Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2025 May 1.
Published in final edited form as: J Pain. 2023 Nov 24;25(5):104433. doi: 10.1016/j.jpain.2023.11.016

Myeloid Cell Association with Spinal Cord Injury-Induced Neuropathic Pain and Depressive-like Behaviors in LysM-eGFP Mice

Jonathan H Richards 1, Daniel D Freeman 1, Megan Ryan Detloff 1,*
PMCID: PMC11058038  NIHMSID: NIHMS1947194  PMID: 38007034

Abstract

Spinal cord injury (SCI) affects ~500,000 people worldwide annually, with the majority developing chronic neuropathic pain. Following SCI, approximately 60% of these individuals are diagnosed with comorbid mood disorders, while only ~21% of the general population will experience a mood disorder in their lifetime. We hypothesize that nociceptive and depressive-like dysregulation occurs after SCI and is associated with aberrant macrophage infiltration in segmental pain centers. We completed moderate unilateral C5 spinal cord contusion on LysM-eGFP reporter mice to visualize infiltrating macrophages. At 6-weeks post-SCI, mice exhibit nociceptive and depressive-like dysfunction compared to naïve and sham groups. There were no differences between sexes, indicating that sex is not a contributing factor driving nociceptive or depressive-like behaviors after SCI. Utilizing hierarchical cluster analysis, we classified mice based on endpoint nociceptive and depressive-like behavior scores. Approximately 59.3% of SCI mice clustered based on increased paw withdrawal threshold to mechanical stimuli and immobility time in the forced swim test. SCI mice displayed increased myeloid cell presence in the lesion epicenter, ipsilateral C7–8 dorsal horn and C7–8 DRGs as evidenced by eGFP, CD68, and Iba1 immunostaining when compared to naïve and sham mice. This was further confirmed by SCI-induced alterations in the expression of genes indicative of myeloid cell activation states and their associated secretome in the dorsal horn and DRGs. In conclusion, moderate unilateral cervical SCI caused the development of pain-related and depressive-like behaviors in a subset of mice and these behavioral changes are consistent with immune system activation in the segmental pain pathway.

Keywords: Spinal Cord Injury, Macrophages, Neuroinflammation, Pain, Depression

Introduction

Spinal cord injury (SCI) annually affects ~500,000 people worldwide, with the overwhelming majority developing chronic neuropathic pain11, 60, 114, 125. Chronic pain is associated with allodynia, pain resulting from a normally innocuous stimulus, and hyperalgesia, when sensitivity to a known noxious stimulus is increased19, 91. The pain experience integrates these sensory discriminative attributes with mood and cognitive related characteristics, reinforcing the broad experiences that encompass chronic pain88, 93, 105. Following SCI, approximately 60% of individuals are diagnosed with chronic pain also exhibit comorbid mood disorders, like major depressive disorder and generalized anxiety disorder, while only ~21% of the uninjured population will experience a mood disorder at some point in their lives24, 33, 42, 109, 112. Clinically, over half of individuals with diagnosed depression report nociceptive problems and up to 85% of individuals with chronic pain report symptoms of depression24, 33, 112, 125.

Many studies have focused on mechanisms of the sensory discriminative aspects of neuropathic pain post-SCI. Here, we begin to disentangle the complex interactions between the affective and sensory discriminative aspects of pain. While it is important to recognize that mice may not have similar emotional capacities compared to humans, multiple studies have shown that depressive-like behaviors related to evolutionarily conserved compulsions can be observed following SCI74, 75, 127, 134, 135 and these behaviors were associated with cortical immune cell presence and activation and SCI severity134, 135.

Myeloid cells like macrophages and microglia can be neuroprotective, preventing tissue damage, engulf cellular debris, initiate defense mechanisms, alter the inflammatory environment, and promote repair of damaged neural circuits18, 45, 56, 95, 106. It is well established that macrophage infiltration50, 101103 and microglial activation71, 87, 102, 141 occurs following SCI at the lesion epicenter. Additionally, macrophage infiltration and microglial activation has been identified in remote sites, such as below the lesion19, 52, 101, 102, in the periphery5, 19, 29, 31, 46, 58, 86 and even the cortex141, 144 following neuronal injuries or inflammatory perturbations. These immune cells become activated below the level of injury as early as 3–5 days post-SCI19, 103 and persist for weeks to months after injury19, 103. This could be a useful model for studying chronic pain and depression, since both diseases are also associated with likely immune system activation at multiple levels of the pain pathway4, 28, 91, 120, 146.

Thus, it is possible that pain-related behaviors and comorbid depressive-like behaviors that occur following SCI8, 51 could be a result of inappropriate spatial and temporal distribution of infiltrating macrophages and activation of myeloid cells1, 5, 64, 65, 131, 132, 142. To test this hypothesis, we used a unilateral cervical spinal cord contusion model in mice with an eGFP reporter on bone marrow derived myeloid cells, evaluated both pain and depression over time, and examining potential myeloid cell infiltration and activation state within the spinal cord and dorsal root ganglia (DRG) by immunocytochemistry and gene expression analyses. We rigorously assessed the contributions of behavioral and molecular readouts by utilizing a multivariate statistical approach. Our results indicate that pain-related and depressive-like behaviors develop post-SCI and these behavioral changes can be correlated with macrophage infiltration and microglial activation in the LysM-eGFP reporter mouse and a contusive model of SCI.

Methods

Subjects

LysM-eGFP+/− mice were purchased from cryopreserve at the Mutant Mouse Research Resource Center at the National Institutes of Health (CATALOG # 012039-MU [B6.129(Cg)-Lyz2tm1.1Graf/Mmmh]). This reporter mouse line has myeloid cells transgenically labeled with green fluorescent protein for easy identification36, 37, 46, 84. Mice were bred to homozygosity using a continuous breeding scheme.

Adult, LysM-eGFP+/+ mice (at least 6 weeks old, 20–25g) of both sexes were singly housed in a controlled environment (12 hr. light-dark cycle) with food ad libidum and access to water from a two-bottle system attached to the wire cage36. All experimental procedures were approved by the Drexel University Institutional Animal Care and Use Committee. Mice were randomly assigned to a naïve control (n=21♂, n=23♀), sham control (n=12♂, n=14♀) or SCI (n=22♂, n=21♀) group. Every effort was made to keep experimenters blinded. Though, it should be noted that in the first week after unilateral C5 SCI, mice display a clubbed forepaw ipsilateral to the lesion and are generally more lethargic. To reduce stress and limit the effects of novel testing environments during behavioral assessments, all mice were handled and acclimated 10 minutes per day for 5 days before baseline behavioral testing occurred to expose the mice to the experimenter. In addition, mice were placed in the von Frey and the Hargreaves’ chambers for five 10-minute sessions, and mice were exposed to the two-bottle setup for sucrose preference testing in their home cage beginning 7 days before testing. Baseline behavioral testing (von Frey and Hargreaves’) were conducted 1-week prior to SCI. von Frey and Hargreaves’ behavioral tests were repeated weekly post-injury for all groups, followed by the sucrose preference, mechanical conflict avoidance and forced swim tests over the course of weeks 6–7. At the completion of the forced swim test, mice were sacrificed for immunohistochemistry.

C5 Spinal Cord Contusion

The SCI was performed according to a clinically relevant and accepted model of SCI-induced neuropathic pain28, 55, 128. Briefly, mice were anesthetized using 5% isoflurane (Vedco Inc., St Joseph, MO, NDC 50989–150-15) in O2 and maintained in a surgical anesthetic plane with 2% isoflurane in O2. A hemilaminectomy was performed at the C5 level, exposing the right dorsal surface of the spinal cord up to and partially over the midline. The spinal column was stabilized in the Infinite Horizons device (Precision Systems and Instrumentation, Lexington, KY)111, and a custom probe was positioned 1 mm over the right dorsal surface of the C5 spinal cord close to the midline, centered between midline and the lateral edge. The spinal cord and surgical field were submerged in sterile saline, and a contusion was performed with 40-kdyne force and 2-second dwell time, resulting in average tissue displacement of 505um consistent across mice (see Table 1 for details). The incision was sutured in layers using vicryl 4–0 suture (Ethicon Vicryl, Plus, VCP214H). Antibiotic (Ampicillin: Sandoz Inc., Princeton, NJ, NDC 0781–3404-85, 100mg/kg) was administered subcutaneously at the time of injury and daily for 3 days post-injury. Lactated Ringer’s solution (1mL) was administered subcutaneously on the day of surgery and daily for up to 1-week post-surgery to prevent dehydration. Analgesics were withheld to limit potential confounds. Importantly, mice were closely monitored for visual signs of pain and/or distress daily including porphyrin production, piloerection, vocalization, labored breathing, and extreme lethargy by laboratory members and at least weekly by Drexel University veterinary staff.

Table 1:

Impactor force, displacement, and velocity of spinal cord injury impact between males and females. No significant differences between males and female mice between force (p=0.8890), velocity (p=0.6638), or displacement (p=0.1416) of the spinal cord contusion. Data recorded from the Infinite Horizons Spinal Cord Impactor following C5 unilateral contusion. Statistics. Mann-Whitney test. Compare ranks.

Contusion Parameters Separated by Sex:
SCI Group Force Displacement Velocity
Male 42.00 ± 3.61 512.00 ± 306.82 132.41 ± 19.50
Female 41.29 ± 1.52 498.62 ± 323.57 124.57 ± 9.84

Behavioral Testing

All mice were acclimated to testing environments for all tests described below except for the forced swim test. Behavioral assessments were conducted by an experimenter blinded to the experimental groups. Experimenters remained consistent throughout the behavioral testing per cohort, to limit potential confounds due to different animal handlers. The von Frey and Hargreaves’ assessments were conducted on the ipsilesional forepaw to assess hypersensitivity and pain-like behaviors attributed to the unilateral nature of our injury model. Testing occurred one week prior to surgery and weekly thereafter for 6 weeks. The C7 and C8 DRG contain the somata of the median and ulnar nerves, which innervate the plantar surface of the forepaw108. C7 afferents innervate half the forepaw, relaying sensory information from digits 1–3 and half the plantar surface of the forepaw, while C8 afferents innervate digits 4–5 and the other half of the forepaw13, 126. Importantly, where these dermatomes overlap in the center of the plantar surface of the forepaw, is where von Frey and Hargreaves’ stimuli are applied, causing activation of both C7 and C8 afferents. The mechanical conflict avoidance paradigm, sucrose preference and forced swim tests were conducted during week 7 post-injury (see Table 2 for details). We minimized confounding factors by maintaining testing order, consistently testing at the same time of day, and limiting the individuals handling the animals. Detailed descriptions of behavioral assessments are described below.

Table 2:

Timeline for all behavioral tests based on post-surgery days.

  Behavioral Tests Schedule Relative to the Date of Surgery:
Behavioral Test Testing Respective to Surgery Days Post-Injury (DPI)
Von Frey −5dpi, 7dpi, 14dpi, 21dpi, 28dpi, 35dpi, 42dpi
Hargreaves’ −4dpi, 8dpi, 15dpi, 22dpi, 29dpi, 35dpi, 43dpi
Sucrose Preference (24hr. Test) 44dpi
Mechanical Conflict Avoidance Training: 46dpi – 49dpi, Test: 50dpi
Forced Swim Test 51dpi (mice were sacrificed 24hrs. Post-FST)

von Frey Testing

Mice were placed in individual Plexiglas® chambers with a wire mesh bottom and allowed to acclimate for 10 min. Each forepaw was tested only when the weight of the mouse was equally distributed on all four paws, or as much as possible post-SCI. Plastic monofilaments of varying bending forces (von Frey monofilaments; Stoelting Co., Wood Dale, IL) were applied to the plantar surface of the forepaw for 1 second using the up-down method with an interval of 2–4min between applications16, 19, 30, 146. A total of 10 von Frey monofilament stimulus applications were collected for each paw for each day of testing, beginning with the 0.6g force von Frey hair. Immediate forepaw withdrawal with evidence of supraspinal awareness (licking or looking at the paw, moving away from the stimulus, etc.) was considered as a positive response, followed by application of von Frey hair of next lower force value. Absence of forepaw withdrawal was noted as a negative response, and the next higher force von Frey hair was applied. Paw withdrawal threshold (PWT) was determined as the lowest force (g) that produced a forepaw withdrawal and supraspinal behaviors in at least 50% of the applications at that force. Order of paw testing was randomized to minimize fatigue or an order effect. Mice that demonstrated a >33.34% reduction in PWT at 6-weeks compared to baseline were designated to display a mechanical pain phenotype.

Hargreaves’ Testing

Mice were placed in individual Plexiglas® chambers with a tempered glass bottom and allowed to acclimate for 10 min prior to each testing session. Each forepaw was tested only when the weight of the mouse was equally distributed on all four paws, or as much as possible post-SCI. Following acclimation, a noxious infrared light beam (IR=25) was applied using the Ugo Basile Plantar Heat test (Comerio VA, Italy) to the plantar surface of the paw, and paw withdrawal latency (PWL) was recorded in seconds3, 54, 90. The infrared stimulus application automatically shut off at 30sec to avoid tissue damage. Forepaw withdrawal with evidence of supraspinal awareness (licking or looking at the paw, moving away from the stimulus, vocalization, etc.) was considered as a positive response and was recorded. Five trials were collected randomly for each paw with at least a 1min delay between each trial. The trials for each paw were averaged to yield one score per paw. Order of paw testing was randomized to minimize fatigue or an order effect. Mice that demonstrated a >33.34% reduction in PWL at 6-weeks compared to baseline were designated to display a thermal pain phenotype.

Operant testing for brain-mediated behaviors indicating pain

The mechanical conflict-avoidance paradigm (MCAP) tests the brain-mediated behaviors indicating pain by capitalizing on the photophobic, nocturnal nature of the mouse. Mice are presented with a choice to remain in an aversive, brightly lit environment to avoid painful mechanical stimulation, or subject themselves to the noxious tactile stimulation to their paws in order to escape the aversive chamber and reach a preferred dark chamber19, 72. The mechanical conflict avoidance paradigm is a novel brain-dependent test that has been utilized prior to this study in mice. Previous research utilized this behavioral test in both the spared nerve injury (SNI) and CFA-induced inflammatory pain model113, while others utilized this method in the fracture/casting model of the chronic pain condition complex regional pain syndrome59. Prior studies have found that a probe height of 5mm lead to increased escape latency in the SNI model when compared to sham controls39, 59. The experimental setup consists of a rectangular runway connecting the aversive (light) chamber with the preferred (dark) chamber. During 3 days of post-operative training (52–54dpi), mice learned to spontaneously cross the runway to escape the aversive light stimulus. For testing, the runway floor was modified with an array of nociceptive probes (5mm in height, 0.4mm in diameter, spaced 10mm apart), and the latency to exit the aversive light chamber during the pre-test and experimental trials 1–3 was recorded in seconds per mouse and was averaged by experimental group. Data was analyzed for statistical significance between experimental group averages of pre-test, trial 1 only and the average of trials 1–3. Mice that did not exit the lit chamber were assigned an escape latency of 45 sec for that trial. If a mouse did not exit the light box prior to 45sec during the pretest, that mouse was excluded from the study since it was unable to learn the test.

