Abstract

Previous studies have revealed that abnormal expressions of membrane transporters were associated with colorectal cancer (CRC). We herein performed a comprehensive bioinformatics analysis to identify the key transporter protein-related genes involved in CRC and potential mechanisms. Differentially expressed transporter protein-related genes (DE-TPRGs) were identified from CRC and normal samples using The Cancer Genome Atlas database. SLC38A3 expression was validated by immunohistochemistry and RT-qPCR, and the potential mechanism was explored. A total of 63 DE-TPRGs (29 up-regulated and 34 down-regulated) were screened. Inside, ABCC2, ABCG2, SLC4A4, SLC9A3, SLC15A1, and SLC38A3 were identified as hub genes. SLC38A3 is indeed upregulated in colorectal cancer patients. Furthermore, we found that knockdown of SLC38A3 inhibited the proliferation and migration of HCT116 cells, and Hsp70 ATPase activator could rescue it. Overall, SLC38A3 is a novel potential biomarker involved in CRC progression and promotes the proliferation and migration of tumor cells by positively regulating the function of Hsp70.
Introduction
Colorectal cancer (CRC) poses a significant public health challenge in modern medicine, ranking as the third most common cancer and the fourth leading cause of cancer-related deaths globally.1 The risk of developing CRC is influenced by various factors, such as lifestyle, behavior, and genetic predisposition.2−4 The process of CRC development is intricate and involves gene mutations, cellular contexts, and environmental factors. Despite the availability of current treatment methods such as radiotherapy, chemotherapy, and surgical resection, their effectiveness remains suboptimal.5 We need to develop more innovative and effective diagnostic and therapeutic interventions. Therefore, it is of great significance to deeply understand the complex molecular mechanisms underlying cellular proliferation, and invasion in CRC.6
Previous studies have indicated that abnormal expression of membrane transporters can lead to cancer, such as ATP-binding cassette transporters (ABCTs) and solute carriers (SLCs).7 The ABCT superfamily contains 48 members, categorized into seven subfamilies ranging from ABCA to ABCG.8 While they are typically located in the plasma membrane of cells, ABCTs have also been observed within the Golgi, mitochondria, and endoplasmic reticulum.9 These crucial transporters are responsible for facilitating the movement of diverse substrates such as steroids, glycolipids, phospholipids, and xenobiotics across membranes.10 ABCTs play a pivotal role in numerous physiological processes, including cell detoxification, lipid trafficking, membrane homeostasis, etc. Their involvement in these processes has underscored their importance.11 SLCs are recognized mainly for their ability to regulate the influx/efflux of exogenous/endogenous substances.12,13 Therefore, SLCs may participate in the occurrence and development of tumors by mediating the substance metabolism to regulate cellular functions. Additionally, studies have demonstrated that SLCs can independently contribute to the activation of various signaling network cascades, potentially promoting the formation of metastatic tumors.14−16 Therefore, membrane transporters represent a broad range of potential therapeutic targets for cancer treatment.
For CRC, a study showed that SLCO4A1 expression was upregulated in CRC tissues and was significantly associated with poor prognosis. In cellular experiments, SLCO4A1 knockdown resulted in significantly reduced viability, invasion, and migration compared with control cells. Thus, SLCO4A1 may be a valuable marker of poor prognostic and a new target for CRC treatment.17 In addition, the role of SLC7A5, SLC9A3, ABCC2, ABCG2, etc. in the invasion and progression of CRC has been reported.18−20 Nevertheless, current research on the molecular mechanisms by which these transporters impact CRC, as well as their potential application as drug targets in clinical treatment, remains insufficient. Here, we performed a comprehensive bioinformatics analysis to identify differentially expressed transporter protein-related genes (DE-TPRGs) in CRC and determine their potential functions involved in CRC progression. Additionally, we conducted a more extensive investigation into the role of SLC38A3 in the CRC.
Results
Enrichment Analysis Results and DE-TPRGs
We screened DEGs between CRC and normal samples from The Cancer Genome Atlas (TCGA) database. The volcano plot indicated that 4796 DEGs were identified, of which 1479 were downregulated and 3317 were upregulated (Figure 1A). All DEGs are listed in Table S1. Figure 1B shows the enrichment analysis results. All results are presented in Tables S2 and S3. For GO-MF, significant enrichments were observed for “channel activity” and “passive transmembrane transporter activity”. For GO-BP, the major enriched terms were “cellular cation homeostasis” and “muscle system process”. For GO-CC, the “apical part of cell” and “external side of plasma membrane” were significantly enriched. Kyoto Encyclopedia of Genes and Genomes (KEGG) indicated that DEGs were mainly enriched in “neuroactive ligand–receptor interaction”, “calcium signaling pathway”, and “bile secretion”, among others. Gene set enrichment analysis (GSEA) showed similar results (Figure S1). Interestingly, the enrichment results showed that transporter protein-related genes were involved in CRC pathogenesis. Therefore, the intersecting genes between DEGs and transporter protein-related genes were further identified by the Venn diagram. As a result, 63 DE-TPRGs were ultimately identified (Figure 1C).
Figure 1.
Transporter protein-related differentially expressed genes in the TCGA COAD-READ data set. (A) Volcano plot of DEGs. Red dots represent DEGs up-regulated in CRC tissue, and green dots represent DEGs down-regulated in CRC tissue. (B) GO and KEGG enrichment results of DEGs. (C) Acquisition of transporter protein-related differentially expressed genes.
