Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
MicroRNAs identified in Atractylodes lancea rhizome-derived exosome-like nanoparticles.
| MicroRNA | Mature miRNA sequence | Length (nt) | Number of reads |
|---|---|---|---|
| ath-miR166f | ucggaccaggcuucauucc | 19 | 46 |
| ath-miR162a-5p | ucgauaaaccucugcaucca | 20 | 2 |
| ath-miR162b-5p | ucgauaaaccucugcaucca | 20 | 2 |
