulsion of EO (blended of clove, cinnamon, and oregano; 400 mg/kg diet) have been confirmed to enhance the growth performance in broilers (Meligy et al., 2023). In the same trend, it has been indicated that resveratrol-loaded liposomal nanocarriers (up to 150 mg/kg) improved the growth rate in stressed broilers (Kishawy et al., 2023). This improvement of this factor was also detected in various reports using raw propolis, which has been accredited to the enhancement of food flavor by benzoic acids and propolis flavonoids, which in turn boost the digestibility of proteins. Noteworthy enhanced nutrient digestibility in broiler chickens following essential oil fortifications in their diets could be ascribed to their functions in heightening the excretion and actions of digestive enzymes.

Another explanation has been established by (Kishawy et al., 2023; Meligy et al., 2023), who clarified that nano-emulsion improved nutrient digestibility in broiler chickens, significantly enhancing growth and health status. Moreover, Kishawy et al. 2023 itemized that NPRL could be a critical function as a growth enhancer to alleviate HS's negative significance on broiler chickens' growth. Previous research indicated that birds that received nano-emulsion of EO (400 mg/kg) had greater growth performance and feed competency. The significantly greater growth rate of broiler chickens' subsequent dietary management of NPRL, unlike free PRO in previous experiments, can be associated with PRO combination into an excellent nano-candidate (Aytekin et al., 2020; Kasote et al., 2022)that improved its functions of hunting damaging OS and lipid peroxidation resulting from prompted by HS conditions (Seven et al., 2008). This finding in our research supports the idea that NPRL therapy may be reflected as a defensive management strategy in broiler chickens to mitigate the undesirable effects of HS.

Moreover, hemoglobin and RBCs were significantly boosted in the blood of broiler-fed diets with 300 mg of PRO. Similar to our finding, it was indicated that propolis (2 g/kg diet) augmented the PCV and heterophil counts in the broiler serum (Attia et al., 2014). Adding PRO (100 mg /100 g diet) to broiler diets meaningfully diminished the H/L ratio and augmented leukocyte cell viability . Recently, Khalati and Al-Salhie (2023) clarified that adding NPRL (100 and 150 μl per liter of drinking water) significantly enhanced some blood variables that, including hemoglobin, RBC, and PCV in broilers.

Similar to our data, Khalati and Al-Salhie (2023) found that the relative weight of the spleen, heart, gizzard, liver, and bursa gland was not affected by the addition of nano-propolis (50, 100, and 150 µl/L drinking water). In contrast with our data, Attia et al. (2014) found that PRO (300 mg/kg diet) substantially increased the addressing percentage in the broiler. Shaddel et al. (2017) reported that PRO powder added to diets augmented the relative weight of crop, length, and thighs of gizzard and reduced the comparative weight of hepatic broiler chickens. Broiler chicken-fed diets with PRO had lower values of serum urea and, creatinine and liver enzymes (aspartate aminotransferase) compared with untreated ones (Shaddel et al., 2017)

Prolonged and unmanageable HS can disturb the stability between antioxidant protection and oxidative stress mechanisms by depleting the levels of enzymatic antioxidants and increasing OS. A substantial increase in SOD, TAC, and CAT enzyme levels was observed in broilers treated with PRO. It has been acknowledged that excessive ROS generated due to HS can lead to oxidative harm, including lipid peroxidation and oxidative damage to DNA and proteins (Azad et al., 2010). Moreover, HS has been shown to diminish nutrient digestibility, possibly due to the abundance of ROS synthesized that oxidizes and injures the hepatic and intestinal tissues. HS can lead to changes in cellular oxidative status, resulting in an increased level of ROS due to reduced production of defensive enzymes such as GSH-Px, TAC, SOD, and along with excessive production of MDA (Zhang et al., 2006). ROS can initiate cholesterol peroxidation, reducing membrane fluidity and receptor function, thus impairing membrane function (Arulselvan and Subramanian, 2007). There was a dose-dependent boost in TAC and antioxidant actions and a significant downregulation of the transcript of inflammatory-related genes in hepatic tissues in all bird groups fed with various levels of NPRL.

HS can decrease the growth of broiler chickens due to its ability to induce oxidative inequality, metabolic syndromes, and immune inhibition. Immune dysfunction makes the birds more sensitive to diseases. Thus, supporting the birds with immunomodulatory agents during HS may improve their health status and welfare and help them resist HS. AL-Kahtani et al. (2022) clarified that a substantial rise in the IgM, IgA, and IgG levels was gained in the broilers treated with PRO (1g/kg diet). The PRO management considerably augmented the points of IgM and IgA in stressed broilers. Three-day supplementation of 300 or 600 µg/mL consistently relieved the higher expression of COX-2, TNF-α, and iNOS mRNA in the spleen (Hsiao et al., 2022). HS can meaningfully increase the IL-10 and IL-4 expression levels for anti-inflammatory cytokines, while co-treated with PRO decreases this elevation (Hsiao et al., 2022).