Sucrose Preference Test

Mice were habituated to the 2-bottle apparatus on the wire home cage for 1-week prior to testing. For habituation, 2 bottles of H2O were attached to the wire rack next to the mouse’s food supply. The mouse had free access to these bottles for the entire experiment. On testing day, one bottle was filled with a 2% sucrose solution (20g Sucrose (Fisher Chemical, Fair Lawn, NJ, S5–500) mixed with 1L of H20) while the other was filled with H2O only32, 77, 119. Each bottle was weighed at the beginning of the testing period. After 12 hours, the bottles were switched to reduce bias for side preference. After 24 hours, the bottles were weighed again, and the sucrose bottle was replaced with H2O. Pre- and post-test bottle weights were recorded, and the sucrose preference ratio was calculated as the volume of sucrose consumed/total liquid volume consumed X 100. Mice exhibiting decreased sucrose preference ratio indicates anhedonia or depressive-like behavior119.

Forced Swim Test

The forced swim test was only performed at the terminal timepoint to avoid learned helplessness adaptation to multiple bouts of swimming. Mice were placed into a cylindrical tank of water (50 cm height, 27 cm diameter, 30 cm water level, 26–28°C water temperature) for a 6-minute swimming period15, 104. The entire testing session was recorded at water level via the GoPro HERO 2018 (GoPro Inc., San Mateo, CA). Post-hoc scoring was conducted in a blinded manor to determine scores for each mouse. Outcome measures for this test consisted of time to first float, immobility time, swimming time and climbing time. The time to first float was determined by the time from when the mouse in placed in the water to the time of the first bout of immobility that lasted for at least 1 sec in the water. This metric was captured in the first 2-minutes of the test, so if a mouse did not become immobile in the first two minutes, a score of 120 seconds was assigned. The other 3 outcome measures are scored only during the last 4 minutes. Immobility time was defined as a lack of movement, except for the small movements necessary for keeping the head above water. Climbing was defined as movements where all 4 paws are touching the walls of the tank in an attempt to escape. Swimming time was determined by subtracting the total immobility and climbing times from the total 4-minute experiment. Mice with high immobility times in the forced swim test is indicative of depressive-like behavior2, 15, 122.

Histology

Mice were sacrificed at 7-weeks post-SCI with an overdose of Euthasol (390mg/kg of sodium pentobarbital and 50mg/kg of phenytoin, intraperitoneally) followed by thoracotomy and perfused transcardially with 0.9% ice-cold saline followed by 4% paraformaldehyde (PFA). The cervical spinal cord segments C4–6, C7–C8, and ipsilesional C7–8 DRGs were dissected, post-fixed in PFA at 4°C overnight, then submersed in 30% sucrose for cryoprotection. Spinal cord blocks were embedded in OCT compound (Fisher Scientific, Pittsburgh, PA) and sectioned at −20°C using a cryostat (Leica Microsystems, Wetzlar, Germany). C7–8 DRGs were embedded in M1 embedding matrix (Richard-Allan Scientific LLC, Kalamazoo, MI, REF: 1310) and were sectioned at −20°C using a cryostat (Leica Microsystems, Wetzlar, Germany). Transverse 10um-thick sections 100 um apart spanning across C4–C6 cord, and C7–8 cord as well as 10-um thick sections 40 um apart of ipsilesional C7–8 DRG sections were mounted on superfrost plus microscope slides (Fisher Scientific, Pittsburgh, PA, Catalog Number: 12–550-15) for immunohistochemical processing.

Analysis of lesion epicenter

Spinal cord sections (10um thick) 100um apart spanning the extent of the lesion from C4–C6 were stained with cresyl violet (Sigma-Aldrich, St. Louis, MO, 10510–54-0) for Nissl substance and euriochrome cyanine (Sigma-Aldrich, St. Louis, MO, 3564–18-9) for myelin. Sections were cover-slipped with Permount (Toluene Solution UN1294) mounting medium (Fisher Chemical, Fair Lawn, NJ, SP15–500). Quantitaive analysis was conducted to determine the spared ipsilateral tracts of the SCI mice compared to naïve and sham mice using the Cavalieri estimator method (Stereo Investigator) by an experimenter blinded to experimental groups27, 28. Briefly, the Cavalieri estimator is used to determine an unbiased estimate of tissue area40, 48. The tissue sectioned determined to be the lesion epicenter (i.e., the section with the least amount of spared tissue and the largest lesioned area), was imaged on a Zeiss Axioplan EL-Einsatz Laboratory Microscope (#451888) and analyzed using the standard Cavalieri estimator probe in the StereoInvestigator software (MBF Bioscience, Burlington, VT). A computer-generated point counting grid (grid spacing is 150um) was randomly placed over the tissue section, and grid points were tallied based on whether the tissue under the point was spared white matter, spared grey matter, lesion on the ipsilesional (right) or contralesional (left) side of the spinal cord section. Based on the grid size and the number of points, the estimated area of each tissue category is determined. Ipsilateral spared tissue area was determined as the sum of the spared white and spared grey area estimates on the ipsilesional (right) side of the spinal cord. Likewise, the area of contralateral spared tissue was determined as the sum of the spared white and grey area estimates from the contralesional (left) side of the spinal cord section. Data are represented graphically as the proportion of spared ipsilateral/spared contralateral area.

Analysis of macrophages and microglia

Spinal cord sections spanning the extent of the lesion from C4-C6, C7–C8, and ipsilesional C7–8 DRGs sections on slides were washed three times with OX-PBS. Sections were treated with Dako Antigen Retrieval Solution (Agilent Pathology Solutions, Santa Clara, CA, S1699) at 95°C in a vegetable steamer for 20min for heat-induced target retrieval. Slides were incubated in blocking solution (5% normal serum, 1% fish gelatin (G7765; Sigma-Aldrich), 1% bovine serum albumin [BP1605; Fisher Scientific], 1% Triton X-100 [X-100; Sigma-Aldrich] in OX-PBS) with Mouse on Mouse blocking reagent (Vector Laboratories, Burlingame, CA, REF: MKB2213) at room temperature for 1h, then incubated in primary antibodies (see Table 3) overnight at room temperature. After three rinses in OX-PBS and a two-hour incubation in secondary antibodies (Table 3) sections were washed with 0.3% H2O2, 50% histology grade methanol in OX-PBS at room temperature for 30min to quench endogenous peroxidases. Antibodies were visualized using the Vectastain Elite ABC reagent (Vector Laboratories, Burlingame, CA, PK-6100) and 3,3’-diaminobenzidine (Vector Laboratories Burlingame, CA, SK-4100). Sections were dehydrated, cleared in Citrisolv (Fisher Scientific, 04–355-121), and cover-slipped using Permount (Toluene Solution UN1294) mounting medium (Fisher Chemical, Fair Lawn, NJ, SP15–500).

Table 3:

Antibody name, immunogen structure, manufacturer information and dilutions for immunohistochemical reagents.

    Antibodies Used for Immunohistochemistry:  
Antibody Name Immunogen Structure Manufacturer Information catalog/lot/RRID Dilution
Primary
Rat anti mouse CD68 IgG2a BIO RAD Laboratories, Hercules, CA MCA1957 / 164433 1:400
Mouse anti-ED1 IgG1 BIO RAD Laboratories, Hercules, CA MCA341R / AB_2291300 1:1500
Rabbit anti-IBA-1 Poly Wako Chemicals, Osaka, Japan 019–19741 / AB_839504 1:6000
Secondary
Rhodamine Red-X Conjugated Min XRs Whole IgG Jackson ImmunoResearch, West Grove, PA
115–295-146 / AB_2338766
1:400
Biotinylated House Anti-Mouse IgG (H+L), Visualized with DAB IgG Vector Laboratories, Burlingame, CA BA-2000–1.5 / AB_2336180 1:200
Biotin-SP conjugated
Goat-anti-rabbit IgG, visualized with DAB
Whole IgG Jackson Laboratory, Bar Harbor, ME 111–065-003 / AB_2337959 1:200

Spinal cord sections spanning the extent of the lesion from C4-C6, C7–C8, and ipsilesional C7–8 DRGs sections on slides were washed three times with OX-PBS. Slides were incubated in blocking solution (5% normal serum, 1% fish gelatin (G7765; Sigma-Aldrich), 1% bovine serum albumin [BP1605; Fisher Scientific], 1% Triton X-100 [X-100; Sigma-Aldrich] in OX-PBS) at room temperature for 1h, then incubated in primary antibodies (see Table 3) overnight at room temperature. After three rinses in OX-PBS and a two-hour incubation in secondary antibodies (Table 3) sections were washed with OX-PBS three times and cover-slipped using DAPI Fluoromount-G (Southern Biotech, Birmingham, AL, 0100–20) mounting medium.

Iba1 immunoreactivity was quantified using ImageJ (NIH, Bethesda, MD) by measuring the proportional area (PA) of positively stained tissue within a specific region23, 82. PA of Iba1 labeling in C4–6 and C7–8 cord was measured from one representative image of the ipsilesional dorsal horn per mouse (Leica DM5500 B microscope; Leica Microsystems) at 40X and are represented as group averages. For ipsilesional C4–6 and C7–8 dorsal horns, CD68+ cells with phagocytic amoeboid morphology were identified as macrophages and were manually counted on a representative 10um-thick section for each mouse, which are represented as experimental group averages. Representative Images were merged tile scans taken at 20X with an inlay image taken at 63X using a laser scanning confocal microscope (Leica True Confocal System SP8). For ipsilesional DRGs, CD68+ cells with phagocytic amoeboid morphology were identified as macrophages and were manually counted on 10um-thick sections 40um apart spanning through the entire ipsilesional C7–8 DRGs and aggregated to represent total macrophage count for the ipsilateral C7–8 DRGs of each mouse17. Cell counts were then represented as experimental group averages. Representative images were merged tile scans taken at 63X using a laser scanning confocal microscope (Leica True Confocal System SP8).

RNA isolation and cDNA synthesis of ipsilesional C4–8 DRGs and C7–8 dorsal horn.

The right C4–8 DRG of naïve, C4–8 DRG ipsilateral to the hemi-laminectomy and/or C5 SCI, and the ipsilesional C7–8 dorsal horn of the spinal cord were rapidly isolated from mice euthanized with Euthasol at 6 weeks post-injury (390mg/kg of sodium pentobarbital and 50 mg/kg of phenytoin, intraperitoneally). DRG and spinal cord were flash-frozen in supercooled isopentane and stored at −80°C. Ipsilesional C4–8 DRG from each mouse were pooled together and homogenized in 1 mL RNA-Solv Reagent (EZNA Total RNA kit, Omega Bio-Tek, R-6834, Norcross, GA) with 20 μL 2-mercaptoethanol per 1 mL reagent. Similarly, the ipsilesional dorsal horn of C7–8 was isolated and homogenized in 1 mL RNA-Solv Reagent as previously described. 100 μL chloroform was then added and sample centrifuged at 12,000 rpm at 4°C for 15 minutes to separate the aqueous and organic phase. Aqueous phase containing RNA was mixed with equal volume of 70% ethanol and RNA purification performed using HiBind RNA mini columns as per manufacturer’s instructions. The amount of total RNA was quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware, USA). Purity was verified using the A260/A280 ratio for each sample as approximately 2.0. RNA was aliquoted and stored at −80°C until use. One microgram of RNA was reverse transcribed into cDNA using the qScript XLT cDNA Supermix (QuantaBio, 95048, Beverly, MA) in the Eppendorf Mastercycler (Eppendorf, Hauppauge, NY) under the following conditions: 10 minutes at 25°C, 60 minutes at 42°C, 5 minutes at 85°C. cDNA was aliquoted and stored at −20°C until use.

Primer Design.

All primers were designed using PrimerBLAST engine (https://www.ncbi.nlm.nih.gov/tools/primer-blast/), specificity verified using BLASTn (National Center for Biotechnology Information, National Institutes of Health, Bethesda, MD, (http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome) and synthesized by Integrated DNA Technologies (Coralville, Iowa). Primer sequences were tested over 5–6 log dilutions of cDNA. Standard curves were generated to verify efficiency of primer (90–105%, R2=0.99). Melt curve analysis was performed (95 °C for 15 s, and 60 °C for 1 min, 95 °C for 15 s) and no-template controls were run to verify the absence of primer-dimers. Primer sequence information is available in Table 422, 38, 44, 66, 68, 82, 89, 100, 110, 136, 138.

Table 4.

Primer sequences used in quantitative polymerase chain reaction (qPCR).