Acquisition of the Hub Gene
A protein–protein interaction (PPI) network of DE-TPRGs including 61 nodes and 144 edges was constructed through the STRING online platform (Figure 2A). Using the CytoHubba plug-in of Cytoscape software, the top 10 genes with the highest degree scores (SLC9A3, SLC15A1, ABCG2, ABCC2, SLC22A11, SLC4A4, SLC7A5, SLC28A3, SLC38A3, and SLCO1B1) were obtained (Figure 2B). The expression patterns of these genes in CRC and normal samples were presented in box plots (Figure 2C). Survival analysis showed that six hub genes were significantly associated with CRC prognosis in the external GEO data set: ABCC2 (P = 0.041), ABCG2 (P = 0.011), SLC4A4 (P = 0.0098), SLC9A3 (P = 0.031), SLC15A1 (P = 0.017), and SLC38A3 (P = 0.031) (Figure 2 D).
Figure 2.
Acquisition of Hub Genes. (A) PPI network of transporter protein-related differentially expressed genes. (B) Subnetwork of hub genes. (C) Expression boxplots of the 10 highest-scoring genes from tumor tissues and paracarcinoma tissues. (D) Kaplan–Meier plots of hub genes.
Landscape of Immune Infiltration
To better understand immune infiltration in the tumor environment, an immune infiltration analysis was performed using CIBERSORT. Figure 3A shows the proportion of 22 immune cell infiltrators in all samples. All results are presented in Table S4. The first 647 represented the CRC group, and the last 51 represented the normal group. As shown in Figure 3B, 18 types of immune cell markers exhibited significantly diverse expression. Notably, eight types of immune cells (T cells CD4 memory resting, macrophages M0, NK cells resting, macrophages M1, T cells CD4 memory activated, mast cells activated, T cells follicular helper, and neutrophils) exhibited significantly higher expression in the CRC group. Conversely, a reduced level of infiltration was observed for 10 types of immune cells (macrophages M2, Plasma cells, T cells CD8, B cells naive, monocytes, B cells memory, dendritic cells resting, eosinophils, NK cells activated, and mast cells resting) in comparison to the normal group. In addition, immune cell correlation analysis showed hub genes are highly associated with macrophages M2, T cells CD4 memory activated, NK cells activated, and macrophages M2, among others. (Figure 3 C).
Figure 3.
Landscape of Immune Infiltration. (A) Histogram of the percentage of immune infiltration. (B) Box diagram of each immune cell grouping. (C) Correlation between prognostic genes and immune cells.
Potential Mechanism of SLC38A3
For next-level investigation, we selected SLC38A3 which was rarely reported in colorectal cancer among hub genes. We performed a PPI network analysis of SLC38A3 using the STRING online database, resulting in a network of 100 nodes (refer to Figure 4A). The full list is displayed in Table 1. GSEA results showed that SLC38A3 was positively associated with (i) “Endoplasmic reticulum lumen”, (ii) “Endopeptidase regulator activity”, and (iii) “Protein containing complex”. In contrast, a significant negative correlation was noted between SLC38A3 and “NK T cell activation”, “intrinsic apoptotic signaling pathway in response to oxidative stress”, and “negative regulation of I kappab kinase NF kappab signaling” (Figure 4B). All results are presented in Table S5. In addition, 622 genes highly related to SLC38A3 were identified in the CRC cohort by correlation analysis (Table S6). Subsequently, three intersecting genes were identified among the PPI network and highly correlated genes, including SLC15A1, SLC3A2, and DNAJC5 (Figure 4C). Among them, DNAJC5 was an innovative gene in the intersecting genes besides the transporters’ family. We observed a notable positive correlation between DNAJC5 and SLC38A3 (Figure 4D).
Figure 4.

Analysis of SLC38A3. (A) PPI network of SLC38A3. (B) GSEA results. (C) Genes significantly correlated with SLC38A3. (D) Correlation between SLC38A3 and DNAJC5.
Table 1. 100 Nodes of the SLC38A3 PPI Network.
| SLC3A1 | GAD1 | AQP4 | GLS | SLC6A11 | RBX1 | DNAJC5 | SLC6A18 |
| SLC1A3 | KCNJ10 | CPLX1 | SLC6A13 | SNAP25 | TCEB2 | GADL1 | SLC7A6 |
| SLC6A19 | FABP7 | STXBP1 | SLC18A1 | SYT1 | RNF7 | CALB2 | SLC7A7 |
| SLC6A20 | GRIN1 | GPHN | SLC7A5 | SLC17A6 | ZER1 | SLC9A3R1 | SLC7A3 |
| SLC15A1 | GAD2 | VAMP2 | SLC38A1 | SYP | ZYG11B | SLC7A11 | SLC36A2 |
| ERVW-1 | GRIN2B | RIMS1 | SLC1A6 | SLC1A2 | COMMD1 | SLC3A2 | SLC38A9 |
| SLC1A7 | GRIA1 | SLC18A3 | SLC38A2 | SLC6A1 | SLC38A4 | SLC1A5 | SLC7A8 |
| SLC4A9 | SLC12A5 | SLC17A8 | ATP1B3 | S100B | SGCE | EGFR | SLC7A1 |
| PVALB | DLG4 | ASB4 | SCN11A | SYN1 | CUL2 | ACE2 | HCCS |
| SLC32A1 | GFAP | SLC18A2 | SLC7A9 | BSN | CUL5 | SLC38A5 | ARL6IP5 |
| SLC17A7 | SLC1A1 | HSPA8 | SLC36A1 | GRIA2 | PAIP2B | SCN3B | FAM171B |
| SCN4B | GABRG2 | CSAD | ANKHD1 | GRM5 | RAB3A | SCN1B | PDZK1 |
| GLUL | SCN2B | SLC6A5 | FTSJ1 |
SLC38A3 was Overexpressed in CRC Specimens
Immunohistochemistry demonstrated that SLC38A3 expression was significantly upregulated in CRC tissues compared to paracarcinoma tissues (Figure 5A). In addition, RT-qPCR showed that the expression level of SLC38A3 was significantly elevated in CRC tissues compared to paracarcinoma tissues (Figure 5B). These results were consistent with the findings from the bioinformatics analysis.