The results indicate that incorporating PRO and bee pollen into the broiler chickens' diet positively impacts the morpho-physiology of their intestines (Prakatur et al., 2019). The same previous study aligns with our data, suggesting that PRO can improve intestinal health by increasing the villus height/crypt depth ratio and sustaining intestinal permeability and epithelial cells. Studies have revealed that HS can impair broiler intestinal health and epithelial integrity (Meligy et al., 2023; Won et al., 2023). Adding some nanoparticles such as liposomal encapsulated blend essential oils (Meligy et al., 2023) improved the intestinal structure of broiler chickens subjected to HS circumstances, probably by its immunomodulatory and antioxidant effects of NPRL. Moreover, (Shaddel et al., 2017; AL-Kahtani et al., 2022) found that PRO can improve morphological and bacterial homeostasis in the gastrointestinal region. Dietary inclusion of NPRL significantly augmented VH. Remarkably, goblet cell numbers were augmented in this trial's NPRL management under HS conditions. The probable motive may be that NPRL is connected with mucin synthesis in the goblet cells and an additional supply of PRO in the nano-form may stimulate mucin synthesis, thus improving the number of goblet cells (de Melo Garcia et al., 2022). PRO is reported as a natural supplement that is more noteworthy in offering greater absorbent areas of the intestine cavity, thus increasing the viability of nutrients and metabolism (Yen et al., 2017) and finally improving body weight. The hopeful and encouraging results from this experiment highlight the significance of conducting further evaluations on the dosage levels of the investigated supplements. Such assessments aim to maximize their valuable properties on the gut homeostasis of chickens and, by extension, enhance the typical health of broiler chickens.

HS can imbalance the gut microbial population in the intestinal cavity of broiler. However, the NPRL treatments in this consideration helped to restore the balance of the intestinal microbiota, which could have contributed to the bettered performance and health of the broilers. HS can affect microbiota broilers, leading to an imbalance in the gut microbial community. However, the NPRL treatments in this study helped to restore the balance of the intestinal microbiota, which could have contributed to the improved performance and health of the broilers by reducing the Salmonella spp., Enterococci, and E. coli. Some previous papers suggested that HS can induce microbiota dysbiosis (Shi et al., 2019; Ringseis et al., 2022). Similar to our data, HS increased the prevalence of E. coli, C. perfringens, and Coliforms, decreasing the loads of Bifidobacterium and Lactobacillus (Awad et al., 2019). Microbiota dysbiosis is induced by increasing the toxic bacteria at the expense of favorable ones (Awad et al., 2020). Such inequality leads to nutrients malabsorption, barrier dysfunction, and local infection. It has been reported that PRO (1.5 g/kg diet) can enhance the accounts of beneficial bacteria such as lactic acid and reduce the pathogenic bacteria C. perfringens (Elsherif et al., 2021) in broiler, as observed in this research. This possibly illustrates the potential antimicrobial action of NPRL. Dietary PRO may maintain microbiota homeostasis by controlling proteins complicated by inflammation and intestinal permeability in broilers (Kasote et al., 2022). However, this experiment reveals the beneficial effect of NPRL on intestinal permeability. To our knowledge, no previous experiments have been shown to verify the consequences of NPRL dietary fortification on intestinal microbiota in broilers kept under HS environments. The present investigation focused on the influence of dietary NPRL on growth, immune and inflammatory responses, and intestinal microbiota in broilers, especially under HS environments. It would be advantageous to compare and assess the effects of the dietary groups used in this trial with those observed under normal conditions, a comparison that was not performed in the present study. Therefore, further examination is required to compare the potential effects of dietary NPRL in broiler chickens under normal and HS environments.

CONCLUSIONS

Liposomes have been demonstrated to be an effective nanocarrier for delivering propolis, enhancing its bioactivity and stability. NPRL protects it from environmental conditions and the gut until it reaches target tissues, boosting its mode of action. This is supported by improving growth in broiler chickens fed NPRL despite exposure to heat stress, as NPRL reduces oxidative damage, sustains intestinal health, and improves the antioxidant capacity. Molecular studies further demonstrate NPRL's potential to modulate inflammatory gene expression. These studies have proven, for the first time, that NPRL can efficiently mitigate the effects of heat stress in broiler chickens.

