Table 1.
In silico prediction of gRNA off-target effects
| gRNA identity | gRNA sequence | MIT specificity score24 | CrisprSCAN25 | Off-targetsa |
|---|---|---|---|---|
| gRNA7 with ABE_SpG (NGN) | ACTAATAGGCAGAGAGAGTC | 24 | 42 | 0|1|2|64|8000|1|1|1|13 |
| gRNA6 with ABE_SpRY (NYN) | CTAATAGGCAGAGAGAGTCA | 17 | 43 | 0|1|4|116|14580|1|1|7|27 |
| gRNA20 with ABE_SpRY (NRN) | TGCCTATTAGTCTATTTTCC | 9 | 6 | 0|1|8|255|34890|0|0|14|24 |
a
Based on analyses using CRISPOR, numbers shown indicate the number of (first row: total, second row: intragenic) off-targets with 0|1|2|3|4 gRNA mismatches.