Figure 5.
Expression of SLC38A3 in tumor tissues and normal tissues. (A) The comparison of the protein expressions of SLC38A3 between tumor tissues and adjacent tissues by IHC. n = 5 biological replicates. (B) The mRNA expression of SCL38A3 between tumor tissues and adjacent tissues was measured by RT-qPCR. *P < 0.05 vs normal. n = 5 biological replicates. Statistics were determined using an independent samples t test.
Knockdown of SLC38A3 Inhibits Proliferation and Migration of CRC Cells
To knock down the expression of SLC38A3 in HCT116 human CRC cell lines, a siRNA-mediated gene silencing approach was employed. Results revealed that SLC38A3 expression was significantly lower in siRNA-interfered cells compared to the control group (Figure 6A). This indicated that cells with stable, low expression of SLC38A3 were successfully constructed. For cellular proliferation, HCT116 cells transfected with SLC38A3 siRNA resulted in a significant reduction in cellular growth proliferation compared to the NC group (Figure 6B). Similarly, significant cellular colony reduction was observed in HCT116 with SLC38A3 siRNA in the colony formation assay. In contrast, transfected cells cultured with the addition of 115-7c (an ATPase agonist of Hsp70) showed a restored ability to proliferate compared to knockdown cells. In our cloning formation and scratch assay experiments, we also observed similar results. Interfering with SLC38A3 significantly reduced the cloning formation ability and migration ability of HCT116 cells. Pretreatment with 115-7C partially reversed the decrease in cell cloning formation ability and migration ability caused by SLC38A3 interference (Figure 6C and D).
Figure 6.
SLC38A3 promotes cell proliferation, migration and invasion of CRC. (A) The transfection efficiency of siSLC38A3 was demonstrated by Western blotting. (B) Silencing SLC38A3 decreased the cell viability of HCT116 cells, and 115-7c demonstrated the reverse. CRC cells were transfected with siSLC38A3 or negative control siRNAs for 48 h before serum deprivation. Cell viability was detected by CCK8. (C) Colony formation assays with siCtrl, siSLC38A3 transfected cells, and siSLC38A3 transfected cells with 115-7c for 14 d. Data represent x̅ ± sx̅, n = 3 independent experiments. (D) Wound healing assay of siCtrl, siSLC38A3 transfected cells, and siSLC38A3 transfected cells with 115-7c for 48 h. Scale bars represent 50 μm. All data were statistically analyzed using an independent samples t test. *P < 0.05, **P < 0.01, ***P < 0.001.
Discussion
Searching for mechanisms to target transporters has great potential for the clinical treatment of CRC and improving chemotherapy resistance. In this study, we performed a comprehensive bioinformatics analysis to identify the key transporter protein-related genes involved in CRC, including SLC9A3, SLC15A1, ABCG2, ABCC2, SLC4A4, and SLC38A3. There are many members of the transporter protein family, and they play different roles in CRC. Abnormal expression of ABCC2 and ABCG2 in CRC has been demonstrated, and their roles in transporting lipids and leading to drug resistance have been reported. SLC4A4 and SLC9A3 can transport H+ and HCO3–, respectively, thus affecting tumor cell PH regulation. SLC15A1 has a significant effect on intestinal peptide transport affects intestinal diseases.19,22−24SLC38A3 is known for its involvement in amino acid transport and is extensively documented in neurological disorders.25−27 Previous studies have explored the role of SLC38A3 in glutamine metabolism and its effect on tumor progression. Our study identified SLC38A3 as a novel prognostic marker gene in CRC, and the knockdown of SLC38A3 in HCT cells inhibited CRC cell proliferation and migration.
Immune infiltration analysis showed that the CRC group had a significantly higher percentage of infiltration by M2 macrophages compared to M1 macrophages. M2 macrophages can produce various immunosuppressive factors and chemokines to reduce antigen presentation and hinder T cell function, allowing tumor cells to evade immune surveillance. Previous studies have suggested that M1 macrophages may be associated with a better patient prognosis. Blocking glutamine metabolism may promote the conversion of M2 macrophages to the more desirable M1 phenotype.28,29 Immune cell correlation results showed that expression of SLC38A3 was negatively correlated with the M1 macrophage, thus targeted inhibition of SLC38A3 might be beneficial for macrophage M1 polarization.