Acknowledgments

ACKNOWLEDGMENTS

This work was funded by the Deanship of Scientific Research at the University of Tabuk through research group number S-1443-0073.

DISCLOSURES

There is no conflict of interest to declare.

REFERENCES

  1. Abdelnour S.A., Hassan M.A., Shehabeldin A.M., Omar M.E., Khalil W.A., Aman R.M. Effects of propolis-loaded nanoliposomes fortification in extender on buffalo semen cryopreservation. Sci. Rep. 2023;13:10621. doi: 10.1038/s41598-023-37424-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Açıkgöz Z., Yücel B., Altan Ö. The effects of propolis supplementation on broiler performance and feed digestibility. Arch. Geflügelk. 2005;69:117–122. [Google Scholar]
  3. Addeen A., Benjakul S., Wattanachant S., Maqsood S. Effect of Islamic slaughtering on chemical compositions and post-mortem quality changes of broiler chicken meat. Int. Food Res. J. 2014;21:897–907. [Google Scholar]
  4. AL-Kahtani S.N., Alaqil A.A., Abbas A.O. Modulation of antioxidant defense, immune response, and growth performance by inclusion of propolis and bee pollen into broiler diets. Animals. 2022;12:1658. doi: 10.3390/ani12131658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Al-Mufarrej S., Al-Baadani H., Fazea E. Effect of level of inclusion of clove (Syzygium aromaticum) powder in the diet on growth and histological changes in the intestines and livers of broiler chickens. S. Afr. J. Anim. Sci. 2019;49:166–175. [Google Scholar]
  6. Arulselvan P., Subramanian S.P. Beneficial effects of Murraya koenigii leaves on antioxidant defense system and ultra structural changes of pancreatic β-cells in experimental diabetes in rats. Chem.-Biol. Interact. 2007;165:155–164. doi: 10.1016/j.cbi.2006.10.014. [DOI] [PubMed] [Google Scholar]
  7. Attia Y.A., Al-Hamid A.E.A., Ibrahim M.S., Al-Harthi M.A., Bovera F., Elnaggar A.S. Productive performance, biochemical and hematological traits of broiler chickens supplemented with propolis, bee pollen, and mannan oligosaccharides continuously or intermittently. Livest. Sci. 2014;164:87–95. [Google Scholar]
  8. Awad E.A., Najaa M., Zulaikha Z.A., Zulkifli I., Soleimani A.F. Effects of heat stress on growth performance, selected physiological and immunological parameters, caecal microflora, and meat quality in two broiler strains. Asian-Aus. J. Anim. Sci. 2020;33:778–787. doi: 10.5713/ajas.19.0208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Awad E.A., null n., Zulkifli I., null n., Soleimani A.F., null n., Law F.L., null n., Ramiah S.K., null n., Mohamed-Yousif I.M., null n., Hussein E.A., null n., Khalil E.S., null n. Response of broilers to reduced-protein diets under heat stress conditions. World's Poult. Sci. J. 2019;75:583–598. [Google Scholar]
  10. Aytekin A.A., Tuncay Tanrıverdi S., Aydın Köse F., Kart D., Eroğlu İ., Özer Ö. Propolis loaded liposomes: evaluation of antimicrobial and antioxidant activities. J. Liposome Res. 2020;30:107–116. doi: 10.1080/08982104.2019.1599012. [DOI] [PubMed] [Google Scholar]
  11. Azad M., Kikusato M., Maekawa T., Shirakawa H., Toyomizu M. Metabolic characteristics and oxidative damage to skeletal muscle in broiler chickens exposed to chronic heat stress. Comparative Biochem. Physiol. Part A. 2010;155:401–406. doi: 10.1016/j.cbpa.2009.12.011. [DOI] [PubMed] [Google Scholar]
  12. Corzo A., Dozier Iii W., Kidd M. Valine nutrient recommendations for Ross× Ross 308 broilers. Poult. Sci. 2008;87:335–338. doi: 10.3382/ps.2007-00307. [DOI] [PubMed] [Google Scholar]
  13. da Silva V.P., van der Werf H.M., Soares S.R., Corson M.S. Environmental impacts of French and Brazilian broiler chicken production scenarios: An LCA approach. J. Environ. Manag. 2014;133:222–231. doi: 10.1016/j.jenvman.2013.12.011. [DOI] [PubMed] [Google Scholar]
  14. de Melo Garcia P.H., Guerra R.R., de Oliveira J.S., de Lima Júnior D.M., de Almeida V.V.S., da Silva E.G., Ribeiro N.L. 2022. Red propolis extract in the diet of confined sheep: morphometric alterations of the digestive system. [DOI] [Google Scholar]