    Primer Information for qPCR mRNA Analysis:    
Gene Species Sequence (5’ - 3’) Reference
18s Mouse Forward AGTCCCTGCCCTTTGTACACA 109
Reverse CGATCCGAGGGCCTCACTA
Arg1 Mouse Forward CATTGGCTTGCGAGACGTAGAC 82
Reverse GCTGAAGGTCTCTTCCATCACC
CCL2 Mouse Forward CCCACTCACCTGCTGCTACT 38
Reverse TCTGGACCCATTCCTTCTTG
CCR2 Mouse Forward ACAGCTCAGGATTAACAGGGACTTG 66
Reverse ACCACTTGCATGCACACATGAC
CD32 Mouse Forward CTGGACTGGAGCCAACAAGC 137
Reverse TGATCGTATTCTCAGCCTCAGT
CD68 Mouse Forward TTCTGCTGTGGAAATGCAAG 68
Reverse GAGAAACATGGCCCGAAGT
CD86 Mouse Forward ATGGACCCCAGATGCACCAT 106
Reverse CGGCAGATATGCAGTCCCAT
CD206 Mouse Forward GGAGTGATGGTTCTCCCGTTT 137
Reverse CATGCCAGGGTCACCTTTCA
GAPDH Mouse Forward TGCACCACCAACTGCTTAG 44
Reverse GGATGCAGGGATGATGTTC
IL-1β Mouse Forward CAGGCTCCGAGATGAACAAC 22
Reverse GGTGGAGAGCTTTCAGCTCATAT
IL-6 Mouse Forward GCCTTCTTGGGACTGATGCT 135
Reverse AGTCTCCTCTCCGGACTTGTG
IL-10 Mouse Forward ATGCCTGGCTCAGCACTGCTA 99
Reverse TACAAAGAAAGTCTTCACCTG
IL-12 Mouse Forward ACGGGACCAAACCAGCACATT 137
Reverse AAGGCACAGGGTCATCATCAAAGA
iNOS Mouse Forward ACATCGACCCGTCCACAGTAT 88
Reverse CAGAGGGGTAGGCTTGTCTC
TNFα Mouse Forward CAGGCGGTGCCTATGTCTC 88
Reverse CGATCACCCCGAAGTTCAGTAG

Quantitative Real Time Polymerase Chain Reaction (qPCR) of ipsilesional C4-C8 DRGs and C7–8 dorsal horn.

qPCR was performed according to Minimum Information for Publication of qPCR Experiments (MIQE) guidelines using the StepOnePlus RealTime PCR system (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA). The PCR reactions were performed with a total volume of 25 μL: 12.5 μL PerfeCTa SYBR Green Fast Mix (QuantaBio, 95–72 Beverly, MA), 1 μL diluted cDNA (1:50), 1.5 μL each of 2.5 μM forward and reverse primers and 8.5 μL nuclease-free water with the following conditions: 50 °C for 2 minutes, 95 °C for 10 minutes, followed by 40 cycles at 95 °C for 15 seconds, and 60 °C for 1 minute. All samples were run in triplicate, and values were only considered when within the coefficient of variation was less than 20%. GAPDH and 18s were used as the reference genes, their values averaged, and results were analyzed using a modified comparative cycle threshold (ΔΔCt) method79. Briefly, Ct values were normalized to the reference gene for each mouse within a group and were averaged and expressed as fold change over normalized Ct values of uninjured naïve control DRG or dorsal horn samples12.

Statistics

Graphical and statistical analysis was performed using PRISM GraphPad (version 9.2.0). von Frey and Hargreaves’ scores over time were analyzed using a 2way RM (Repeated Measure) ANOVA (Analysis of Variance) with the Geisser-Greenhouse correction, and matched values are stacked into a subcolumn. Tukey’s multiple comparison test, with individual variances computed for each comparison. The ratio of pain vs. no pain mice (−33.34% from baseline to determine pain) for von Frey and Hargreaves’ were analyzed using the Chi-squared test. All data was tested for normality using the Shapiro-Wilks test. Data that did pass normality was analyzed with parametric statistics, while data that did not pass normality was analyzed with nonparametric statistics. CD68 cell counts (C7–8 ipsilateral DRGs, C4–6 SC, and C7–8 SC), Iba1 PA (C4–6 SC and C7–8 SC) and some qPCR mRNA fold change graphs (DRG: CD68 and CD206; DH: CCL2 and Arg1) presented by experimental groups were analyzed using One-Way ANOVA with Tukey’s multiple comparisons test, with a single pooled variance. Sucrose preference ratio, MCAP latency to exit (pre-test, trial 1 and average), forced swim (immobility, swimming and climbing), some qPCR mRNA fold change graphs (DRG: iNos, CD86, IL-1B, IL-6, IL-12, TNFa, CCL2, Arg1 and IL-10; DH: CD68, CD206, iNos, IL-1B, IL-6, IL-12, TNFa, IL-10) and lesion analysis separated by experimental group were all analyzed using Kruskal-Wallis test with Dunn’s multiple comparisons test. Contusion parameters were analyzed using the Mann-Whitney test, to compare ranks. All graphs are reported as mean ± standard error of the mean (SEM).

Hierarchical cluster and principal component analyses, which were performed using R (version 4.1.1) and MatLab (R2022a Update 5). Principal Component Analysis (PCA) was performed initially on behavioral data to determine the contributions of variance when clustering experimental mice124. Three different PCAs were performed throughout this experiment to determine the contributions of biologically relevant variables to behavioral alterations post-SCI. First, a PCA was conducted including behavior scores at 6-weeks to determine the relative contributions of variables to the subclustering of mice based on behavior post-SCI. The following two PCAs were then conducted to disentangle the panel of qPCR analytes conducted in the ipsilateral C4–8 DRGs and C4–6 SC. The DRG PCA and SC PCAs were run separately but both included matched behavior scores at 6-weeks post-SCI to determine the overall driving characteristics of the secretome on behavior in both the DRGs and SC regions that were affected post-SCI. Hierarchical Cluster Analysis (HCA) is an unbiased approach to grouping datasets based on similarity. The hierarchical cluster analysis produces a dendrogram, that can be interpreted to identify subgroups or clusters of mice using at a particular height or level of similarity 35, 80. In this case, the height of 8 was calculated to be the highest level of similarity where 3 clusters emerged. The dataset for these mice included von Frey 6-week percent baseline, Hargreaves’ 6-week percent baseline, sucrose preference ratio at 6-weeks and forced swim immobility time. Once these clusters were established, individual graphs were created in Prism for von Frey precent baseline, Hargreaves’ percent baseline, sucrose preference ratio and immobility time to better understand the breakdown of the data. Individual behavior graphs based on dendrogram subclusters were analyzed first for normality via the Shapiro-Wilks test. Data that did pass normality was analyzed with parametric statistics, while data that did not pass normality was analyzed with corresponding nonparametric statistics. Forced swim immobility separated by HCA subclusters was analyzed using One-way ANOVA with Tukey’s multiple comparison test, with a single pooled variance. Von Frey, Hargreaves’, SPT Ratio, CD68 cell counts (C7–8 ipsilateral DRGs, C4–6 SC and C7–8 SC) and IBA1 PA (C7–8 SC) separated by HCA subclusters were analyzed using Kruskal-Wallis test with Dunn’s multiple comparison test. All graphs are reported as mean ± SEM.

Data Sharing.

All data will be indexed and made publicly available via the Open Data Commons for Spinal Cord Injury (https://odc-sci.org/) upon publication. Experimental protocols will be provided to interested researchers upon request.

Results

Lesion analysis and contusion parameters show no differences between the sexes.

To determine the lesion epicenter and spared white matter tracts post-SCI, lesion analysis was conducted using the Nissl/Myelin stain, and the Cavilieri method to determine lesion area, spared white matter and spared grey matter on both the ipsilateral and contralateral sides of the C4–6 spinal cord from naïve, sham and SCI mice (Figure 1A-D). Representative images of SCI mice show lesion sites that encapsulate the ipsilateral grey matter and portions of the white matter tracts (Figure 1 B and D). SCI mice had decreased proportion of spared ipsilateral area/spared contralateral area indicating that the SCI caused lesion area on the ipsilateral side which damaged grey matter and white matter tracts (Figure 1E). There were no differences between the sexes of any experimental group (2way ANOVA Sex: p=0.827, f=0.048, Group X Sex: p=0.665, f=0.410). In addition to lesion analysis, quantitative analysis of contusion parameters was conducted. There were no differences between the sexes of SCI mice in force (p=0.8890), velocity (p=0.6638), or displacement (p=0.1416) of the impactor probe during the contusion procedure. SCI mice had an average 41.65 ± 2.81 kDyn force, 505.50 ± 315.19 um displacement and 128.58 ± 16.03 m/s velocity (Table 1). This lesion analysis and contusion parameter analysis indicates that at chronic timepoints, the mouse SCI contusion paradigm that is used in this experiment does not affect male and female mice differently, and that this model is an appropriate and reproducible model of C5 SCI.

Figure 1:

Figure 1:

Tissue Sparing after Unilateral C5 Spinal Cord Contusion. Representative images of C5 spinal cord from naïve male (A) or female (C) mouse and images of the spinal cord injury lesion epicenter from a male (B) and female (D) mouse. E. Quantification of spared tissue at C4–6. SCI mice displayed decreased proportion of ipsilateral vs. contralateral spared tissue when compared to both naïve (p<0.0001) and sham mice (p<0.0001). Statistics: Naïve (n=31), Sham (n=16), and SCI (n=41). E. 2way ANOVA (Sex: p=0.827, f=0.048, Group X Sex: p=0.665, f=0.410). Shapiro-Wilks test for normality, Kruskal-Wallis test to determine group differences. Dunn’s multiple comparison test. Scale bar= 500um. **** p<0.0001.

SCI causes mechanical allodynia and thermal hyperalgesia in both male and female mice.

Mice from the SCI group displayed increased ipsilateral forepaw mechanical and thermal pain sensitivity when compared to sham and naïve mice. Mechanical hypersensitivity was tested using the manual von Frey up-down method to determine the 50% paw withdrawal threshold for each mouse over time (Figure 2A). The baseline forepaw withdrawal threshold for all mice was 1.92 ± 1.56 grams (averaged across all experimental groups), and there were no significant differences in paw withdrawal threshold between male and female mice prior to surgery (Supplemental Figure 1A). In fact, there were no significant differences in the withdrawal threshold of the ipsilateral forepaw between male and female mice within experimental groups at any time point (3way RM ANOVA: Sex p=0.121, f=2.417; Group X Sex X Time p=0.885, f=0.546). Thus, the data were collapsed based on group and timepoint (2way RM ANOVA: Group p<0.0001, f=19.19; Group X Time p<0.0001, f=7.361). The sham group exhibited similar forepaw withdrawal thresholds to the naïve group at all timepoints tested (p>0.05). At week 1, SCI mice displayed decreased paw withdrawal thresholds when compared to naïve (p=0.0138), but not sham (p=0.1298) mice, suggesting that the hemilaminectomy procedure may induce temporary ipsilateral forepaw sensitivity. By week 2, SCI mice displayed statistically significantly decreased paw withdrawal thresholds when compared to naïve (p=0.0009) and sham (p=0.0014) mice. This statistical significance persisted until the end of the experiment (SCI vs. Naïve weeks 3–6: p<0.0001; SCI vs. Sham weeks 3–6: p<0.0001). Additionally, more SCI mice display decreased forepaw withdrawal threshold to mechanical stimuli when compared to sex matched naïve or sham mice as represented in Figure 2B, where a 33.34% decrease in paw withdrawal threshold from baseline was used to determine mouse forepaw hypersensitivity (Male SCI vs. Naïve & Sham: p<0.0001; Female SCI vs. Naïve & Sham: p<0.001).

Figure 2:

Figure 2:

Spinal cord injury increased forepaw mechanical and thermal sensitivity starting at 1-week post-SCI and persisted until the end of the experiment, when MCAP was used to identify pain perception. A. von Frey thresholds of ipsilesional forepaw overtime. Starting at 1-week post-surgery, SCI vs. Naïve mice display significantly reduced paw withdrawal threshold (p=0.0138). This finding is also significant at 2, 3, 4, 5, and 6 weeks (p<0.001) post-SCI. SCI vs. Sham mice display significantly reduced paw withdrawal threshold at 2, 3, 4, 5, and 6 weeks (p<0.005) post-SCI. Naïve vs. Sham mice were never statistically significant throughout all 7 testing sessions (p>0.05). B. Total number of mice with mechanical hypersensitivity at 6-weeks post-SCI separated by experimental group and sex. Hypersensitivity was determined by at least a 33.34% reduction in percent baseline. 20.0% Naïve male mice and 20.0% Naïve female mice exhibit hypersensitivity at 6-weeks. Sham surgeries caused 16.7% male mice and 14.3% female mice to become hypersensitive at 6-weeks. SCI caused 81.8% of male mice and 76.2% of female mice to exhibit hypersensitivity at 6-weeks. SCI caused a significant increase in the number of mice that displayed mechanical hypersensitivity in both male (p<0.0001) and female (p=0.0002) mice compared to sham and naïve mice. C. Hargreaves’ radiant heat paw withdrawal latencies overtime. Starting at 1 week, SCI vs. Naïve mice displayed significantly reduced paw withdrawal latencies (p<0.0001). This finding is also significant at 1, 2, 3, 4, 5, and 6 weeks (p<0.001) post-SCI. SCI mice displayed significantly reduced paw withdrawal latencies at 1, 2, 3, 4, 5, and 6 weeks when compared to sham mice (p<0.001). Naïve vs. Sham mice were statistically significant at week 3 (p=0.03) but not any other timepoints (p>0.05). D. Total number of mice with thermal hypersensitivity at 6-weeks post-surgery separated by experimental group and sex. Thermal hypersensitivity was determined by at least a 33.34% reduction in percent baseline values. 16.7% Naïve male mice and 12.5% Naïve female mice exhibit hypersensitivity after 7 testing sessions. Sham surgeries caused 37.5% male mice and 12.5% female mice to exhibit thermal hypersensitivity by 6-weeks. SCI caused 41.2% of male mice and 50.0% of female mice to exhibit hypersensitivity at 6-weeks. SCI did not cause a significant increase in the number of mice that displayed thermal hypersensitivity in both male (p=0.3592) and female (p=0.0729) mice compared to sham and naïve mice. E. Mechanical Conflict Avoidance paradigm reveals differences in SCI mouse pain perception. MCAP Latency to Exit (LtE) Pre-Test where no probes are present on the runway. Schematic of the MCAP apparatus inlayed showing 1: Brightly lit starting chamber, 2: transition runway where noxious probes can be introduced, and 3: Dark box where the mouse enters to end the behavioral test. No statistical significance between any experimental groups (p>0.05). F. MCAP LtE Trial 1. SCI mice had significantly increased LtE when compared to naïve (p=0.0025), but not sham (p=0.0917) mice. D. MCAP LtE Trial Average (Trials 1–3). SCI mice had significantly increased LtE when compared to naïve (p=0.0023), but not sham (p=0.3728) mice. Statistics: A-B. Naïve (n=30), Sham (n=26), and SCI (n=43). C-D. Naïve (n=20), Sham (n=16), and SCI (n=33). E-G. Naïve (n=30), Sham (n=25), and SCI (n=14). Squares on each MCAP graph (E-G) represent male mice and triangles represent female mice. A. 3-way RM ANOVA (Sex p=0.121, f=2.417; Group X Sex X Time p=0.885, f=0.546) to determine sex differences. 2-way RM ANOVA (Group p<0.0001, f=19.19; Group X Time p<0.0001, f=7.361) with the Geisser-Greenhouse correction, matched values are stacked into a subcolumn to determine group differences. Tukey’s multiple comparison test, with individual variances computed for each comparison. C. 3-way RM ANOVA (Sex p=0.364, f=0.826; Group X Sex X Time p=0.602, f=0.846) to determine sex differences. 2way RM ANOVA (Group p<0.0001, f=44.45; Group X Time p=0.0027, f=2.572) with the Geisser-Greenhouse correction, matched values are stacked into a subcolumn to determine group differences. Tukey’s multiple comparison test, with individual variances computed for each comparison. B, D. Chi-squared Analysis. E-G. Two-way ANOVA (MCAP Pre-Test Sex: p=0.866, f=0.029, MCAP Pre-Test Group X Sex: p=0.353, f=1.058; MCAP Trial 1 Sex: p=0.167, f=1.948, MCAP Trial 1 Group X Sex: p=0.772, f=0.260; MCAP Trial 1–3 Sex: p=0.244, f=1.381, MCAP Trial 1–3 Group X Sex: p=0.954, f=0.047) to determine sex differences. Shapiro-Wilks test for normality. Kruskal-Wallis test to determine group differences. Dunn’s multiple comparisons test. * SCI vs. all other groups, $ Sham vs. Naïve, # SCI vs. Naïve only, * p<0.05, *** p<0.001, **** p<0.0001.