Furthermore, we adopted a novel approach of single gene correlation analysis and the construction of a single gene PPI network to investigate the role of SLC38A3 in CRC progression. First, we observed elevated expression of SLC38A3 in CRC tissues, consistent with the findings of He Yu et al.30 In addition, our research revealed that SLC38A3 has a significant impact on both the proliferation and migration of CRC cells. Through correlation analysis and the PPI network, we identified a positive association between SLC38A3 and DNAJC5, which is a chaperone protein of the heat shock protein Hsp70. These Hsp70s are essential molecular chaperones that play a crucial role in various biological processes by regulating polypeptide folding, translocation across membranes, and protein–protein interactions.31 The J protein family has also been proven to increase the ATPase activity of Hsp70, which contributes to its binding ability with client proteins.32 Inhibition of Hsp70 has been identified as a promising chemotherapeutic approach for CRC treatment.33 GSEA results showed SLC38A3 was positively associated with endopeptidase and the endoplasmic reticulum, which are responsible for processing and modification of proteins. There are two important factors related to the development of colorectal cancer. First, dysregulation of translational regulatory mechanisms of proteins is commonly observed in solid tumors, including colorectal cancer. Second, the abnormal folding of proteins in the endoplasmic reticulum is closely associated with the development of colorectal cancer.34,35 In contrast, a significant negative correlation was noted between SLC38A3 and some pathways that are detrimental to tumor growth.36,37 For example, in a study of normal versus colorectal cancer patients, a better prognosis was observed in patients with higher Valpha24+ NKT cell infiltration.38
To further investigate the effect of SLC38A3 on tumor tissue and the mechanism, a cell model of SLC38A3 knockdown by siRNA transfection was constructed. The proliferation and migration of HCT116 cells knocked down with SLC38A3 were significantly slower than those of the NC group, indicating that SLC38A3 promotes the proliferation and migration of tumor cells. The proliferation and migration ability of transfected cells with the addition of HSP70 ATPase agonist 115-7c was significantly restored compared to the knockdown group. Thus, combined with the results of bioinformatics analysis, we hypothesize that SLC38A3 may affect tumor cell progression by positively regulating DNAJC5 to promote biological processes such as protein folding in which Hsp70 is involved.
In conclusion, these results highlight the potential of SLC38A3 as a therapeutic target in the treatment of CRC. Further research needs to be done to explore the potential therapeutic applications of targeting this protein. However, the current study is somewhat limited. Our data are limited and from publicly available databases, and a larger number of samples are needed for validation. In addition, we have studied only the complex molecular mechanisms of SLC38A3 at the cellular level, which needs further validation in animal models.
Conclusions
SLC38A3, a new oncogenic gene, plays an important role in promoting proliferation and migration of tumor cells by positively regulating the protein folding function of DNAJC5 affecting Hsp70, and it may be used as a new biomarker for the diagnosis and treatment of CRC.
Materials and Methods
Identification of Differentially Expressed Genes
The gene expression profile and corresponding clinical information were downloaded from The Cancer Genome Atlas (TCGA) database (https://portal.gdc.cancer.gov/).39 The TCGA COADREAD data set consisted of 647 CRC tissues and 51 normal tissues. The Dseq2 R package40 was utilized to identify differentially expressed genes (DEGs) between CRC and normal tissues. The criteria for identifying DEGs was set at |log2foldchange| > 2 and an adjusted P-value of <0.05. Subsequently, DEGs were visualized with a volcano map using the ggplot2 R package.41
Enrichment Analysis of DEGs and Identification of DE-TPRGs
To further examine the potential functions of DEGs, gene ontology (GO)42 enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG)43 pathway enrichment analysis of DEGs were performed using the clusterProfiler R package.44 GO enrichment analysis consisted of three parts: biological process (BP), cellular component (CC), and molecular function (MF). Terms with P < 0.05 were considered to be significantly enriched. The enrichment results were visualized using dot plots via the Sangerbox online platform.45
Transporters-related gene lists were collected in Reactome (https://reactome.org/) and the KEGG database (https://www.kegg.jp/kegg/). The search keywords were “transporter proteins”, “ATP-binding cassette transporter”, and “Solute carrier transporter” with the following searching strategies: “Homo Sapiens” (Species) and “Pathway” (Type). Transporter-related genes are displayed in Table S7. The intersection of DEGs and transporter protein-related genes was visualized by a Venn plot.
Acquisition of Hub Genes
The STRING (https://string-db.org/) is an online database that was designed to collect and evaluate protein–protein interaction (PPI) information of the DE-TPRGs. Genes were selected to construct the PPI network with a combined score ≥0.4. We then imported the results of STRING into Cytoscape software (version 3.8.2), and the key subnetworks were built through the cytoHubba plugin. The 10 highest-scoring genes (maximum correlation criterion, Degree algorithm) were acquired. Survival analysis was subsequently conducted on CRC samples from the external data set GSE87211 obtained from the Gene Expression Omnibus (GEO) database.46 Specifically, CRC samples were categorized into high- and low-expression groups based on the expression level of each gene. Genes with meaningful results were identified as hub genes. Kaplan–Meier survival curves and log-rank tests were utilized for survival analysis.
Evaluation of Immune Infiltration
The gene expression data normalized by the DESeq2 R package were uploaded to the CIBERSORT online platform (http://cibersort.stanford.edu/) to obtain the relative proportions of 22 types of infiltrating immune cells. CIBERSORT is an analytical tool developed by the Alizadeh Lab and Newman Lab to impute gene expression profiles and provide an estimation of the abundances of member cell types in a mixed cell population, using gene expression data.47 In addition, correlations between hub genes and immune cells were estimated by a Spearman correlation analysis.
Potential role of SLC38A3 in CRC
To further identify the proteins that SLC38A3 potentially directly modulates in CRC progression, we first identified 100 genes interacting with SLC38A3 using the STRING database. Subsequently, correlations of other genes with SLC38A3 were calculated in CRC samples using Spearman correlation analysis. A gene list for gene set enrichment analysis (GSEA) was constructed and ranked according to correlation coefficients from high to low. Then GSEA analysis was performed based on the gene list. Genes with P < 0.05 and correlation coefficients ≥0.3 from correlation analysis were identified as SLC38A3-related genes. Finally, Venn diagrams were used to identify the intersection between the PPI network genes and SLC38A3-related genes. The intersecting genes might be involved in mediating the function with SLC38A3 in CRC progression
Immunohistochemistry
The CRC tissue and paracarcinoma tissues were collected and routinely embedded into paraffin. Colon rectal sections were stained with hematoxylin. For immunochemistry staining, after the endogenous peroxidases were quenched with 3% H2O2 and unspecific binding was blocked with 2% bovine serum albumin (Amresco, Solon, OH), sections were stained with F4/80, Ly-6G, CD3, 3-nitrotyrosine, 8-oxoG, or Nrf2 overnight at 4 °C. After extensive washing, sections were incubated with respective biotinylated secondary antibodies. Positive staining was visualized using DAB Substrate (Cwbiotech, Beijing, China) following the ABC Kit (Vector Laboratories, Burlingame, CA).
RNA Extraction and RT-qPCR
Clinical samples were obtained from patients with CRC who were surgically treated at The Third Xiangya Hospital from February 2022 to March 2023. The study has been approved by the Ethics Committee of Third Xiangya Hospital (R20021). Total RNA was isolated from cells using the TRIzOn reagent (CWBIO, Beijing, China). A HiFiScript cDNA Synthesis Kit (CWBIO, Beijing, China) was usedfor reverse transcription, and then ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) was used for RT-qPCR. SLC38A3 primer sequences were as follows: forward primer CTCCAACCTGTCCATCGCTGTC and reverse primer AAACGGGTCCACCTTGCTGTAG.
Cell Culture and Silencing of SLC38A3
Human CRC cell line HCT116 was obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were maintained in DMEM high glucose medium (Hyclone, Logan, UT, USA) supplemented with 10% FBS (Gibco, USA) and 1% antibiotic (penicillin-streptomycin, Gibco, USA). Cells were transfected with Specific small interfering RNA (siRNA) against SLC38A3. SiRNAs were custom designed and provided by Guangzhou RiboBio Co., Ltd. (RiboBio). The three siRNAs targeting SLC38A3 include SLC38A3_1, SLC38A3_2 and SLC38A3_3. Cells were seeded on 60 mm culture plates and transfected with oligonucleotides using lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Transfected cells were incubated at 37 °C in 5% CO2. After 48 h, cells were harvested for Western blotting.
Cell Proliferation Assay
In order to examine the involvement of SLC38A3 expression with cellular proliferation, control cells, transfected HCT116 cells, and transfected cells cultured with 115-7c (an ATPase agonist of Hsp70) were spread in five 96-well plates at a density of 2500 cells per well, and incubated at 37 °C in a 5% CO2 incubator. 115-7c was formulated into solution at a concentration of 20 nm to examine whether reduced expression of DNAJC5 due to SLC38A3 knockdown affects the ATPase activity of Hsp70 and inhibits tumor cell proliferation. One plate was removed every 24 h for 3 consecutive days, 100 μL of CCK8 solution (90 μL of complete medium plus 10 μL of CCK8 stock solution) was added to each well, and the plates were incubated in the incubator for 1 h. The absorbance at 450 nm was measured. For the colony formation assay, control cells, transfected HCT116 cells, and transfected HCT116 cells cultured with 115-7c were seeded into 12-well plates with a cell count of 1000 cells per well and repeated three times. The cells were incubated for 14 days until the appearance of a naked eye cell cluster terminated. Samples were washed three times with PBS, PBS was discarded, cells were fixed with 1 mL of paraformaldehyde for 10 min, and paraformaldehyde was discarded. Then, 1 mL of 0.5% crystalline violet was added to each well, and cells were stained for 20 min avoiding light. The samples were washed three times with PBS, dried, and photographed.
Wound Healing Assay
Control cells, transfected HCT116 cells, and transfected HCT116 cells cultured with 115-7c were seeded in 6-well plates, and monolayers were gently scratched with a sterile 200 mL pipet tip when they had grown to 90% confluence. After washing with PBS three times to remove floating cells, the remaining adherent cells with a thin “wound” were incubated at 37 C in 5% CO2. The photos were photographed at 0, 12, 24, 36, and 48 h using an inverted microscope. All independent experiments were performed in triplicate.
Statistical Analysis
Histochemistry and RT-qPCR were performed using five pairs of biological samples. Cell experiments were repeated at least three times. All data were expressed as the mean ± standard deviation (SD). Statistical analysis was carried out using GraphPad Prism 8.0 for Windows. The Spearman correlation coefficient test was used to analyze the association between SLC38A3 and other genes in the TCGA cohort. The survival curves were plotted by Kaplan–Meier analysis and compared using a log-rank test. Differences were considered statistically significant when the P-value was <0.05.
Acknowledgments
We are grateful to the Bioinformatics Center, Xiangya Hospital, Central South University for partial support of this work. Results shown here are in part based upon data generated by the TCGA Research Network: https://www.cancer.gov/tcga. This project was financially supported by the National Natural Science Foundation of China (Grant 82073850) and the Natural Science Foundation of Hunan Province (Grant 2021JJ31004). The study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of The Third Xiangya Hospital (R20021). The manuscript has not been published previously.