  15. Elsherif H., Orabi A., Ali A., Samy A. Castor and propolis extracts as antibiotic alternatives to enhance broiler performance, intestinal microbiota and humoral immunity. Adv. Anim. Vet. Sci. 2021;9:734–742. [Google Scholar]
  16. Hsiao F.S.-H., Artdita C.A., Hua K.-F., Tsai C.-J., Chien Y.-H., Chen Y.-W., Cheng Y.-H., Yu Y.-H. Optimization of emulsification conditions on ethanol extract of taiwanese green propolis using polysorbate and its immunomodulatory effects in broilers. Animals. 2022;12:446. doi: 10.3390/ani12040446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kasote D., Bankova V., Viljoen A.M. Propolis: chemical diversity and challenges in quality control. Phytochem. Rev. 2022;21:1887–1911. doi: 10.1007/s11101-022-09816-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Khalati R.H., Al-Salhie K.C. Hematological parameters and relative weight of some organs for broiler chickens supplemented by different levels of nano propolis. Texas J. Agric. Biol. Sci. 2023;13:115–121. [Google Scholar]
  19. Kishawy A.T.Y., Ibrahim D., Roushdy E.M., Moustafa A., Eldemery F., Hussein E.M., Hassan F.A.M., Elazab S.T., Elabbasy M.T., Kanwal R., Kamel W.M., Atteya M.R., Zaglool A.W. Impact of resveratrol-loaded liposomal nanocarriers on heat-stressed broiler chickens: Effects on performance, sirtuin expression, oxidative stress regulators, and muscle building factors. Front. Vet. Sci. 2023;10 doi: 10.3389/fvets.2023.1137896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kpomasse C.C., Oke O.E., Houndonougbo F.M., Tona K. Broiler production challenges in the tropics: a review. Vet. Med. Sci. 2021;7:831–842. doi: 10.1002/vms3.435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Liu D., Guo Y., Wang Z., Yuan J. Exogenous lysozyme influences Clostridium perfringens colonization and intestinal barrier function in broiler chickens. Avian Pathol. 2010;39:17–24. doi: 10.1080/03079450903447404. [DOI] [PubMed] [Google Scholar]
  22. Liu W.-C., Huang M.-Y., Balasubramanian B., Jha R. Heat stress affects jejunal immunity of Yellow-Feathered broilers and is potentially mediated by the microbiome. Front. Physiol. 2022;13:1022. doi: 10.3389/fphys.2022.913696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  24. Lu P., Xue W., Zhang X., Wu D., Ding L., Wen C., Zhou Y. Heat-induced protein oxidation of soybean meal impairs growth performance and antioxidant status of broilers. Poult. Science. 2019;98:276–286. doi: 10.3382/ps/pey344. [DOI] [PubMed] [Google Scholar]
  25. Mahmoud U.T., Abdel-Rahman M.A.M., Darwish M.H.A., Applegate T.J., Cheng H.-w. Behavioral changes and feathering score in heat stressed broiler chickens fed diets containing different levels of propolis. Appl. Anim. Behav. Sci. 2015;166:98–105. [Google Scholar]
  26. Marklund S., Marklund G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 1974;47:469–474. doi: 10.1111/j.1432-1033.1974.tb03714.x. [DOI] [PubMed] [Google Scholar]
  27. Meligy A.M.A., El-Hamid M.I.A., Yonis A.E., Elhaddad G.Y., Abdel-Raheem S.M., El-Ghareeb W.R., Mohamed M.H.A., Ismail H., Ibrahim D. Liposomal encapsulated oregano, cinnamon, and clove oils enhanced the performance, bacterial metabolites antioxidant potential, and intestinal microbiota of broiler chickens. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Mutalik S., Salian S.R., Avadhani K., Menon J., Joshi H., Hegde A.R., Kumar P., Kalthur G., Adiga S.K. Liposome encapsulated soy lecithin and cholesterol can efficiently replace chicken egg yolk in human semen cryopreservation medium. Syst. Biol. Reprod. Med. 2014;60:183–188. doi: 10.3109/19396368.2014.902521. [DOI] [PubMed] [Google Scholar]
  29. Part C.E., Edwards P., Hajat S., Collins L.M. Prevalence rates of health and welfare conditions in broiler chickens change with weather in a temperate climate. Royal Soc. Open Sci. 2016;3 doi: 10.1098/rsos.160197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Prakatur I., Miskulin M., Pavic M., Marjanovic K., Blazicevic V., Miskulin I., Domacinovic M. Intestinal morphology in broiler chickens supplemented with propolis and bee pollen. Animals. 2019;9:301. doi: 10.3390/ani9060301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Puvača N., Tufarelli V., Giannenas I. Essential oils in broiler chicken production, immunity and meat quality: review of Thymus vulgaris, Origanum vulgare, and Rosmarinus officinalis. Agriculture. 2022;12:874. [Google Scholar]
