Table 1. Primers used for preparation of CHIKV 181/25 clone expressing nLuc (CHIKV 181/25-nLuc) and for sequencing PCR fragment from cDNA of V5040 virus.

The nLuc gene was inserted within the nsP3 gene by Gibson cloning method at 5217 bp site as described in Materials and Methods.

pCHIKV_nsP3_nLuc_vector_rev	AACGAAATCTTCGAGTGTGAAGACggttggtaatgtatgtaccgcccc
nsP3_nLuc_FWD	ggggcggtacatacattaccaaccGTCTTCACACTCGAAGATTTCGTTGGGGAC
nsP3_nLuc REV	cacggccgcaaggtttccgattatCGCCAGAATGCGTTCGCACAGCCG
pCHIKV_nsP3_nLuc_vector_fwd	CGGCTGTGCGAACGCATTCTGGCGataatcggaaaccttgcggccgtg
SEQ_E3_Forw8461	gtactatcagctgctacaag
SEQ_C_Rev7561	ggtacctcctattgtagaaagtt