Glossary
Abbreviations
- CRC
colorectal cancer
- DE-TPRGs
differentially expressed transporter protein-related genes
- TCGA
The Cancer Genome Atlas
- PPI
protein–protein interaction
- SLCs
solute carriers
- ABCTs
ATP-binding cassette transporters
- EMT
epithelial–mesenchymal transition
- DEGs
differentially expressed genes
- GO
gene ontology
- KEGG
Kyoto Encyclopedia of Genes and Genomes
- BP
biological process
- CC
cellular component
- MF
molecular function
- GEO
Gene Expression Omnibus
- GSEA
gene set enrichment analysis
- ESCC
esophageal squamous cell carcinoma
Data Availability Statement
The data sets used or analyzed during the current study are available from the corresponding author on reasonable request. The complete results of the authors’ analyses are provided in the Supporting Information. Publicly available data sets can be downloaded from the TCGA (https://www.cancer.gov/tcga) and GEO (https://www.ncbi.nlm.nih.gov/gds) databases.
Supporting Information Available
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsomega.4c00901.
Author Contributions
# S.Z. and L.H. contributed equally to this work. Conceptualization: R.G. and D.L. Methodology: L.H., W.H., and G.G. Software and validation: S.Z. and L.H. Writing–original draft preparation: S.Z. Writing–review and editing: R.G. and Y.Z. Visualization: S.Z., L.H., and Y.Z. Supervision: D.L. All authors read and approved the final version of the manuscript.
The authors declare no competing financial interest.
Supplementary Material
References
- Siegel R. L.; Miller K. D.; Goding Sauer A.; Fedewa S. A.; Butterly L. F.; Anderson J. C.; Cercek A.; Smith R. A.; Jemal A. Colorectal cancer statistics, 2020. CA Cancer J. Clin. 2020, 70 (3), 145–64. 10.3322/caac.21601. [DOI] [PubMed] [Google Scholar]
- Nejadghaderi S. A.; Roshani S.; Mohammadi E.; Yoosefi M.; Rezaei N.; Esfahani Z.; Azadnajafabad S.; Ahmadi N.; Shahin S.; Kazemi A.; Namazi Shabestari A.; Khosravi A.; Mokdad A. H.; Larijani B.; Farzadfar F. The global, regional, and national burden and quality of care index (QCI) of colorectal cancer; a global burden of disease systematic analysis 1990–2019. PLoS One 2022, 17 (4), e0263403 10.1371/journal.pone.0263403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Carethers J. M.; Doubeni C. A. Causes of Socioeconomic Disparities in Colorectal Cancer and Intervention Framework and Strategies. Gastroenterology. 2020, 158 (2), 354–67. 10.1053/j.gastro.2019.10.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gausman V.; Dornblaser D.; Anand S.; Hayes R. B.; O’Connell K.; Du M.; Liang P. S. Risk Factors Associated With Early-Onset Colorectal Cancer. Clin. Gastroenterol. Hepatol. 2020, 18 (12), 2752–2759.e2. 10.1016/j.cgh.2019.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xie Y. H.; Chen Y. X.; Fang J. Y. Comprehensive review of targeted therapy for colorectal cancer. Signal Transduct Target Ther. 2020, 5, 22. 10.1038/s41392-020-0116-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wan M. L.; Wang Y.; Zeng Z.; Deng B.; Zhu B. S.; Cao T.; Li Y. K.; Xiao J.; Han Q.; Wu Q. Colorectal cancer (CRC) as a multifactorial disease and its causal correlations with multiple signaling pathways. Biosci Rep. 2020, 40 (3), BSR20200265. 10.1042/BSR20200265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rashid K.; Ahmad A.; Liang L.; Liu M.; Cui Y.; Liu T. Solute carriers as potential oncodrivers or suppressors: their key functions in malignant tumor formation. Drug Discov Today. 2021, 26 (7), 1689–701. 10.1016/j.drudis.2021.03.004. [DOI] [PubMed] [Google Scholar]
- Alam A.; Locher K. P. Structure and Mechanism of Human ABC Transporters. Annual Review of Biophysics. 2023, 52 (1), 275–300. 10.1146/annurev-biophys-111622-091232. [DOI] [PubMed] [Google Scholar]
- ter Beek J.; Guskov A.; Slotboom D. J. Structural diversity of ABC transporters. J. Gen Physiol. 2014, 143 (4), 419–35. 10.1085/jgp.201411164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang J. Q.; Wu Z. X.; Yang Y.; Teng Q. X.; Li Y. D.; Lei Z. N.; Jani K. A.; Kaushal N.; Chen Z. S. ATP-binding cassette (ABC) transporters in cancer: A review of recent updates. J. Evid Based Med. 2021, 14 (3), 232–56. 10.1111/jebm.12434. [DOI] [PubMed] [Google Scholar]
- Xiao H.; Zheng Y.; Ma L.; Tian L.; Sun Q. Clinically-Relevant ABC Transporter for Anti-Cancer Drug Resistance. Front Pharmacol. 2021, 12, 648407. 10.3389/fphar.2021.648407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pizzagalli M. D.; Bensimon A.; Superti-Furga G. A guide to plasma membrane solute carrier proteins. FEBS Journal. 2021, 288 (9), 2784–835. 10.1111/febs.15531. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bai X. Progress in Structural Biology of Solute Carriers. Current Molecular Biology Reports. 2021, 7 (2), 9–19. 10.1007/s40610-021-00144-5. [DOI] [Google Scholar]
- Panda S.; Banerjee N.; Chatterjee S. Solute carrier proteins and c-Myc: a strong connection in cancer progression. Drug Discovery Today. 2020, 25 (5), 891–900. 10.1016/j.drudis.2020.02.007. [DOI] [PubMed] [Google Scholar]
- Wu Z.; Xu J.; Liang C.; Meng Q.; Hua J.; Wang W.; Zhang B.; Liu J.; Yu X.; Shi S. Emerging roles of the solute carrier family in pancreatic cancer. Clin. Transl. Med. 2021, 11 (3), e356. 10.1002/ctm2.356. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sutherland R.; Meeson A.; Lowes S. Solute transporters and malignancy: establishing the role of uptake transporters in breast cancer and breast cancer metastasis. Cancer and Metastasis Reviews. 2020, 39 (3), 919–32. 10.1007/s10555-020-09879-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ban M. J.; Ji S. H.; Lee C. K.; Bae S. B.; Kim H. J.; Ahn T. S.; Lee M. S.; Baek M. J.; Jeong D. Solute carrier organic anion transporter family member 4A1 (SLCO4A1) as a prognosis marker of colorectal cancer. J. Cancer Res. Clin Oncol. 2017, 143 (8), 1437–47. 10.1007/s00432-017-2393-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tang B.; Zhang L.; Yu J.; Peng M.; Cheng Y.; Hu D.; Liu Y.; Guo Y.; Zhou H. SLC7A5 promotes colorectal cancer progression by regulating cell cycle and migration. Europe PMC 2021, PPR281759 10.21203/rs.3.rs-192581/v1. [DOI] [Google Scholar]
- Zhou X.; Jiang M.; Liu Z.; Xu M.; Chen N.; Wu Z.; Gu C.; Chin E.; Yang X. Na+/H+-Exchanger Family as Novel Prognostic Biomarkers in Colorectal Cancer. J. Oncol. 2021, 2021, 3241351. 10.1155/2021/3241351. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Andersen V.; Vogel L. K.; Kopp T. I.; Saebo M.; Nonboe A. W.; Hamfjord J.; Kure E. H.; Vogel U. High ABCC2 and low ABCG2 gene expression are early events in the colorectal adenoma-carcinoma sequence. PLoS One. 2015, 10 (3), e0119255 10.1371/journal.pone.0119255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Y.; Wang J.; Yang L.; Qiu L.; Hua Y.; Wu S.; Zeng S.; Yu L.; Zheng X. Epigenetic regulation of intestinal peptide transporter PEPT1 as a potential strategy for colorectal cancer sensitization. Cell Death dis. 2021, 12 (6), 532. 10.1038/s41419-021-03814-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mamoor S. Differential expression of SLC4A4 in colorectal cancer. OSF Preprints 2023, 10.31219/osf.io/8qrfu. [DOI] [Google Scholar]
- Sałagacka-Kubiak A.; Zawada D.; Saed L.; Kordek R.; Jeleń A.; Balcerczak E. ABCG2 Gene and ABCG2 Protein Expression in Colorectal Cancer—In Silico and Wet Analysis. International Journal of Molecular Sciences. 2023, 24 (13), 10539. 10.3390/ijms241310539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marafi D.; Fatih J. M.; Kaiyrzhanov R.; Ferla M. P.; Gijavanekar C.; Al-Maraghi A.; Liu N.; Sites E.; Alsaif H. S.; Al-Owain M.; Zakkariah M.; El-Anany E.; Guliyeva U.; Guliyeva S.; Gaba C.; Haseeb A.; Alhashem A. M.; Danish E.; Karageorgou V.; Beetz C.; Subhi A. A.; Mullegama S. V.; Torti E.; Sebastin M.; Breilyn M. S.; Duberstein S.; Abdel-Hamid M. S.; Mitani T.; Du H.; Rosenfeld J. A.; Jhangiani S. N.; Coban Akdemir Z.; Gibbs R. A.; Taylor J. C.; Fakhro K. A.; Hunter J. V.; Pehlivan D.; Zaki M. S.; Gleeson J. G.; Maroofian R.; Houlden H.; Posey J. E.; Sutton V. R.; Alkuraya F. S.; Elsea S. H.; Lupski J. R. Biallelic variants in SLC38A3 encoding a glutamine transporter cause epileptic encephalopathy. Brain. 2022, 145 (3), 909–24. 10.1093/brain/awab369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Alawbathani S.; Khan S.; Westenberger A.; Beetz C.; Lingappa L. A novel biallelic nonsense variant in SLC38A3 causing epileptic encephalopathy in an Indian family. Clinical Genetics. 2023, 103 (5), 609–11. 10.1111/cge.14271. [DOI] [PubMed] [Google Scholar]
- Rubio-Aliaga I.; Wagner C. A. Regulation and function of the SLC38A3/SNAT3 glutamine transporter. Channels (Austin). 2016, 10 (6), 440–52. 10.1080/19336950.2016.1207024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li J.; Li L.; Li Y.; Long Y.; Zhao Q.; Ouyang Y.; Bao W.; Gong K. Tumor-associated macrophage infiltration and prognosis in colorectal cancer: systematic review and meta-analysis. International Journal of Colorectal Disease. 2020, 35 (7), 1203–10. 10.1007/s00384-020-03593-z. [DOI] [PubMed] [Google Scholar]
- Najafi M.; Hashemi Goradel N.; Farhood B.; Salehi E.; Nashtaei M. S.; Khanlarkhani N.; Khezri Z.; Majidpoor J.; Abouzaripour M.; Habibi M.; Kashani I. R.; Mortezaee K. Macrophage polarity in cancer: A review. J. Cell Biochem. 2019, 120 (3), 2756–65. 10.1002/jcb.27646. [DOI] [PubMed] [Google Scholar]
- He Y.; Yu Y.; Huang H.; Wang C.; Huang G.; Han S. Expression of SNAT3 in Colorectal Cancer Tissues and Its Relationship with Clinicopathological Biological Features. World J. Cancer Res. 2018, 8 (4), 144–149. 10.12677/WJCR.2018.84023. [DOI] [Google Scholar]
- Albakova Z.; Siam M. K. S.; Sacitharan P. K.; Ziganshin R. H.; Ryazantsev D. Y.; Sapozhnikov A. M. Extracellular heat shock proteins and cancer: New perspectives. Transl Oncol. 2021, 14 (2), 100995. 10.1016/j.tranon.2020.100995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kampinga H. H.; Craig E. A. The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nat. Rev. Mol. Cell Biol. 2010, 11 (8), 579–92. 10.1038/nrm2941. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moradi-Marjaneh R.; Paseban M.; Moradi M. M. Hsp70 inhibitors: Implications for the treatment of colorectal cancer. IUBMB Life. 2019, 71 (12), 1834–1845. 10.1002/iub.2157. [DOI] [PubMed] [Google Scholar]
- Huang J.; Pan H.; Wang J.; Wang T.; Huo X.; Ma Y.; Lu Z.; Sun B.; Jiang H. Unfolded protein response in colorectal cancer. Cell Biosci. 2021, 11, 26. 10.1186/s13578-021-00538-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schmidt S.; Denk S.; Wiegering A. Targeting Protein Synthesis in Colorectal Cancer. Cancers. 2020, 12 (5), 1298. 10.3390/cancers12051298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ghazvinian Z.; Abdolahi S.; Tokhanbigli S.; Tarzemani S.; Piccin A.; Reza Zali M.; Verdi J.; Baghaei K. Contribution of natural killer cells in innate immunity against colorectal cancer. Front. Oncol. 2023, 12, 1077053. 10.3389/fonc.2022.1077053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu Z.; Zhu J.; Ma Y.; Long T.; Gao L.; Zhong Y.; Wang X.; Li Z. CIP4 targeted to recruit GTP-Cdc42 involving in invadopodia formation via NF-κB signaling pathway promotes invasion and metastasis of CRC. Molecular Therapy - Oncolytics. 2022, 24, 873–86. 10.1016/j.omto.2022.02.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tachibana T.; Onodera H.; Tsuruyama T.; Mori A.; Nagayama S.; Hiai H.; Imamura M. Increased intratumor Valpha24-positive natural killer T cells: a prognostic factor for primary colorectal carcinomas. Clin. Cancer Res. 2005, 11 (20), 7322–7. 10.1158/1078-0432.CCR-05-0877. [DOI] [PubMed] [Google Scholar]
- Tomczak K.; Czerwińska P.; Wiznerowicz M. ReviewThe Cancer Genome Atlas (TCGA): an immeasurable source of knowledge. Contemporary Oncology/Współczesna Onkologia. 2015, 1A, 68–77. 10.5114/wo.2014.47136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Love M. I.; Huber W.; Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology. 2014, 15 (12), 550. 10.1186/s13059-014-0550-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wickham H. ggplot2. Wiley interdisciplinary reviews: computational statistics. 2011, 3 (2), 180–5. 10.1002/wics.147. [DOI] [Google Scholar]
- The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res. 2019, 47 (D1), D330–D338. 10.1093/nar/gky1055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kanehisa M.; Sato Y.; Kawashima M.; Furumichi M.; Tanabe M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016, 44 (D1), D457–62. 10.1093/nar/gkv1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yu G.; Wang L.-G.; Han Y.; He Q.-Y. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics: a journal of integrative biology. 2012, 16 (5), 284–7. 10.1089/omi.2011.0118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shen W.; Song Z.; Zhong X.; Huang M.; Shen D.; Gao P.; Qian X.; Wang M.; He X.; Wang T.; Li S.; Song X. Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform. iMeta 2022, 1 (3), e36. 10.1002/imt2.36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hu Y.; Gaedcke J.; Emons G.; Beissbarth T.; Grade M.; Jo P.; Yeager M.; Chanock S. J.; Wolff H.; Camps J.; Ghadimi B. M.; Ried T. Colorectal cancer susceptibility loci as predictive markers of rectal cancer prognosis after surgery. Genes Chromosomes Cancer. 2018, 57 (3), 140–9. 10.1002/gcc.22512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Newman A. M.; Steen C. B.; Liu C. L.; Gentles A. J.; Chaudhuri A. A.; Scherer F.; Khodadoust M. S.; Esfahani M. S.; Luca B. A.; Steiner D.; Diehn M.; Alizadeh A. A. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nat. Biotechnol. 2019, 37 (7), 773–82. 10.1038/s41587-019-0114-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data sets used or analyzed during the current study are available from the corresponding author on reasonable request. The complete results of the authors’ analyses are provided in the Supporting Information. Publicly available data sets can be downloaded from the TCGA (https://www.cancer.gov/tcga) and GEO (https://www.ncbi.nlm.nih.gov/gds) databases.