  32. Rafeeq M., Bilal R.M., Batool F., Yameen K., Farag M.R., Madkour M., Elnesr S.S., El-Shall N.A., Dhama K., Alagawany M. Application of herbs and their derivatives in broiler chickens: a review. World's Poult. Sci. J. 2023;79:95–117. [Google Scholar]
  33. Refaat H., Mady F.M., Sarhan H.A., Rateb H.S., Alaaeldin E. Optimization and evaluation of propolis liposomes as a promising therapeutic approach for COVID-19. Int. J. Pharmac. 2021;592 doi: 10.1016/j.ijpharm.2020.120028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Richard M.J., Portal B., Meo J., Coudray C., Hadjian A., Favier A. Malondialdehyde kit evaluated for determining plasma and lipoprotein fractions that react with thiobarbituric acid. Clin. Chem. 1992;38:704–709. [PubMed] [Google Scholar]
  35. Ringseis R., Eder K. Heat stress in pigs and broilers: role of gut dysbiosis in the impairment of the gut-liver axis and restoration of these effects by probiotics, prebiotics and synbiotics. J. Anim. Sci. Biotechnol. 2022;13:1–16. doi: 10.1186/s40104-022-00783-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Seven P.T., Seven I., Yılmaz M., Şimşek Ü. The effects of Turkish propolis on growth and carcass characteristics in broilers under heat stress. Anim. Feed Sci. Technol. 2008;146:137–148. [Google Scholar]
  37. Shaddel-Tili A., Eshratkhah B., Kouzehgari H., Ghasemi-Sadabadi M. The effect of different levels of propolis in diets on performance, gastrointestinal morphology and some blood parameters in broiler chickens. Bulg. J. Vet. Med. 2017;20:215–224. [Google Scholar]
  38. Shalmany S.K., Shivazad M. The effect of diet propolis supplementation on Ross broiler chicks performance. Int. J. Poult. Sci. 2006;5:84–88. [Google Scholar]
  39. Sheikholeslami B., Lam N.W., Dua K., Haghi M. Exploring the impact of physicochemical properties of liposomal formulations on their in vivo fate. Life Sci. 2022;300 doi: 10.1016/j.lfs.2022.120574. [DOI] [PubMed] [Google Scholar]
  40. Shi D., Bai L., Qu Q., Zhou S., Yang M., Guo S., Li Q., Liu C. Impact of gut microbiota structure in heat-stressed broilers. Poult. Sci. 2019;98:2405–2413. doi: 10.3382/ps/pez026. [DOI] [PubMed] [Google Scholar]
  41. Tarek K., Mohamed M., Omar B., Hassina B., Messaouda I. Histological changes in liver and pectoral muscles of broiler chickens slaughtered with and without naming of Allah. Int. J. Poult. Sci. 2013;12:550–552. [Google Scholar]
  42. Tuohy K.M., Ziemer C.J., Klinder A., Knöbel Y., Pool-Zobel B.L., Gibson G.R. A human volunteer study to determine the prebiotic effects of lactulose powder on human colonic microbiota. Microb. Ecol. Health Dis. 2002;14:165–173. [Google Scholar]
  43. Won S.Y., Han G.P., Kwon C.H., Lee E.C., Kil D.Y. Effect of individual or combination of dietary betaine and glycine on productive performance, stress response, liver health, and intestinal barrier function in broiler chickens raised under heat stress conditions. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Yen C.-H., Chiu H.-F., Wu C.-H., Lu Y.-Y., Han Y.-C., Shen Y.-C., Venkatakrishnan K., Wang C.-K. Beneficial efficacy of various propolis extracts and their digestive products by in vitro simulated gastrointestinal digestion. Lwt. 2017;84:281–289. [Google Scholar]
  45. Zhang H., Guo Y., Yuan J. Effects of conjugated linoleic acids on growth performance, serum lysozyme activity, lymphocyte proliferation,and antibody production in broiler chicks. Arch. Anim. Nutr. 2005;59:293–301. doi: 10.1080/17450390500247808. [DOI] [PubMed] [Google Scholar]
  46. Zhang L., Wang L., Shi Z., Wei X., Chen J., Zhao R. Expression of SGLT1 mRNA in duodenum, jejunum and ileum of weaning pigs and the effect of cysteamine on it. J. Agric. Biotechnol. 2006;14:850–854. [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES