Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
CRISPR crRNA guide RNA sequences (entered as DNA into the IDTdna.com crRNA order form)
| Strain | Sequence |
|---|---|
| snu-66 H765 randomized | CAATCCGGGTAAGAAACAGT |
| Prp8 H1573 randomized | TCTTTTGCCACAAGTGAGCA |
| ubc-22 5′ss swap ΔAA and ubc-22 ΔAA | AGTTTTAAATGTAAACAACG |