Thermal hypersensitivity was tested using the Hargreaves’ test (Figure 2C). The baseline forepaw withdrawal latency for all mice was 9.10 ± 3.17 seconds (averaged across all experimental groups). No significant differences in paw withdrawal latency were determined between any group prior to surgery (Supplemental Figure 1B). Moreover, there were no significant differences between males and females within experimental groups at any timepoint (3way RM ANOVA: Sex p=0.364, f=0.826; Group X Sex X Time p=0.602, f=0.846) for thermal ipsilateral forepaw withdrawal latency. Thus, the data were collapsed based on group and timepoint (2way RM ANOVA: Group p<0.0001, f=44.45; Group X Time p=0.0027, f=2.572). At week 1, SCI mice displayed decreased paw withdrawal latency when compared to naïve and sham mice (p<0.001). This statistical significance persisted until the end of the experiment (SCI vs. Naïve week 2–6: p<0.001; SCI vs. Sham week 2–6: p<0.001.). Additionally, more SCI mice display decreased paw withdrawal latency when compared to naïve or sham mice as represented in Figure 2D, where a 33.34% decrease in paw withdrawal latency from baseline was used to determine mouse forepaw hypersensitivity. While this finding was not statistically significant when comparing sex matched mice, it is trending toward significance in female but not male mice (Female SCI vs. Naïve & Sham: p=0.0729; Male SCI vs. Naïve & Sham: p=0.3592).

Spinal cord injury alters brain-dependent nocifensive behavior tested using the mechanical conflict avoidance paradigm.

While von Frey and Hargreaves’ testing revealed significant differences in forepaw hypersensitivity in SCI mice, neuropathic pain is inferred from evoked reflex responses, rather than a brain-dependent perception. Thus, we utilized an additional behavioral test of mechanical sensation called the mechanical conflict avoidance paradigm (MCAP) in a subset of mice from each group to assess perception of noxious mechanical stimuli. In the test, the mouse must choose between two aversive stimuli— a substrate studded with an array of noxious probes—to escape to a safe, dark chamber with a smooth floor (MCAP apparatus shown in Figure 2E) or a bright light, which is naturally aversive to the mouse. Mice are nocturnal prey animals. They naturally avoid light and seek dark, confined spaces. This test is important because we can determine if the noxious probes are causing the mice to linger in the brightly lit chamber, which would be an indication that the mice perceive the runway probes as aversive. From this data, we can infer that increased latency to exit suggests a painful hypersensitivity that is interfering with the natural urge to avoid bright light. There were no differences in latency to exit times between groups during the pre-testing (Figure 2E), indicating that all mice, regardless of experimental group, react similarly to the noxious light stimulus. These findings could also be used as a proxy to measure anxiolytic behaviors, where all mice, regardless of experimental group, avoided remaining in the brightly lit chamber, similar to the light-dark box10. Complementary to the reflex based nociceptive tests, at 6 weeks post SCI, there were no statistically significant sex differences determined between all experimental groups (p>0.05). On average, naïve mice left the bright chamber in 7.39 ± 6.32 seconds during the pre-test, while sham and SCI mice left the light box in 15.31 ± 19.50 seconds or 26.38 ± 19.95 seconds, respectively. During test trial 1, SCI mice displayed increased latency to exit the light chamber when compared to naïve (Figure 2F; p=0.0025), but not sham mice (p=0.0917), indicating that the nociceptive probes on the transition runway were aversive enough for some SCI and sham mice to pause in the brightly lit starting chamber before traversing the runway of probes. This was also the case when averaging all three trials, where SCI mice displayed increased latency to exit over all three trials when compared to naïve (p=0.0023), but not sham (p=0.3728) mice, indicating a persistent response to the presentation of the nociceptive probes (Figure 2G). These data are consistent with published reports in the rat that demonstrate that sham rats demonstrate altered perception of aversive tactile stimuli, and that SCI elicits volitional and aversive responses to noxious tactile stimulation of the forepaw19, 96. Here we demonstrated similar phenomena observed following laminectomy surgery96, but in the mouse model of cervical SCI.

SCI induces learned-helplessness and anhedonia, two hallmarks of depressive-like behavior.

Anhedonia was tested using the sucrose preference test at 6 weeks post SCI, where mice have the option to drink standard water or 2% sucrose solution for 24 hours while in the home cage. Decreased sucrose preference ratio is indicative of an anhedonia phenotype77. At 6 weeks, mice from all groups preferred the 2% sucrose solution over standard water, with sucrose preference ratios ranging from 0.71 to 0.81 (Figure 3A). Two-way ANOVA revealed no statistical significance within groups between the two sexes (Supplemental Figure 1C; Sex: p=0.530, f=0.398, Group X Sex: p=0.484, f=0.733) or between experimental groups (2way ANOVA Group: p=0.095, f=2.436). Since there were no differences due to the sex of the mice, data were collapsed within experimental group for further analysis. Kruskal-Wallis test on collapsed groups revealed a statistically significant decrease in sucrose ratio between the SCI group when compared to sham (p=0.0021) but not naïve (p=0.2602) mice. These data suggest that preference for sucrose is significantly altered in chronic SCI, compared to sham, which could mean that damaging the spinal cord could lead to dysfunction in cortically mediated behaviors. Additionally, this finding could indicate that there is a dysfunction in taste recognition116 or glucose metabolism in mice post-SCI63.

Figure 3:

Figure 3:

SCI causes increased learned-helplessness symptoms and anhedonia symptoms in male and female mice. A. Sucrose Preference Test at 6-weeks separated by group. SCI mice displayed decreased sucrose preference when compared with sham (p=0.0021), but not naïve (p=0.2602) mice. B. FST Immobility time separated by group. SCI mice displayed significantly increased immobility times compared to naive (p<0.0001) and sham (p=0.0385) mice. Sham mice did not display increased immobility time when compared to naïve (p=0.0597) mice. C. FST Swimming Time separated by group. SCI mice displayed significantly decreased swimming time compared to naive (p<0.0001) mice. Sham mice also displayed decreased swimming time when compared to naïve (p=0.0001) mice. D. Climbing time separated by group. SCI mice displayed significantly reduced climbing times compared to naive (p<0.0001) and sham (p=0.0025) mice. Statistics: A. Naïve (n=34), Sham (n=16), and SCI (n=27). B-D. Naïve (n=44), Sham (n=26), and SCI (n=40). Male data points are represented as squared and female data points are represented as triangles. A-D. 2way ANOVA (SPT Sex: p=0.530, f=0.398, SPT Group X Sex: p=0.484, f=0.733; FST Immobility Sex: p=0.457, f=0.558, FST Immobility Group X Sex: p=0.945, f=0.056; FST Swimming Sex: p=0.744, f=0.107, FST Swimming Group X Sex: p=0.556, f=0.591; FST Climbing Sex: p=0.497, f=0.464, FST Climbing Group X Sex: p=0.776, f=0.254) to determine sex differences. Shapiro-Wilks test for normality. Kruskal-Wallis test to determine group differences. Dunn’s multiple comparisons test. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

While anhedonia-like behaviors are one feature of the human depressive condition which is affected following SCI in mice, learned-helplessness behavior was also more prevalent in SCI mice compared to naïve and sham mice. Learned-helplessness behavior was measured using the forced swim test at 6 weeks post-SCI. Increased immobility time is indicative of learned-helplessness behavior15 and is represented in Figure 3B. Naïve mice averaged 172.75 ± 42.02 seconds swimming, 56.43 ± 33.47 seconds immobile, and 36.81 ± 17.33 seconds climbing. Sham mice averaged 124.69 ± 32.87 seconds swimming, 82.43 ± 44.76 seconds immobile, and 32.88 ± 21.54 seconds climbing. SCI mice averaged 124.03 ± 52.97 seconds swimming, 108.71 ± 53.27 seconds immobile, and 16.24 ± 9.25 seconds climbing. No differences between sexes within groups were determined (Supplemental Figure 1D; 2way ANOVA Sex: p=0.457, f=0.558, Group X Sex: p=0.945, f=0.056), so the data collapsed experimental group only (2way ANOVA Group: p<0.001, f=21.754). SCI mice displayed significantly increased immobility time when compared to naïve (p<0.0001) and sham (p=0.0385) mice. SCI (p<0.0001) and sham (p=0.0001) mice displayed decreased swimming time compared to naïve mice (Figure 3C). SCI mice displayed decreased climbing time compared with naïve (p<0.0001) and sham (p=0.0025) mice (Figure 3D). Notably, SCI mice did not appear to fatigue faster than naïve or sham mice as the time that elapsed until the first instance where the mouse was still and floating in the water during the FST and the general activity of SCI mice were not different from naïve and sham groups (Supplemental Figure 2A-C). Additionally, SCI mice did not employ different strategies for swimming or floating compared to naïve or sham mice47, 69. Swimming behavior in mice is mainly hindlimb driven, providing further evidence towards these findings indicating that the increased immobility times were not because of a motor or metabolic abnormality caused by the SCI.

Myeloid cells are recruited to the DRG, lesion epicenter and below the lesion epicenter post-SCI.

We captured and quantified images from naïve, sham and SCI mice to demonstrate the differences between macrophage infiltration in the C7–8 ipsilateral DRGs (Figure 4A-O), lesion epicenter and C7–8 dorsal horn (Figure 5 A-R). Macrophages are small round immune cells that are recruited to the nervous system and activated post-injury. These cells are observed infiltrating via the LysM-eGFP reporter mouse line, in which myeloid cells are tagged with eGFP. These eGFP positive cells are found in the C7–8 ipsilateral DRGs and C4–8 dorsal horn (DH) of the spinal cord post-SCI. Additionally, by utilizing anti-CD68 staining, resident macrophages (LysM-eGFP-/CD68+) can be differentiated from infiltrating macrophages (LysM-eGFP+/CD68+) and other infiltrating myeloid cells (LysM-eGFP+/CD68-). Quantitatively, in the C7–8 ipsilateral DRGs, SCI mice exhibited statistically significant increases in CD68+ cells when compared to naïve (p<0.0001) and sham (p<0.0001) mice (Figure 4D). Similar analysis was conducted in the DH of the spinal cord, where SCI mice exhibited statistically significant increases in CD68+ cells in the C4–6 DH (Figure 5G) and C7–8 DH (Figure 5H) when compared to naïve (C4–6: p<0.0001, C7–8: p=0.0069) and sham (C4–6: p=0.0087, C7–8: p=0.0337) mice. This indicates that infiltrating macrophages accumulate in the DH and DRGs of mice post-SCI.

Figure 4:

Figure 4:

Diverse macrophage (LysM+/CD68+) subtypes infiltrate the C7–8 ipsilateral DRGs and remain present at 6-weeks post-SCI leading to alterations in the local inflammatory environment. A. Representative image of the ipsilateral C7 DRG expression of LysM-eGFP (A)., CD68 staining (A’)., and merged image (A”) for a naïve mouse. B. Representative image of the ipsilateral C7 DRG expression of LysM-eGFP (B)., CD68 staining (B’)., and merge (B”) for a sham mouse. C. Representative image ipsilateral C7 DRG expression of LysM-eGFP (C)., CD68 staining (C’)., and merge (C”) from a SCI mouse. D. Quantification of CD68+ cell counts in the C7–8R DRGs. SCI mice had significantly more CD68+ cells in the C7–8R DRGs when compared to naïve (p<0.0001) and sham (p<0.0001) mice. qPCR analyte alterations for C4–8 ipsilateral dorsal root ganglia (DRGs) post-SCI. E. CD68. F. CD86. G. CCL2. H. TNFa. I. iNOS. J. CD206. K. Arg1. L. IL-12. M. IL-10. N. IL-6. O. IL-1B. Statistics: Shapiro-Wilks test for normality. D-E, J. One-way ANOVA. Tukey’s multiple comparison test, with a single pooled variance. F-I, K-O. Kruskal-Wallis test with Dunn’s multiple comparison test. Scale Bar = 100um. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

Figure 5:

Figure 5:

Diverse macrophage subtypes infiltrate the lesion epicenter and remain present at 6-weeks post-SCI leading to alterations in the local inflammatory environment. A-C. Representative image of C5 spinal cord showing expression of LysM-eGFP merged with anti-CD68 staining for a naive mouse (A)., a sham mouse (B)., and a SCI mouse (C). 63X inlay of the ipsilateral dorsal horn magnifying the white box shown in bottom left corner of each spinal cord image. D-F. Representative image of C7 spinal cord showing expression of LysM-eGFP merged with anti-CD68 staining for naïve mouse (D)., sham mouse (E)., and SCI mouse (F). 63X inlay of the ipsilateral dorsal horn magnifying the white box shown in bottom left corner of each spinal cord image. G. Quantification of CD68+ cells in the dorsal horn of the C4–6 spinal cord. SCI mice had significantly more CD68+ cells in the lesion epicenter when compared with naïve (p<0.0001) and sham (p<0.0001) mice. H. Quantification of CD68+ cells in the dorsal horn of the C7–8 spinal cord. SCI mice had significantly more CD68+ cells in dorsal horns associated with forepaw dermatomes when compared with naïve (p=0.0007) but not sham (p=0.1341) mice. qPCR analyte alterations for the dorsal horn (DH) of the spinal cord post-SCI. I. CD68. J. CCL2. K. TNFa. L. iNOS. M. CD206. N. Arg1. O. IL-12. P. IL-10. Q. IL-4. R. IL-1B. Statistics: Shapiro-Wilks test for normality. G, H, J, N. One-way ANOVA. Tukey’s multiple comparison test, with a single pooled variance. I, K-M, O-R. Kruskal-Wallis test with Dunn’s multiple comparison test. Scale bar (20X) = 300um, Scale Bar (63X) = 100um. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

Additionally, we captured representative images from naïve, sham and SCI mice at the lesion epicenter (Supplemental Figure 3A-D) and the C7–8 dorsal horn stained for Iba-1 (Supplemental Figure 3E-H) to identify group differences in microglial activation. Our lab as well as many other labs have correlated the likely microglial activation states at the lesion epicenter and below with pain development and persistence19, 28. IBA1+ microglia display a ramified morphology at resting state (Supplemental Figure 3A and 3E), which can be seen in the uninjured mouse spinal cord. This ramified morphology describes microglia with small cell bodies and long elaborate processes that extend in all directions. After an injury, microglia alter their morphology to an activated state by retracting their processes and migrating to the injury site (Supplemental Figure 3C and 3G), where microglia have larger cell bodies and short processes. Microglia can also have a phagocytic morphology, which occurs after injury when microglia attempt to clear debris from the lesion epicenter. Quantitatively, SCI mice displayed a statistically significant increase in IBA1+ proportional area in the lesion epicenter (Supplemental Figure 3D) and C7–8 dorsal horn (Supplemental Figure 3H) compared to naïve (p<0.0001) and sham (p<0.0001) mice. This indicates that microglia are activated at the lesion epicenter and caudal levels following SCI.

qPCR in the dorsal horn of the lesion epicenter and C4–8 ipsilateral DRGs

Utilizing qPCR in the DH of the spinal cord and the DRGs strengthened the immunohistochemical findings and supplements these findings by adding information regarding possible macrophage/microglial activation states and inflammatory environment of these pain-associated regions. The fold change increase of pro-inflammatory macrophage markers and cytokines has been associated with the development and persistence of chronic pain18, 26, 67, 97, 143. In this study, we did not identify any phenotypic macrophage markers that are statistically elevated in the DH of the spinal cord after running CD68, iNos, CD206 and Arg1 (Figure 5I, L, M and N, respectively). Additionally, we only found that IL-12 (Figure 5O) was elevated in sham mice when compared to naïve (p=0.0199) but not SCI (p=0.1914) mice. No other cytokines were elevated post-SCI (Figure 5I-R). Conversely, we have identified that CD68 mRNA, which is a pan macrophage marker (predominantly expressed on the intracellular lysosomes of tissue macrophages/monocytes20, 98, 129), is elevated in the C4–8 ipsilateral DRGs at 6-weeks in SCI mice when compared to sham (p=0.0003) and naïve (p=0.0225) mice (Figure 4E). These findings indicate that there are increased macrophages in the C4–8 ipsilateral DRGs, confirming our findings from IHC (Figure 4A-C). Further investigation into the phenotype of these macrophages reveals that CD206 mRNA, which is a marker of anti-inflammatory macrophages, was also elevated at 6-weeks in SCI mice when compared to sham (p=0.0399) and naïve (p=0.0124) mice (Figure 4J). Interestingly, there is also an increase in the pro-inflammatory macrophage marker iNos mRNA (Figure 4I: SCI vs. Naïve: p=0.1392; SCI vs. Sham p=0.6554) and pro-inflammatory cytokine TNFa mRNA (Figure 4H: SCI vs. Naïve: p=0.2248; SCI vs. Sham p=0.2048) in some SCI mice, however, when comparing experimental groups the data was not found to be significant, but speaks to the diversity of the immune response and behavioral alterations after injury.

To disentangle the complex immune response and behavioral alterations post-SCI, a PCA was conducted for the DRG (Supplemental Figure 4A-E) and DH (Supplemental Figure 5A-E) qPCR with matching behavioral scores. SCI DRG had significantly increased principal component (PC) scores compared to Naïve DRGs (p=0.0045) and Sham DRGs (p=0.0012) in PC1, while Sham DRGs displayed significantly decreased scores compared Naïve DRGs (p=0.0320) in PC1 (Supplemental Figure 4B). These findings are then explained by the individual PC graphs demonstrating that increased presence of cytokines in the DRG such as IL-1B, TNFa and IL-6 are inversely correlated with paw withdrawal threshold (Supplemental Figure 4C-E). Additionally, SCI DH displayed significantly decreased PC scores when compared to Naïve DH (p=0.0453) and Sham DH (p=0.0068) in PC1. Sham DH displayed significantly decreased PC scores when compared to Naïve DH (p=0.0016) in PC3 (Supplemental Figure 5B). These findings are then explained by the individual PC graphs demonstrating that TNFa and CCR2 are positively correlated with increased latency to exit in the MCAP, while negatively correlated with paw withdrawal thresholds to mechanical stimulation (Supplemental Figure 5C-E).

Hierarchical cluster analysis grouped mice based on pain sensitivity and depressive phenotypes.

An unbiased method of clustering is useful for subgrouping mice based on their behavior scores. In this experiment, we utilized both hierarchical cluster analysis (HCA) and PCA to identify clusters of mice based on behavioral scores and the prominent variables that drive the clustering, respectively. The HCA produced a dendrogram that subclustered mice based on behavior phenotypes (Figure 6A). At the height of 8 on the dendrogram, there are 3 distinct groups labeled C1, C2 and C3. C2 was the only homogeneous population comprised of all SCI mice, while C1 and C3 were comprised of a heterogenous population of mice from all experimental groups. As reflected in Figure 6B, 19 naïve mice clustered into C1 and 1 naïve mouse clustered into C3; 14 sham mice clustered into C1 and 2 sham mice clustered into C3; 8 SCI mice clustered into C1, 16 SCI mice clustered into C2, and 3 SCI mice clustered into C3. Behavior scores were re-graphed by clusters rather than experimental groups to determine the characteristics of each subgroup (Figure 6C-F). Mice in C1 had high von Frey scores, high Hargreaves scores, high SPT ratio and low immobility time in the forced swim test. These features resembled baseline or uninjured mouse scores. Mice in C2 had low von Frey scores, and high immobility time in the forced swim test while neither Hargreaves nor SPT ratio revealed any differences between clusters. These features are indicative of mechanical pain and depression-like phenotype. Finally, mice in C3 exhibited low SPT ratios compared to the other clusters, but no other distinct differences in behaviors. These features are difficult to discriminate but may be indicative of a modality specific phenotype for both pain and depression testing (thermal hyperalgesia and anhedonia).

Figure 6:

Figure 6:

Hierarchical cluster analysis produces a dendrogram that identifies subgroups of mice based on results of nociceptive pain and depressive-like behavior testing. A. Cluster dendrogram produced by unbiased hierarchical cluster analysis. The cluster dendrogram yielded 3 major subgroups at height of 8: C1, C2, and C3. B. Composition of subgroups identified by cluster dendrogram displayed by experimental groups. C1 consists mainly of Naïve and Sham mice, while C2 consists only of SCI mice. C3 is a mix of all three experimental groups. C. von Frey scores grouped by dendrogram subclusters identified that C2 (p<0.0001) displayed significantly reduced paw withdrawal threshold from C1. D. Hargreaves’ scores grouped by dendrogram subclusters identified no statistical significance between groups. E. FST immobility scores grouped by dendrogram subclusters identified that C2 (p<0.0001) and C3 (p=0.0056) displayed significantly increased immobility time from C1, and that C2 displayed significantly increased immobility time from C3 (p=0.0005). F. SPT scores grouped by dendrogram subclusters identified that C2 (p=0.0321) and C3 (p=0.0004) displayed significantly decreased preference for sucrose from C1. G. C4–6 DH CD68 cell counts grouped by dendrogram subclusters identified that C2 displayed increased infiltrating macrophages when compared to C1 (p<0.0001) or C3 (p=0.0466). H. C7–8 ipsilateral DH CD68 cell counts grouped by dendrogram subclusters identified that C2 displayed increased infiltrating macrophages when compared to C3 (p=0.0066). I. Ipsilateral C7–8 DRG CD68 cell counts grouped by dendrogram subclusters identified that C2 displayed increased infiltrating macrophages when compared to C1 (p=0.0007) or C3 (p=0.0224). J. C7–8 ipsilateral DH IBA1 proportional area grouped by dendrogram subclusters identified that C2 displayed increased activated microglia when compared to C1 (p=0.0002). Statistics: Naïve (n=20), Sham (n=16), and SCI (n=27). A. Hierarchical cluster analysis completed in Rstudio (v4.1.1). C-J. Shapiro-Wilks test for normality. C, D, F-J. Kruskal Wallis test for group differences. Dunn’s multiple comparison test. E. One-way ANOVA. Tukey’s multiple comparison test. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001.

To further validate this analysis, PCA was conducted to identify the significant contributing variables to the subgroups. Results from the PCA determine that Principal Component 1 (PC1) accounted for 51.3% of the total variance. The variables included in PC1 were von Frey (loading coefficient: 0.808), Hargreaves’ (loading coefficient: 0.726), and FST immobility time (loading coefficient: −0.833), which are the most important tests for determining pain and depression-like phenotypes post-SCI, further validating the results from the HCA. Based on these findings, we will only utilize these three tests going forward to reduce the stress of behavioral testing on the mice without sacrificing statistical or clinical relevance. For immunohistochemical analysis, it will be important to determine these subgroups since there maybe be a correlation between immune cell infiltration/activation and behavioral phenotype.

To make more translationally relevant correlations between macrophage infiltration and behavioral deficits, we also evaluated immune cell response based on the behavioral clusters determined in Figure 6A rather than by experimental group. If we group the mice based on behaviors experienced, this may provide a better snapshot of the alterations associated with specific behaviors, rather than only being able to draw conclusions about the effects of SCI. Quantitatively, in the DH of the spinal cord, mice subgrouped into C2 exhibited statistically significant increases in CD68+ cells in the C4–6 DH (Figure 6G) when compared to C1 (p<0.0001) or C3 (p=0.0466) mice. Mice clustered into C2 displayed increased infiltrating macrophages in the ipsilaterally C7–8 DH (Figure 6H) when compared to C3 (p=0.0066). Similar analysis was conducted in the C7–8 ipsilateral DRGs (Figure 6I), where mice in C2 exhibited statistically significant increases in CD68+ cells when compared to C1 (p=0.0007) and C3 (p=0.0224) mice. This could indicate that increased infiltrating macrophages that accumulate in the DH or DRGs correlate with increased pain and depressive-like symptoms post-SCI.

When IBA1 data were plotted by clusters identified in the behavioral HCA, mice grouped into C2 displayed significant increases in IBA1 proportional area in the C4–6 (data not shown) ipsilateral dorsal horn when compared with C1 (p=0.0034) and C3 (p=0.0248) mice. Finally, in the C7–8 ipsilateral DHs (Figure 6J) C2 mice displayed more IBA1 proportional area when compared to C1 (p=0.0002) mice. In both C4–6 and C7–8 ipsilateral DHs, mice grouped into C2 displayed increased activated and/or phagocytic microglia, which could contribute to the increased pain and depressive-like symptoms observed in this group of mice. Since the lesion epicenter and secondary complications do not resolve spontaneously post-SCI, we can consider that the immune response post-SCI is not properly restricted, resulting in long term, systemic inflammation and subsequent or concurrent neuronal hyperexcitability that mediates chronic pain and depressive-like symptoms.

Discussion

While the C5 unilateral moderate contusion model has been extensively used for the study of ipsilesional forepaw pain55, 128, to the best of our knowledge, we provide the first demonstration of comorbid depression- and pain-like behaviors following a moderate C5 unilateral contusion. Using an unbiased and rigorous design, we showed that 59.3% of SCI (C2: 16/27) mice developed both pain and learned-helplessness behaviors, 29.6% (C1: 8/27) did not express either of these behaviors, and the remaining 11.1% (C3: 3/27) displayed anhedonia, but normal forepaw sensation. Terminal forced swim and MCAP testing validated the comorbidity of depression and pain at 6-weeks post-SCI. Moreover, these behaviors correspond to increased macrophage recruitment and microglial activation in the dorsal horn and DRGs associated with forepaw dermatomes as determined using transgenic reporter lines and immunocytochemical approaches. Notably, our findings are consistent with published studies using similar to mouse models in the reports of pain and depression73, 85, 99, 134, but dissimilar when examining differences between males and females34, 75, 85, 118. Importantly, the data presented here have strong face validity with what occurs in the clinical population post-SCI where approximately 60% of individuals develop chronic pain and comorbid mood dysfunction24, 33, 42, 109, 112 and individuals experiencing chronic pain and depression exhibit increased immune system activation. 4, 28, 91, 120, 146. How immune cell activation impacts neuronal excitability along the pain pathway is currently being examined in our laboratory.

One surprising finding from this study was that there were no sex-related differences in any behavioral tests or immunohistochemical analysis post-SCI. This is in direct contrast to human reports, where there is a noted difference in reported rates of both pain and depression between males and females, with females exhibiting higher rates of both pain and depression14, 41, 94, 115. While understanding the clinical prevalence and etiology of pain and depression is vital, pre-clinical research has identified many similarities and differences between humans and rodents post-trauma. Pre-clinical studies have examined sex differences post-SCI in mice identifying motor, physiological, immunological and behavioral differences between males and females. Sex differences in motor impairments have been reported in mouse SCI studies using the Basso Mouse Scale7, but the results vary where some report worse recovery in females85, while others report improved recovery in females compared to male mice34, 75. One study reports that rostral caudal lesion length could be smaller in female mice85 with no sex differences in contusion parameters. Another study reports that the inflammatory profile in young female mice may be more pronounced early post-SCI75, which may be related to the differences in lesion size when compared to male mice. Sex differences in pain-like behaviors post-SCI have not been reported in von Frey, Hargreaves’ or acetone test73, 85, 99, which is consistent with our findings of no sex differences in von Frey, Hargreaves’ and MCAP. Interestingly, differences in depressive-like behaviors have been reported in the tail suspension test but not the forced swim test post-SCI75, corresponding with our findings of no sex differences in the forced swim test. Importantly, these findings appear to be dependent on the contusion severity, contusion location, housing conditions, time of behavioral testing and age of the mouse34, 73, 75, 85, 99, 117, 118. While we did not find the sex of the mice to be a significant contributor to behavior or immune cell presence and likely activation state, it is possible that there are sub-cellular mechanistic differences due to hormonal or neurophysiological responses that the behavioral assessments utilized in this study were not sensitive enough to detect. Some studies have shown that female rodents can exhibit different behavioral profiles depending upon their phase of estrus17, 43, 70, 139, while other studies have identified little variation in behavioral phenotypes over the estrous cycle145. In the current study, we did not account for estrous cycle in our female mice at the time of SCI or throughout the post-injury period.

Additionally, depressive-like behaviors are usually tested chronically, making it difficult to determine the time course of development. Previous studies conducted in mice reported that mechanical allodynia can be determined as early as one week post-SCI, while increased immobility time in the forced swim test is only increased starting at 3 weeks post-SCI, indicating that the development of pain may precede the development of depression post-SCI in mice127. Additionally in the same study, anxiolytic behaviors were displayed at week 1, indicating that different modalities of mood dysfunction may develop at different timepoints post-SCI127. It is important to consider that most of these studies are using a thoracic contusion model, which has very different functional effects due to decreased spared white and grey matter bilaterally in the lesion epicenter compared to a unilateral cervical contusion model where one side is anatomically preserved. Another key difference between our work and published reports is that we limited the mouse’s exposure to aversive test environments like the MCAP and forced swim test to the final behavioral timepoint, while published work conducts weekly testing which can induce a stressed phenotype on the mouse over the course of the experiment23, 57, 127, 137.

A potential drawback to using the forced swim test in mice with incomplete cervical SCI is that they may have motor deficits that may impact the ability of the mouse to swim and thus confound test validity. In the forced swim test, mice are required to remain afloat in an inescapable pool of water for 6 minutes by using limb movements and trunk stability. While we did not conduct quantitative locomotor assessments (e.g., Basso Mouse Scale for locomotion7 or CatWalk53) on these mice post-SCI, we do qualitatively evaluate mice daily post-SCI. Twenty four hours post-SCI, the ipsilesional forepaw has a stereotypical clubbed appearance that resolves by 7-weeks post SCI when forced swim test is conducted. Additionally, the time that elapsed when the mouse was placed in the water until the first bout of floating, an indirect indicator of effort exerted or exhaustion revealed no differences between groups mice. This could indicate that chronically injured mice are not fatiguing at a faster rate than sham or naive mice. Instead, it may indicate that SCI mice are indeed demonstrating learned-helplessness behavior. Other studies using cortical lesions122, traumatic brain injury76 or SCI80 reported differences in forced swim immobility time that were not attributed to gross motor impairments.

Anhedonia was detected in mice with SCI compared with sham but not naïve mice. One explanation for this finding is that all mice were singly housed for the duration of the study, which in the absence of injury or other pathology, has been shown to induce depressive-like behaviors21, 78. When comparing our findings to other published reports, we noticed that our naïve mice drank similar ratios of sucrose to water (SPT Ratio: 0.80 ± 0.10 at 6 weeks) when compared to naïve mice from other experiments (~0.80 SPT ratio)32, 77, 119. This comparison further validates our findings, and suggests that there could be a plausible mechanism behind the modality specific development and variability observed in the naïve mice of depressive-like symptoms post-SCI.

Another interesting caveat is the relationship between repetitive behavioral testing, stress and the development of depressive-like, learned helplessness behaviors137. It could be a possibility that weekly pain testing could induce stress or mood dysregulation. Both von Frey and Hargreaves’ cause the mouse to withdraw their paws and induce supraspinally-mediated, aversive behaviors like licking or looking at the paw, moving away from the stimulus, or adaptive behaviors like guarding the injured forepaw or becoming hypervigilant of the stimulus, indicating the perception of a painful stimulus. Moreover, due to the weekly testing schedule pain tests were conducted on the same day with at least a 2-hour break between tests. Indeed, repetitive testing may cause the mice to become hypervigilant57 (heightened awareness of the surrounding environment) or induce a stress response23, 137. Additionally, the MCAP test may also impact depressive-like behaviors as it has some similar components to assessments of anxiety like the light-dark box test10. In both tests, mice avoid the brightly lit chambers, and avoidance of the brightly lit environments can be inferred as anxiety. Additional experiments using a genetic model of depression83 or stress-induced depression137 could parse out possible connections between pain regulation and mood dysfunction but are beyond the scope of the current experiments.

We used immunohistochemistry in the dorsal horn and DRGs corresponding to forepaw dermatomes to correlate myeloid cell recruitment with the development of pain-related and depressive-like behaviors after SCI. Following SCI, macrophage infiltration into the spinal cord and DRGs at the level of the lesion epicenter and below has been reported by our lab19, 28, as well as other labs50, 71, 86, 87, 101103, 141. By utilizing the transgenic LysM-eGFP mouse, and CD68 staining, we differentiated between infiltrating, monocyte-derived (LysM+ and CD68+) and resident tissue macrophages (LysM- and CD68+) post-SCI. Some studies report that CD68 is a pro-inflammatory macrophage marker9, 81, but most of these studies are conducted in clinical human research. CD68 (cluster of differentiation factor 68) is a protein highly expressed in monocyte-derived macrophages129, and it has been classically used as a macrophage marker in normal and injury conditions98. In multiple tissue types, CD68 can be used to identify tissue macrophages in naïve and injured mice20, 61, 98, 121, 130. We utilized an unbiased clustering approach to make our immunohistochemical findings more robust, by directly comparing them with sensory discriminative and depressive-like pain behaviors measured chronically. Interestingly, C7–8 DRG and dorsal horn that receives sensory information from forepaw dermatomes13, 108, 126 exhibited increased macrophage presence and microglial activation in C7–8 DH, and this increase correlated with increased forepaw hypersensitivity and the emergence of depressive-like symptoms. Importantly, increased numbers of CD68+ and Iba1+ macrophages and microglia does not directly address their activation state. Shortly after SCI, macrophages and microglia are predominantly pro-inflammatory, affecting secondary tissue damage and recruiting more immune cells to the lesion epicenter18, 45, 56, 95, 106. The temporal control of cytokine release and phagocytic activities may not be appropriately regulated following SCI. Additionally, the role of macrophages and microglia is still debated, with some studies associating these immune cells with the development of pain19, 67, 140, 143, while others with the resolution of pain6, 25, 92, 123, 133. In many of these studies, the inflammatory profile and time post-injury are important factors to consider when attempting to correlate macrophages and microglia with pain development.

A fundamental question that remains is how the immune cell response interacts with neurons to produce behavioral changes. In our study, we identified increased CD206 mRNA at 6-weeks post-SCI in SCI mice when compared to sham and naïve mice. This indicates that anti-inflammatory macrophages are present in the DRGs at 6-weeks post-SCI, but the variability of increased iNos, TNFa and CD32 mRNA expression demonstrates that there are persistent pro-inflammatory signals chronically after SCI. Depending on the inflammatory profile, these immune cells can have diverse effects on the local neuronal circuitry49, 62, 107. Inflammatory cytokines secreted from macrophages and microglia have been demonstrated to directly modulate intrinsic properties of neurons, causing ectopic firing and hyperactivity of primary nociceptors, features that have been correlated with the development of chronic neuropathic pain8, 18, 51. Additionally, some of the cytokines and general immune cell markers correlated with depressive-like behaviors. While these behaviors are cortically mediated, it has been shown that injuries to the CNS8, 14, 51, immune cell activation52, 144, local cytokine expression18, 64, electrical stimulation144, and even sham surgeries96 can cause subsequent hyperexcitability and/or aberrant immune system activation along the sensory-neuroaxis. Thus, it is possible that increased macrophages infiltrating the spinal cord could cause increased excitability and ectopic firing of primary nociceptors and second order neurons in the DH, which in turn causes and overall hyperexcitability of ascending tracts. This hypothesis remains to be tested and precise characterization of macrophage polarization states via single-cell RNA-seq is necessary to better understand the neuroimmune interactions that mediate pain-related and depressive-like behaviors following SCI.

In summary, we found that the moderate unilateral C5 contusion is model of trauma induced pain-related and depressive-like behaviors in LysM-eGFP mice. The pain development and depression prevalence accurately represented the overall prevalence of these disorders in the clinical SCI population, however sex differences and specifiers of depression varied between mice and humans. In addition, the microglial activation and macrophage infiltration both were consistent with what is observed in other animal models and humans following SCI28, 102, 141. Further analysis of the electrophysiological properties and cytokine analysis will be important to identify specific markers for pain and depression comorbidities. If we identify a pathophysiological explanation for the development of pain and depression, we could help to eliminate the stigmas associated with these subjective experiences and expand the treatment options for suffering individuals. Understanding how microglia and macrophages interact to alter the central nervous system following trauma is vital to better characterization of these disorders independently, and identifying common mechanisms could open the doors for off-label treatments that could ameliorate comorbid pain and depression following traumatic injury.

Supplementary Material

1

Highlights:

  • Mechanical and thermal pain-like behavior develops as early as 1-week and persists post-SCI.

  • Depressive-like symptoms can be detected at 6-weeks post-SCI.

  • Macrophages infiltrate the DRG and spinal cord post-SCI, correlating with pain and mood dysfunction.

Perspective.

These experiments characterized pain-related and depressive-like behaviors and correlated these changes with the immune response post-SCI. While humanizing the rodent is impossible, the results from this study inform clinical literature to closely examine sex-differences reported in humans to better understand the underlying shared etiologies of pain and depressive-like behaviors following CNS trauma.

ACKNOWLEDGEMENTS:

We gratefully acknowledge Ms. Meredith A. Singer, MS for her assistance with genotyping, animal care and sucrose preference testing.

Funding:

This work was supported by the National Institutes of Health National Institute of Neurological Disorders and Stroke R01 #NS097880 and an administrative supplement from the Help End Addiction Longterm (H.E.A.L.) Initiative, both awarded to M.R.D.

Footnotes

CONFLICTS OF INTEREST: The authors have no conflicts of interest.

DISCLOSURES

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

REFERENCES

  • 1.Abbadie C, Lindia JA, Cumiskey AM, et al. Impaired neuropathic pain responses in mice lacking the chemokine receptor CCR2. Proceedings of the National Academy of Sciences. 100:7947–7952, 2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Abdelhamid RE, Kovács KJ, Nunez MG, Larson AA. Depressive behavior in the forced swim test can be induced by TRPV1 receptor activity and is dependent on NMDA receptors. Pharmacological Research. 79:21–27, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Akopian AN, Souslova V, England S, et al. The tetrodotoxin-resistant sodium channel SNS has a specialized function in pain pathways. Nature Neuroscience. 2:541–548, 1999 [DOI] [PubMed] [Google Scholar]
  • 4.Anand A, Li Y, Wang Y, et al. Activity and Connectivity of Brain Mood Regulating Circuit in Depression: A Functional Magnetic Resonance Study. Biological Psychiatry. 57:1079–1088, 2005 [DOI] [PubMed] [Google Scholar]
  • 5.Austin PJ, Berglund AM, Siu S, et al. Evidence for a distinct neuro-immune signature in rats that develop behavioural disability after nerve injury. Journal of Neuroinflammation. 12:96, 2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bang S, Xie Y-K, Zhang Z-J, Wang Z, Xu Z-Z, Ji R-R. GPR37 regulates macrophage phagocytosis and resolution of inflammatory pain. The Journal of Clinical Investigation. 128:3568–3582, 2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Basso DM, Fisher LC, Anderson AJ, Jakeman LB, McTigue DM, Popovich PG. Basso Mouse Scale for Locomotion Detects Differences in Recovery after Spinal Cord Injury in Five Common Mouse Strains. Journal of Neurotrauma. 23:635–659, 2006 [DOI] [PubMed] [Google Scholar]
  • 8.Bedi SS, Yang Q, Crook RJ, et al. Chronic Spontaneous Activity Generated in the Somata of Primary Nociceptors Is Associated with Pain-Related Behavior after Spinal Cord Injury. The Journal of Neuroscience. 30:14870–14882, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Berger S, Ceccarini G, Scabia G, et al. Lipodystrophy and obesity are associated with decreased number of T cells with regulatory function and pro-inflammatory macrophage phenotype. International Journal of Obesity. 41:1676–1684, 2017 [DOI] [PubMed] [Google Scholar]
  • 10.Bourin M, Hascoët M. The mouse light/dark box test. European Journal of Pharmacology. 463:55–65, 2003 [DOI] [PubMed] [Google Scholar]
  • 11.Burke D, Fullen BM, Stokes D, Lennon O. Neuropathic pain prevalence following spinal cord injury: A systematic review and meta-analysis. European Journal of Pain. 21:29–44, 2017 [DOI] [PubMed] [Google Scholar]
  • 12.Burns MJ, Nixon GJ, Foy CA, Harris N. Standardisation of data from real-time quantitative PCR methods – evaluation of outliers and comparison of calibration curves. BMC Biotechnology. 5:31, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Buskbjerg Jager S, Ronchi G, Bjerggaard Vaegter C, Geuna S. The Mouse Median Nerve Experimental Model in Regenerative Research. BioMed Research International. 2014:701682, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cairns BE, Gazerani P. Sex-related differences in pain. Maturitas. 63:292–296, 2009 [DOI] [PubMed] [Google Scholar]
  • 15.Can A, Dao DT, Arad M, Terrillion CE, Piantadosi SC, Gould TD. The Mouse Forced Swim Test. JoVE.e3638, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL. Quantitative assessment of tactile allodynia in the rat paw. Journal of Neuroscience Methods. 53:55–63, 1994 [DOI] [PubMed] [Google Scholar]
  • 17.Chari T, Griswold S, Andrews NA, Fagiolini M. The Stage of the Estrus Cycle Is Critical for Interpretation of Female Mouse Social Interaction Behavior. Frontiers in Behavioral Neuroscience. 14:1–9, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chen O, Donnelly CR, Ji R-R. Regulation of pain by neuro-immune interactions between macrophages and nociceptor sensory neurons. Current Opinion in Neurobiology. 62:17–25, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chhaya SJ, Quiros-Molina D, Tamashiro-Orrego AD, Houlé JD, Detloff MR. Exercise-Induced Changes to the Macrophage Response in the Dorsal Root Ganglia Prevent Neuropathic Pain after Spinal Cord Injury. Journal of Neurotrauma. 36:877–890, 2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Choi E-J, Chen W, Jun K, Arthur HM, Young WL, Su H. Novel Brain Arteriovenous Malformation Mouse Models for Type 1 Hereditary Hemorrhagic Telangiectasia. PLOS ONE. 9:e88511, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chourbaji S, Zacher C, Sanchis-Segura C, Spanagel R, Gass P. Social and structural housing conditions influence the development of a depressive-like phenotype in the learned helplessness paradigm in male mice. Behavioural Brain Research. 164:100–106, 2005 [DOI] [PubMed] [Google Scholar]
  • 22.Church JS, Kigerl KA, Lerch JK, Popovich PG, McTigue DM. TLR4 Deficiency Impairs Oligodendrocyte Formation in the Injured Spinal Cord. The Journal of Neuroscience. 36:6352–6364, 2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cnops V, Iyer VR, Parathy N, Wong P, Dawe GS. Test, rinse, repeat: A review of carryover effects in rodent behavioral assays. Neuroscience & Biobehavioral Reviews. 135:104560, 2022 [DOI] [PubMed] [Google Scholar]
  • 24.Craig AR, Hancock KM, Dickson HG. A longitudinal investigation into anxiety and depression in the first 2 years following a spinal cord injury. Spinal Cord. 32:675–679, 1994 [DOI] [PubMed] [Google Scholar]
  • 25.da Silva MD, Bobinski F, Sato KL, Kolker SJ, Sluka KA, Santos ARS. IL-10 Cytokine Released from M2 Macrophages Is Crucial for Analgesic and Anti-inflammatory Effects of Acupuncture in a Model of Inflammatory Muscle Pain. Molecular Neurobiology. 51:19–31, 2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Detloff MR, Fisher LC, McGaughy V, Longbrake EE, Popovich PG, Basso DM. Remote activation of microglia and pro-inflammatory cytokines predict the onset and severity of below-level neuropathic pain after spinal cord injury in rats. Experimental Neurology. 212:337–347, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Detloff MR, Smith EJ, Quiros Molina D, Ganzer PD, Houlé JD. Acute exercise prevents the development of neuropathic pain and the sprouting of non-peptidergic (GDNF- and artemin-responsive) c-fibers after spinal cord injury. Experimental Neurology. 255:38–48, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Detloff MR, Wade RE, Houlé JD. Chronic At- and Below-Level Pain after Moderate Unilateral Cervical Spinal Cord Contusion in Rats. Journal of Neurotrauma. 30:884–890, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dijkstra CD, Damoiseaux JG. Macrophage heterogeneity established by immunocytochemistry. Prog Histochem Cytochem. 27:1–65, 1993 [DOI] [PubMed] [Google Scholar]
  • 30.Dixon WJ. The Up-and-Down Method for Small Samples. Journal of the American Statistical Association. 60:967–978, 1965 [Google Scholar]
  • 31.Dubový P, Jančálek R, Klusáková I, Svíženská I, Pejchalová K. Intra- and Extraneuronal Changes of Immunofluorescence Staining for TNF- and TNFR1 in the Dorsal Root Ganglia of Rat Peripheral Neuropathic Pain Models. Cellular and Molecular Neurobiology. 26:1203–1215, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Eagle AL, Mazei-Robison M, Robison AJ. Sucrose Preference Test to Measure Stress-induced Anhedonia. Bio-protocol. 6:e1822, 2016 [Google Scholar]
  • 33.Fann JR, Bombardier CH, Richards JS, Tate DG, Wilson CS, Temkin N. Depression After Spinal Cord Injury: Comorbidities, Mental Health Service Use, and Adequacy of Treatment. Archives of Physical Medicine and Rehabilitation. 92:352–360, 2011 [DOI] [PubMed] [Google Scholar]
  • 34.Farooque M, Suo Z, Arnold PM, et al. Gender-related differences in recovery of locomotor function after spinal cord injury in mice. Spinal Cord. 44:182–187, 2006 [DOI] [PubMed] [Google Scholar]
  • 35.Farrell K, Houle JD. Systemic Inhibition of Soluble Tumor Necrosis Factor with XPro1595 Exacerbates a Post-Spinal Cord Injury Depressive Phenotype in Female Rats. Journal of Neurotrauma. 36:2964–2976, 2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Faust N, Varas F, Kelly LM, Heck S, Graf T. Insertion of enhanced green fluorescent protein into the lysozyme gene creates mice with green fluorescent granulocytes and macrophages. Blood. 96:719–726, 2000 [PubMed] [Google Scholar]
  • 37.Fenrich KK, Weber P, Rougon G, Debarbieux F. Long- and short-term intravital imaging reveals differential spatiotemporal recruitment and function of myelomonocytic cells after spinal cord injury. The Journal of Physiology. 591:4895–4902, 2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Flaishon L, Becker-Herman S, Hart G, Levo Y, Kuziel WA, Shachar I. Expression of the chemokine receptor CCR2 on immature B cells negatively regulates their cytoskeletal rearrangement and migration. Blood. 104:933–941, 2004 [DOI] [PubMed] [Google Scholar]
  • 39.Gaffney CM, Muwanga G, Shen H, Tawfik VL, Shepherd AJ. Mechanical Conflict-Avoidance Assay to Measure Pain Behavior in Mice. JoVEe63454, 2022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.García-Fiñana M, Cruz-Orive LM, Mackay CE, Pakkenberg B, Roberts N. Comparison of MR imaging against physical sectioning to estimate the volume of human cerebral compartments. NeuroImage. 18:505–516, 2003 [DOI] [PubMed] [Google Scholar]
  • 41.Garnefski N, Teerds J, Kraaij V, Legerstee J, van den Kommer T. Cognitive emotion regulation strategies and depressive symptoms: differences between males and females. Personality and Individual Differences. 36:267–276, 2004 [Google Scholar]
  • 42.Gereau RW, Sluka KA, Maixner W, et al. A Pain Research Agenda for the 21st Century. The Journal of Pain. 15:1203–1214, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Giacometti LL, Buck LA, Barker JM. Estrous cycle and hormone regulation of stress-induced reinstatement of reward seeking in female mice. Addiction Neuroscience. 4:100035, 2022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Gong H, Sun L, Chen B, et al. Evaluation of candidate reference genes for RT-qPCR studies in three metabolism related tissues of mice after caloric restriction. Scientific Reports. 6:38513, 2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Gordon S, Taylor PR. Monocyte and macrophage heterogeneity. Nature Reviews Immunology. 5:953–964, 2005 [DOI] [PubMed] [Google Scholar]
  • 46.Greenhalgh AD, David S. Differences in the Phagocytic Response of Microglia and Peripheral Macrophages after Spinal Cord Injury and Its Effects on Cell Death. The Journal of Neuroscience. 34:6316–6322, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Gruner JA, Altman J. Swimming in the rat: Analysis of locomotor performance in comparison to stepping. Experimental Brain Research. 40:374–382, 1980 [DOI] [PubMed] [Google Scholar]
  • 48.Gundersen HJG, Jensen EBV, Kieu K, Nielsen J. The efficiency of systematic sampling in stereology — reconsidered. Journal of Microscopy. 193:199–211, 1999 [DOI] [PubMed] [Google Scholar]
  • 49.Habbas S, Santello M, Becker D, et al. Neuroinflammatory TNFα Impairs Memory via Astrocyte Signaling. Cell. 163:1730–1741, 2015 [DOI] [PubMed] [Google Scholar]
  • 50.Hackett AR, Lee JK. Understanding the NG2 Glial Scar after Spinal Cord Injury. Frontiers in Neurology. 7:1–10, 2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Hains BC, Saab CY, Waxman SG. Changes in electrophysiological properties and sodium channel Nav1.3 expression in thalamic neurons after spinal cord injury. Brain. 128:2359–2371, 2005 [DOI] [PubMed] [Google Scholar]
  • 52.Hains BC, Waxman SG. Activated Microglia Contribute to the Maintenance of Chronic Pain after Spinal Cord Injury. The Journal of Neuroscience. 26:4308–4317, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Hamers FPT, Koopmans GC, Joosten EAJ. CatWalk-Assisted Gait Analysis in the Assessment of Spinal Cord Injury. Journal of Neurotrauma. 23:537–548, 2006 [DOI] [PubMed] [Google Scholar]
  • 54.Hargreaves K, Dubner R, Brown F, Flores C, Joris J. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain. 32:77–88, 1988 [DOI] [PubMed] [Google Scholar]
  • 55.Heinsinger NM, Spagnuolo G, Allahyari RV, et al. Facial grimace testing as an assay of neuropathic pain-related behavior in a mouse model of cervical spinal cord injury. Experimental Neurology. 334:113468, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Hesketh M, Sahin KB, West ZE, Murray RZ. Macrophage Phenotypes Regulate Scar Formation and Chronic Wound Healing. International Journal of Molecular Sciences. 18:1545, 2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Hollins M, Athans L. Perceptual amplification following sustained attention: implications for hypervigilance. Experimental Brain Research. 239:279–288, 2021 [DOI] [PubMed] [Google Scholar]
  • 58.Hu P, Bembrick AL, Keay KA, McLachlan EM. Immune cell involvement in dorsal root ganglia and spinal cord after chronic constriction or transection of the rat sciatic nerve. Brain, Behavior, and Immunity. 21:599–616, 2007 [DOI] [PubMed] [Google Scholar]
  • 59.Huck NA, Siliezar-Doyle J, Haight ES, et al. Temporal Contribution of Myeloid-Lineage TLR4 to the Transition to Chronic Pain: A Focus on Sex Differences. The Journal of Neuroscience. 41:4349–4365, 2021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Hunt C, Moman R, Peterson A, et al. Prevalence of chronic pain after spinal cord injury: a systematic review and meta-analysis. Regional Anesthesia & Pain Medicine. 46:328–336, 2021 [DOI] [PubMed] [Google Scholar]
  • 61.Ikarashi M, Nakashima H, Kinoshita M, et al. Distinct development and functions of resident and recruited liver Kupffer cells/macrophages. Journal of Leukocyte Biology. 94:1325–1336, 2013 [DOI] [PubMed] [Google Scholar]
  • 62.Imamura Y, Wang H, Matsumoto N, et al. Interleukin-1β causes long-term potentiation deficiency in a mouse model of septic encephalopathy. Neuroscience. 187:63–69, 2011 [DOI] [PubMed] [Google Scholar]
  • 63.Jaiswal S, Brabazon F, von Leden R, et al. Spinal cord injury chronically depresses glucose uptake in the rodent model. Neuroscience Letters. 771:136416, 2022 [DOI] [PubMed] [Google Scholar]
  • 64.Jung H, Toth PT, White FA, Miller RJ. Monocyte chemoattractant protein-1 functions as a neuromodulator in dorsal root ganglia neurons. Journal of Neurochemistry. 104:254–263, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Kanamori H, Matsubara T, Mima A, et al. Inhibition of MCP-1/CCR2 pathway ameliorates the development of diabetic nephropathy. Biochemical and Biophysical Research Communications. 360:772–777, 2007 [DOI] [PubMed] [Google Scholar]
  • 66.Kawaguchi-Niida M, Yamamoto T, Kato Y, Inose Y, Shibata N. MCP-1/CCR2 signaling-mediated astrocytosis is accelerated in a transgenic mouse model of SOD1-mutated familial ALS. Acta Neuropathologica Communications. 1:21, 2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Kiguchi N, Kobayashi D, Saika F, Matsuzaki S, Kishioka S. Pharmacological Regulation of Neuropathic Pain Driven by Inflammatory Macrophages. International Journal of Molecular Sciences. 18:2296, 2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Kim D-H, Sandoval D, Reed JA, et al. The role of GM-CSF in adipose tissue inflammation. American Journal of Physiology-Endocrinology and Metabolism. 295:E1038–E1046, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Kim D, Schallert T, Liu Y, et al. Transplantation of Genetically Modified Fibroblasts Expressing BDNF in Adult Rats with a Subtotal Hemisection Improves Specific Motor and Sensory Functions. Neurorehabilitation and Neural Repair. 15:141–150, 2001 [DOI] [PubMed] [Google Scholar]
  • 70.Kim HJJ, Zagzoog A, Black T, Baccetto SL, Ezeaka UC, Laprairie RB. Impact of the mouse estrus cycle on cannabinoid receptor agonist-induced molecular and behavioral outcomes. Pharmacology Research & Perspectives. 10:e00950, 2022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Kroner A, Rosas Almanza J. Role of microglia in spinal cord injury. Neuroscience Letters. 709:134370, 2019 [DOI] [PubMed] [Google Scholar]
  • 72.Lau D, Harte SE, Morrow TJ, Wang S, Mata M, Fink DJ. Herpes Simplex Virus Vector–Mediated Expression of Interleukin-10 Reduces Below-Level Central Neuropathic Pain After Spinal Cord Injury. Neurorehabilitation and Neural Repair. 26:889–897, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Lee SE, Greenough EK, Oancea P, Scheinfeld AR, Douglas AM, Gaudet AD. Sex Differences in Pain: Spinal Cord Injury in Female and Male Mice Elicits Behaviors Related to Neuropathic Pain. Journal of Neurotrauma. 40:833–844, 2023 [DOI] [PubMed] [Google Scholar]
