Skip to main content
. 2024 May 7;12:RP88991. doi: 10.7554/eLife.88991

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Chemical compound, drug AccuPrime Pfx master mix Thermo Fisher 12344040
Chemical compound, drug Pfu Ultra High-Fidelity DNA Polymerase Agilent 600380
Chemical compound, drug Fugene transfection reagent Thermo Fisher 10362100
Chemical compound, drug SIGMAFAST Protease Inhibitor Cocktail Tablets, EDTA-Free Sigma P8830
Chemical compound, drug Beta-mercaptoethanol Sigma M3148-100ML
Chemical compound, drug PMSF Sigma P7626
Chemical compound, drug Guanosine 5′-diphosphate (GDP) sodium salt hydrate Sigma G7127-100MG
Chemical compound, drug Guanosine 5′-triphosphate (GTP) sodium salt hydrate Sigma G8877-250MG
Chemical compound, drug Sodium deoxycholate Sigma D6750
Chemical compound, drug C12E10 (Polyoxyethylene (10) lauryl ether) Sigma P9769
Chemical compound, drug CHAPS Thermo Fisher J6735909
Chemical compound, drug 1,2-dioleoyl-sn-glycero-3-phosphocholine (18:1 DOPC) Avanti 850375 C
Chemical compound, drug 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (18:1 DOPS) Avanti 840035 C
Chemical compound, drug 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (18:1 Δ9-Cis) DOPE Avanti 850725 C
Chemical compound, drug L-α-phosphatidylinositol-4,5-bisphosphate (Brain PI(4,5)P2) Avanti 840046 X
Chemical compound, drug phosphatidylinositol 4,5-bisphosphate 18:0/20:4 (PI(4,5)P2) Echelon P-4524
Chemical compound, drug 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-
[4-(p-maleimidomethyl)cyclohexane-carboxamide] (18:1 MCC-PE)
Avanti 780201 C
Chemical compound, drug 10 x PBS [pH 7.4] Corning 46–013 CM
Chemical compound, drug Trolox Cayman Chemicals 10011659
Chemical compound, drug Dyomics 647 maleimide Dyomics 647 P1-03
Chemical compound, drug Cy3 maleimide Cytiva PA23031
Chemical compound, drug Cy5 maleimide Cytiva PA15131
Chemical compound, drug Cy3 Mono NHS Ester Cytiva PA13101
Chemical compound, drug SNAP-Surface Alexa Fluor 488 NEB S9129S
Chemical compound, drug SNAP-Surface Alexa Fluor 546 NEB S9132S
Chemical compound, drug SNAP-Surface Alexa Fluor 647 NEB S9136S
Chemical compound, drug Coenzyme A Sigma C3019
Chemical compound, drug Sulfuric acid Sigma 58105–2.5 L-PC
Peptide, recombinant protein glucose oxidase (Aspergillus niger, 225 U/mg) Biophoretics B01357.02
Peptide, recombinant protein catalase (bovine liver) Sigma C40-100MG
Peptide, recombinant protein 10 mg/mL beta casein solution ThermoFisher 37528
Peptide, recombinant protein LPETGG ELIM Biopharm custom peptide synthesis >95% purity
Peptide, recombinant protein CSDGG(pY)MDMSKDESID(pY)
VPMLDMKGDIKYADIE
ELIM Biopharm custom peptide synthesis >95% purity
Peptide, recombinant protein CSDGG(pY)MDMSKDESID(pY)
VPMLDMKGDIKYADIE-Alexa488
ELIM Biopharm custom peptide synthesis >95% purity
Sequence-based reagent CCTTTTTGGTAgcaGATGCG
TCTACTAAAATGCATGGTG
Integrated DNA Technologies (IDT) FW_ ybbr-PIK3R1 (R358A)
Sequence-based reagent GTAGACGCATCtgcTACCAAAAA
GGTCCCGTCTGCTGTATC
IDT RV_ ybbr-PIK3R1 (R358A)
Sequence-based reagent CTTTTCTTGTCgcgGAGAGC
AGTAAACAGGGCTGC
IDT FW_ ybbr-PIK3R1 (R358A)
Sequence-based reagent GTTTACTGCTCTCcgcGACAAG
AAAAGTGCCATCTCGCTTC
IDT RV_ ybbr-PIK3R1 (R358A)
Sequence-based reagent CAAGTCGAGGTGGAgatgacTTT
CTTCCTGTATTGAAAGAAATCTTGG
IDT FW_ his6-TEV-PIK3CB(K532D,K533D)
Sequence-based reagent CAATACAGGAAGAAAgtcatcTCCAC
CTCGACTTGACACATTAGCAC
IDT RV_ his6-TEV-PIK3CB(K532D,K533D)
Recombinant DNA reagent his10-SUMO3-GGGGG-Rac1(1-192aa) This paper pSH752 Bacterial protein expression plasmid
Recombinant DNA reagent his6-MBP-N10-TEV-GGGGG-P-Rex1
(40-405aa, DH-PH)
This paper pSH658 Bacterial protein expression plasmid
Recombinant DNA reagent his10-SUMO3-p67/phox TRP (Rac1-GTP sensor) This paper pSH823 Bacterial protein expression plasmid
Recombinant DNA reagent his6-GST-TEV-nSH2 PIK3R1(322-440aa)-Cys This paper pSH615 Bacterial protein expression plasmid
Recombinant DNA reagent his6-SUMO-Btk(PH-TH,R49S/K52S)-SNAP This paper pSH1313 Bacterial protein expression plasmid
Recombinant DNA reagent his6-MBP-N10-TEV-GGGGG-Grp1 (261-387aa) This paper pSH558 Bacterial protein expression plasmid
Recombinant DNA reagent his6-TEV-SenP2 (368-589aa, SUMO protease) This paper pSH653 Bacterial protein expression plasmid
Recombinant DNA reagent his6-TEV-PIK3CB (1-1070aa) This paper pSH541 Baculovirus expression plasmid
Recombinant DNA reagent ybbr-PIK3R1 (1-724aa) This paper pSH743 Baculovirus expression plasmid
recombinant DNA reagent ybbr-PIK3R1 (FVLR->FVLA, R358A) This paper pSH1045 Baculovirus expression plasmid
Recombinant DNA reagent ybbr-PIK3R1 (FVLR->FVLA, R358A) This paper pSH1046 Baculovirus expression plasmid
Recombinant DNA reagent his6-TEV-PIK3CB (1-1070aa; K532D,K533D) This paper pSH1094 Baculovirus expression plasmid
Recombinant DNA reagent his6-Gg2, Gb1 (DUAL FastBac) PMID:34452907 pSH414 Baculovirus expression plasmid
Recombinant DNA reagent his6-Gg2, SNAP-Gb1 (DUAL FastBac) PMID:34452907 pSH651 Baculovirus expression plasmid
Recombinant DNA reagent PIK3CG(p110g), TwinStrept-his10-TEV-ybbr-PIK3R5(p101) PMID:36842083 HP29 Baculovirus expression plasmid
Software, algorithm GraphPad Prism 9 GraphPad https://www.graphpad.com
Software, algorithm Chimera UCSF https://www.rbvi.ucsf.edu/chimera/
Software, algorithm ImageJ/Fiji ImageJ https://imagej.net/software/fiji/
Software, algorithm Nikon NIS elements Nikon https://www.microscope.healthcare.nikon.com/products/software/nis-elements
Cell line(Spodoptera frugiperda) Sf9 insect cells Expression Systems 94–001 S
Cell line (Trichoplusiani) High five insect cells UC Berkeley Barker Hall Tissue Culture Facility High five insect cells
Other ESF 921 Serum-Free Insect Cell Culture media Expression Systems 96-001-01 Media for insect cell culture
Other Fetal Bovine serum Seradigm 1500–500 Media for insect cell culture
Other Hellmanex III cleaning solution Fisher 14-385-864 Reagent for cleaning coverslips prior to Pirahna etching