  • 74.Li X-m, Meng J, Li Lt, et al. Effect of ZBD-2 on chronic pain, depressive-like behaviors, and recovery of motor function following spinal cord injury in mice. Behavioural Brain Research. 322:92–99, 2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Li Y, Ritzel RM, Lei Z, et al. Sexual dimorphism in neurological function after SCI is associated with disrupted neuroinflammation in both injured spinal cord and brain. Brain, Behavior, and Immunity. 101:1–22, 2022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Lim S-W, Sung K-C, Shiue Y-L, Wang C-C, Chio C-C, Kuo J-R. Hyperbaric Oxygen Effects on Depression-Like Behavior and Neuroinflammation in Traumatic Brain Injury Rats. World Neurosurgery. 100:128–137, 2017 [DOI] [PubMed] [Google Scholar]
  • 77.Liu M-Y, Yin C-Y, Zhu L-J, et al. Sucrose preference test for measurement of stress-induced anhedonia in mice. Nature Protocols. 13:1686–1698, 2018 [DOI] [PubMed] [Google Scholar]
  • 78.Liu N, Wang Y, An AY, Banker C, Qian Y-H, O’Donnell JM. Single housing-induced effects on cognitive impairment and depression-like behavior in male and female mice involve neuroplasticity-related signaling. European Journal of Neuroscience. 52:2694–2704, 2020 [DOI] [PubMed] [Google Scholar]
  • 79.Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 25:402–408, 2001 [DOI] [PubMed] [Google Scholar]
  • 80.Luedtke K, Bouchard SM, Woller SA, Funk MK, Aceves M, Hook MA. Assessment of Depression in a Rodent Model of Spinal Cord Injury. Journal of Neurotrauma. 31:1107–1121, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Manferdini C, Paolella F, Gabusi E, et al. Adipose stromal cells mediated switching of the pro-inflammatory profile of M1-like macrophages is facilitated by PGE2: in vitro evaluation. Osteoarthritis and Cartilage. 25:1161–1171, 2017 [DOI] [PubMed] [Google Scholar]
  • 82.Manuelpillai U, Lourensz D, Vaghjiani V, et al. Human Amniotic Epithelial Cell Transplantation Induces Markers of Alternative Macrophage Activation and Reduces Established Hepatic Fibrosis. PLOS ONE. 7:e38631, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Massart R, Mongeau R, Lanfumey L. Beyond the monoaminergic hypothesis: neuroplasticity and epigenetic changes in a transgenic mouse model of depression. Philosophical Transactions of the Royal Society B: Biological Sciences. 367:2485–2494, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Mawhinney LA, Thawer SG, Lu W-Y, et al. Differential Detection and Distribution of Microglial and Hematogenous Macrophage Populations in the Injured Spinal Cord of lys-EGFP-ki Transgenic Mice. Journal of Neuropathology & Experimental Neurology. 71:180–197, 2012 [DOI] [PubMed] [Google Scholar]
  • 85.McFarlane K, Otto TE, Bailey WM, et al. Effect of Sex on Motor Function, Lesion Size, and Neuropathic Pain after Contusion Spinal Cord Injury in Mice. Journal of Neurotrauma. 37:1983–1990, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.McKay SM, McLachlan EM. Inflammation of rat dorsal root ganglia below a mid-thoracic spinal transection. Neuroreport. 15:1783–1786, 2004 [DOI] [PubMed] [Google Scholar]
  • 87.McTigue DM, Tani M, Krivacic K, et al. Selective chemokine mRNA accumulation in the rat spinal cord after contusion injury. Journal of Neuroscience Research. 53:368–376, 1998 [DOI] [PubMed] [Google Scholar]
  • 88.Melzack R, Wall PD. Pain Mechanisms: A New Theory. Science. 150:971–979, 1965 [DOI] [PubMed] [Google Scholar]
  • 89.Miao L, Qi J, Zhao Q, et al. Targeting the STING pathway in tumor-associated macrophages regulates innate immune sensing of gastric cancer cells. Theranostics. 10:498–515, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Minett MS, Eijkelkamp N, Wood JN. Significant Determinants of Mouse Pain Behaviour. PLOS ONE. 9:e104458, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Miyamoto K, Kume K, Ohsawa M. Role of microglia in mechanical allodynia in the anterior cingulate cortex. Journal of Pharmacological Sciences. 134:158–165, 2017 [DOI] [PubMed] [Google Scholar]
  • 92.Montague K, Malcangio M. The Therapeutic Potential of Monocyte/Macrophage Manipulation in the Treatment of Chemotherapy-Induced Painful Neuropathy. Frontiers in Molecular Neuroscience. 10:1–8, 2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Neely GG, Hess A, Costigan M, et al. A Genome-wide Drosophila Screen for Heat Nociception Identifies α2δ3 as an Evolutionarily Conserved Pain Gene. Cell. 143:628–638, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Nolen-Hoeksema S. Sex differences in unipolar depression: Evidence and theory. Psychological Bulletin. 101:259–282, 1987 [PubMed] [Google Scholar]
  • 95.Novak ML, Koh TJ. Macrophage phenotypes during tissue repair. Journal of Leukocyte Biology. 93:875–881, 2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Odem MA, Lacagnina MJ, Katzen SL, et al. Sham surgeries for central and peripheral neural injuries persistently enhance pain-avoidance behavior as revealed by an operant conflict test. PAIN. 160:2440–2455, 2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Oh SB, Tran PB, Gillard SE, Hurley RW, Hammond DL, Miller RJ. Chemokines and Glycoprotein120 Produce Pain Hypersensitivity by Directly Exciting Primary Nociceptive Neurons. The Journal of Neuroscience. 21:5027–5035, 2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Papaneophytou CP, Georgiou E, Karaiskos C, et al. Regulatory role of oligodendrocyte gap junctions in inflammatory demyelination. Glia. 66:2589–2603, 2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Park A, Uddin O, Li Y, Masri R, Keller A. Pain After Spinal Cord Injury Is Associated With Abnormal Presynaptic Inhibition in the Posterior Nucleus of the Thalamus. The Journal of Pain. 19:727.e721-727.e715, 2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Peng J-K, Lin J-S, Kung JT, Finkelman FD, Wu-Hsieh BA. The combined effect of IL-4 and IL-10 suppresses the generation of, but does not change the polarity of, type-1 T cells in Histoplasma infection. International Immunology. 17:193–205, 2005 [DOI] [PubMed] [Google Scholar]
  • 101.Popovich PG: Immunological regulation of neuronal degeneration and regeneration in the injured spinal cord. In: Progress in Brain Research, Elsevier, 2000, pp. 43–58. [DOI] [PubMed] [Google Scholar]
  • 102.Popovich PG, Hickey WF. Bone Marrow Chimeric Rats Reveal the Unique Distribution of Resident and Recruited Macrophages in the Contused Rat Spinal Cord. Journal of Neuropathology & Experimental Neurology. 60:676–685, 2001 [DOI] [PubMed] [Google Scholar]
  • 103.Popovich PG, Wei P, Stokes BT. Cellular inflammatory response after spinal cord injury in sprague-dawley and lewis rats. Journal of Comparative Neurology. 377:443–464, 1997 [DOI] [PubMed] [Google Scholar]
  • 104.Porsolt RD, Bertin A, Jalfre M. Behavioral despair in mice: a primary screening test for antidepressants. Arch Int Pharmacodyn Ther. 229:327–336, 1977 [PubMed] [Google Scholar]
  • 105.Rainville P, Duncan GH, Price DD, Carrier, Bushnell MC. Pain Affect Encoded in Human Anterior Cingulate But Not Somatosensory Cortex. Science. 277:968–971, 1997 [DOI] [PubMed] [Google Scholar]
  • 106.Ransohoff RM, Cardona AE. The myeloid cells of the central nervous system parenchyma. Nature. 468:253–262, 2010 [DOI] [PubMed] [Google Scholar]
  • 107.Ross FM, Allan SM, Rothwell NJ, Verkhratsky A. A dual role for interleukin-1 in LTP in mouse hippocampal slices. Journal of Neuroimmunology. 144:61–67, 2003 [DOI] [PubMed] [Google Scholar]
  • 108.Ross JL, Queme LF, Shank AT, Hudgins RC, Jankowski MP. Sensitization of Group III and IV Muscle Afferents in the Mouse After Ischemia and Reperfusion Injury. The Journal of Pain. 15:1257–1270, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Saurí J, Chamarro A, Gilabert A, et al. Depression in Individuals With Traumatic and Nontraumatic Spinal Cord Injury Living in the Community. Archives of Physical Medicine and Rehabilitation. 98:1165–1173, 2017 [DOI] [PubMed] [Google Scholar]
  • 110.Sawicki KT, Chang HC, Shapiro JS, et al. Hepatic tristetraprolin promotes insulin resistance through RNA destabilization of FGF21. JCI Insight. 3:1–16, 2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111.Scheff SW, Rabchevsky AG, Fugaccia I, Main JA, Lumpp JE. Experimental Modeling of Spinal Cord Injury: Characterization of a Force-Defined Injury Device. Journal of Neurotrauma. 20:179–193, 2003 [DOI] [PubMed] [Google Scholar]
  • 112.Sheng J, Liu S, Wang Y, Cui R, Zhang X. The Link between Depression and Chronic Pain: Neural Mechanisms in the Brain. Neural Plasticity. 2017:9724371, 2017 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Shepherd AJ, Mohapatra DP. Pharmacological validation of voluntary gait and mechanical sensitivity assays associated with inflammatory and neuropathic pain in mice. Neuropharmacology. 130:18–29, 2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 114.Singh A, Tetreault L, Kalsi-Ryan S, Nouri A, Fehlings MG. Global prevalence and incidence of traumatic spinal cord injury. Clinical Epidemiology. 6:309–331, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Sorge RE, Totsch SK. Sex Differences in Pain. Journal of Neuroscience Research. 95:1271–1281, 2017 [DOI] [PubMed] [Google Scholar]
  • 116.Steen PW, Shi L, He L, McCluskey LP. Neutrophil responses to injury or inflammation impair peripheral gustatory function. Neuroscience. 167:894–908, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Stewart AN, Lowe JL, Glaser EP, et al. Acute inflammatory profiles differ with sex and age after spinal cord injury. Journal of Neuroinflammation. 18:1–16, 2021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 118.Stewart AN, MacLean SM, Stromberg AJ, et al. Considerations for Studying Sex as a Biological Variable in Spinal Cord Injury. Frontiers in Neurology. 11:1–17, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Strekalova T, Gorenkova N, Schunk E, Dolgov O, Bartsch D. Selective effects of citalopram in a mouse model of stress-induced anhedonia with a control for chronic stress. Behavioural Pharmacology. 17:271–287, 2006 [DOI] [PubMed] [Google Scholar]
  • 120.Sumpton JE, Moulin DE. Treatment of Neuropathic Pain with Venlafaxine. Annals of Pharmacotherapy. 35:557–559, 2001 [DOI] [PubMed] [Google Scholar]
  • 121.Sun D, Martinez CO, Ochoa O, et al. Bone marrow-derived cell regulation of skeletal muscle regeneration. Faseb j. 23:382–395, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Thornton EW, Bradbury GE, Davies C. Increased immobility in an automated forced swimming test following lesion of the habenula in rats: Absence of evidence for a contribution from motor impairment. Behavioral Neuroscience. 104:37–43, 1990 [DOI] [PubMed] [Google Scholar]
  • 123.Tonello R, Xie W, Lee SH, et al. Local Sympathectomy Promotes Anti-inflammatory Responses and Relief of Paclitaxel-induced Mechanical and Cold Allodynia in Mice. Anesthesiology. 132:1540–1553, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Torres-Espín A, Chou A, Huie JR, Kyritsis N, Upadhyayula PS, Ferguson AR. Reproducible analysis of disease space via principal components using the novel R package syndRomics. eLife. 10:e61812, 2021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 125.Ullrich PM, Lincoln RK, Tackett MJ, Miskevics S, Smith BM, Weaver FM. Pain, depression, and health care utilization over time after spinal cord injury. Rehabilitation Psychology. 58:158–165, 2013 [DOI] [PubMed] [Google Scholar]
  • 126.Walcher J, Ojeda-Alonso J, Haseleu J, et al. Specialized mechanoreceptor systems in rodent glabrous skin. The Journal of Physiology. 596:4995–5016, 2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 127.Wang C, Chen R, Zhu X, Zhang X. Suberoylanilide Hydroxamic Acid Ameliorates Pain Sensitization in Central Neuropathic Pain After Spinal Cord Injury via the HDAC5/NEDD4/SCN9A Axis. Neurochemical Research. 48:2436–2450, 2023 [DOI] [PubMed] [Google Scholar]
  • 128.Watson JL, Hala TJ, Putatunda R, Sannie D, Lepore AC. Persistent At-Level Thermal Hyperalgesia and Tactile Allodynia Accompany Chronic Neuronal and Astrocyte Activation in Superficial Dorsal Horn following Mouse Cervical Contusion Spinal Cord Injury. PLOS ONE. 9:e109099, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.Wei Q, Deng Y, Yang Q, Zhan A, Wang L. The markers to delineate different phenotypes of macrophages related to metabolic disorders. Frontiers in Immunology. 14:1–9, 2023 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 130.West EL, Pearson RA, Barker SE, et al. Long-Term Survival of Photoreceptors Transplanted into the Adult Murine Neural Retina Requires Immune Modulation. Stem Cells. 28:1997–2007, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 131.White FA, Bhangoo SK, Miller RJ. Chemokines: Integrators of Pain and Inflammation. Nature Reviews Drug Discovery. 4:834–844, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 132.White FA, Sun J, Waters SM, et al. Excitatory monocyte chemoattractant protein-1 signaling is up-regulated in sensory neurons after chronic compression of the dorsal root ganglion. Proceedings of the National Academy of Sciences. 102:14092–14097, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 133.Willemen HLDM, Eijkelkamp N, Garza Carbajal A, et al. Monocytes/Macrophages Control Resolution of Transient Inflammatory Pain. The Journal of Pain. 15:496–506, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 134.Wu J, Zhao Z, Kumar A, et al. Endoplasmic Reticulum Stress and Disrupted Neurogenesis in the Brain Are Associated with Cognitive Impairment and Depressive-Like Behavior after Spinal Cord Injury. Journal of Neurotrauma. 33:1919–1935, 2016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 135.Wu J, Zhao Z, Sabirzhanov B, et al. Spinal Cord Injury Causes Brain Inflammation Associated with Cognitive and Affective Changes: Role of Cell Cycle Pathways. The Journal of Neuroscience. 34:10989–11006, 2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 136.Wu X, Cao L, Li F, Ma C, Liu G, Wang Q. Interleukin-6 from subchondral bone mesenchymal stem cells contributes to the pathological phenotypes of experimental osteoarthritis. Am J Transl Res. 10:1143–1154, 2018 [PMC free article] [PubMed] [Google Scholar]
  • 137.Xu P, Wang K, Lu C, et al. Effects of the chronic restraint stress induced depression on reward-related learning in rats. Behavioural Brain Research. 321:185–192, 2017 [DOI] [PubMed] [Google Scholar]
  • 138.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13:134, 2012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 139.Yohn CN, Shifman S, Garino A, et al. Fluoxetine effects on behavior and adult hippocampal neurogenesis in female C57BL/6J mice across the estrous cycle. Psychopharmacology. 237:1281–1290, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 140.Yu X, Liu H, Hamel KA, et al. Dorsal root ganglion macrophages contribute to both the initiation and persistence of neuropathic pain. Nature Communications. 11:264, 2020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 141.Zarruk JG, Greenhalgh AD, David S. Microglia and macrophages differ in their inflammatory profile after permanent brain ischemia. Experimental Neurology. 301:120–132, 2018 [DOI] [PubMed] [Google Scholar]
  • 142.Zhang H, Boyette-Davis JA, Kosturakis AK, et al. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) and Its Receptor CCR2 in Primary Sensory Neurons Contributes to Paclitaxel-Induced Peripheral Neuropathy. The Journal of Pain. 14:1031–1044, 2013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 143.Zhang L, Xie W, Zhang J, et al. Key role of CCR2-expressing macrophages in a mouse model of low back pain and radiculopathy. Brain, Behavior, and Immunity. 91:556–567, 2021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 144.Zhao P, Waxman SG, Hains BC. Modulation of Thalamic Nociceptive Processing after Spinal Cord Injury through Remote Activation of Thalamic Microglia by Cysteine–Cysteine Chemokine Ligand 21. The Journal of Neuroscience. 27:8893–8902, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 145.Zhao W, Li Q, Ma Y, et al. Behaviors Related to Psychiatric Disorders and Pain Perception in C57BL/6J Mice During Different Phases of Estrous Cycle. Frontiers in Neuroscience. 15:1–10, 2021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 146.Zhuo M. Neural Mechanisms Underlying Anxiety–Chronic Pain Interactions. Trends in Neurosciences. 39:136–145, 2016 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES