Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| CD90.2 MicroBeads, mouse | Miltenyi Biotec | Cat# 130-121-278 |
| CD5 (Ly-1) MicroBeads, mouse | Miltenyi Biotec | Cat# 130-049-301 |
| DAPI | BioLegend | Cat# 422801 |
| Rat Anti-Mouse CD4 Antibody, APC-H7 Conjugated | BD Biosciences | Cat# 560246, RRID:AB_1645236 |
| APC anti-mouse CD25 | BioLegend | Cat# 101910, RRID: AB_2280288 |
| FITC anti-mouse/human CD44 antibody | BioLegend | Cat# 103006, RRID:AB_312957 |
| PE anti-mouse CD45RB antibody | BioLegend | Cat# 103308, RRID:AB_313015 |
| FITC anti-mouse CD8a antibody | BioLegend | Cat# 100705, RRID:AB_312744 |
| FITC anti-mouse IL-17A antibody | BioLegend | Cat# 506907, RRID:AB_536009 |
| FITC anti-mouse CD25 antibody | BioLegend | Cat# 101907, RRID:AB_961210 |
| FITC anti-mouse CD11c antibody | BioLegend | Cat# 117305, RRID:AB_313774 |
| FITC anti-mouse CD80 antibody | BioLegend | Cat# 104705, RRID:AB_313126 |
| PE anti-mouse CD62L antibody | BioLegend | Cat# 104407, RRID:AB_313094 |
| PE anti-mouse CD69 antibody | BioLegend | Cat# 104507, RRID:AB_313110 |
| PE anti-mouse IFN-gamma antibody | BioLegend | Cat# 505807, RRID:AB_315401 |
| PE anti-mouse FOXP3 antibody | BioLegend | Cat# 126403, RRID:AB_1089118 |
| Rat Anti-CD40 Monoclonal Antibody, Phycoerythrin Conjugated, Clone 3/23 | BD Biosciences | Cat# 553791, RRID:AB_395055 |
| PE anti-mouse CD274 (B7-H1, PD-L1) antibody | BioLegend | Cat# 124307, RRID:AB_2073557 |
| PE anti-mouse IL-6 antibody | BioLegend | Cat# 504503, RRID:AB_315337 |
| PerCP/Cyanine5.5 anti-mouse CD45.2 antibody | BioLegend | Cat# 109827, RRID:AB_893352 |
| APC anti-mouse/human CD44 antibody | BioLegend | Cat# 103011, RRID:AB_312962 |
| APC anti-mouse CD279 (PD-1) antibody | BioLegend | Cat# 135209, RRID:AB_2251944 |
| APC anti-mouse IL-4 antibody | BioLegend | Cat# 504105, RRID:AB_315319 |
| ROR gamma (t) Monoclonal Antibody (AFKJS-9), APC, | Thermo Fisher Scientific | Cat# 17-6988-82, RRID:AB_10609207 |
| APC anti-mouse CD11c antibody | BioLegend | Cat# 117309, RRID:AB_313778 |
| APC anti-mouse TNF-alpha antibody | BioLegend | Cat# 506307, RRID:AB_315428 |
| APC/Cyanine7 anti-mouse CD4 antibody | BioLegend | Cat# 100413, RRID:AB_312698 |
| HIF1A-human antibody | GeneTex | Cat# GTX127309, RRID:AB_2616089) |
| HIF Prolyl Hydroxylase 3 Antibody | Novus Biologicals | Cat# NB100-139, RRID:AB_2096716 |
| Mouse Anti-Actin, beta Monoclonal Antibody, Unconjugated, Clone mAbcam 8226 | Abcam | Cat# ab8226, RRID:AB_306371 |
| Anti-rabbit IgG, HRP-linked Antibody | Cell Signaling Technology | Cat# 7074, RRID:AB_2099233 |
| HIF-1 alpha Antibody | Novus Biologicals | Cat# NB100-479, RRID:AB_10000633 |
| Goat Anti-Rabbit IgG H&L (HRP polymer) | abcam | Cat# ab214880 |
| Chemicals, peptides, and recombinant proteins | ||
| Ampicillin | Sigma Aldrich | Cat# A9393 |
| Kanamycin sulfate | Sigma Aldrich | Cat# 60615 |
| Metronidazole | Sigma Aldrich | Cat# M1547 |
| Vancomycin | Sigma Aldrich | Cat# SBR00001 |
| Neomycin | Sigma Aldrich | Cat# N1876 |
| Deferasirox | Sigma Aldrich | Cat# SML2673-50 |
| HBSS (10X), no calcium, no magnesium, no phenol red | Gibco |
Cat# 14185052 |
| Sodium bicarbonate | Sigma Aldrich | Cat# S6014 |
| FBS | GeminiBio | Cat# 100-106 |
| 0.5 M EDTA Solution | Lonza | Cat# 51201 |
| Red blood cell lysing buffer | Sigma Aldrich | Cat# R7757 |
| DTT | Gold Biotechnology | Cat# DTT |
| Percoll PLUS | GE Healthcare | Cat# 17-5445 |
| PMA | Sigma Aldrich | Cat# P1585 |
| Ionomycin | Sigma Aldrich | Cat# I3909 |
| LPS | Sigma Aldrich | Cat# L2654 |
| Protein Transport Inhibitor Cocktail | eBioscience | Cat# 00-4980-03 |
| IC Fixation Buffer | eBioscience | Cat# 00-8222-49 |
| Permeabilization Buffer (10X) | eBioscience | Cat# 00-8333-56 |
| RIPA Lysis and Extraction Buffer | Thermo Scientific | Cat# 89901 |
| ECL Western Blotting Substrate | Thermo Scientific | Cat# 32106 |
| Goat Serum, New Zealand origin | Gibco | Cat# 16210064 |
| ImmPACT® DAB Substrate Kit, Peroxidase (HRP) | VECTOR labolatories | Cat# SK-4105 |
| ProLong™ Gold Antifade Mountant with DAPI | Invitrogen | Cat# P36931 |
| Seahorse XF Media | Agilent | Cat# 102353-100 |
| D-(+)-Glucose | Sigma Aldrich | Cat# G7021 |
| FCCP | abcam | Cat# ab120081 |
| Oligomycin A | Sigma Aldrich | Cat# 75351 |
| Rotenone | Tocris | Cat# 3616 |
| Antimycin A from Streptomyces sp. | Sigma Aldrich | Cat# A8674 |
| Critical commercial assays | ||
| MagAttract PowerMicrobiome DNA/RNA EP | QIAGEN | Cat# 27500-4-EP |
| Quant-iT™ PicoGreen™ dsDNA Assay Kits and dsDNA Reagents | Invitrogen | Cat# P7589 |
| MiSeq Reagent Kits v2 | illumina | Cat# MS-102-2003 |
| NuPAGE™ 4 to 12%, Bis-Tris, 1.0-1.5 mm, Mini Protein Gels | Invitrogen | Cat# NP0321BOX |
| Immobilon®-PSQ Membrane, PVDF, 0.2 m, 8.5 cm x 10 m roll | Millipore | Cat# ISEQ85R |
| Hypoxyprobe-Red549 Kit | Hypoxyprobe | Cat# HP7 |
| RNeasy Micro Kit | QIAGEN | Cat# 74004 |
| High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor | Applied Biosystems | Cat# 4374966 |
| Iron Assay Kit | Sigma Aldrich | Cat# MAK025 |
| Deposited data | ||
| Code used for analysis for 16S rRNA sequencing: https://doi.org/10.5281/zenodo.7401507. | zenodo | https://doi.org/10.5281/zenodo.7401507. |
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6 | Charles River Laboratories | Cat# 027, RRID:IMSR_CRL:02 7 |
| Mouse: BALB/c | Charles River Laboratories | Cat# 028, RRID:IMSR_CRL:02 8 |
| Mouse: BDF1 | Charles River Laboratories | Cat# 099, RRID:IMSR_CRL:09 9 |
| Mouse: B6.129S7-Rag1tm1Mom/J | The Jackson Laboratories | Cat# 002216, RRID:IMSR_JAX:00 2216 |
| Mouse: BDF1 | The Jackson Laboratories | Cat# 100006, RRID:IMSR_JAX:10 0006 |
| Mouse: B6.Cg-Tg(Vil1-cre)1000Gum/J | The Jackson Laboratories | Cat# 021504, RRID:IMSR_JAX:02 1504 |
| Mouse: 129S1/SvImJ | The Jackson Laboratories | Cat# 002448, RRID:IMSR_JAX:00 2448 |
| Mouse: C57BL/6NTac | Taconic Biosciences | Cat# B6 F, RRID:IMSR_TAC:b6 |
| Mouse: BALB/cAnNTac | Taconic Biosciences | Cat# BALB-F, RRID:IMSR_TAC:bal b |
| Mouse: Hif1afl/fl | Gift from Yatrik M. Shah | N/A |
| Oligonucleotides | ||
| RNA sequence, mouse Gapdh:5′- TGACCTCAACTACATGGTCTACA-3′ and 5′- CTTCCCATTCTCGGCCTTG-3′ |
This paper | N/A |
| RNA sequence, mouse Hif1α:5′- CAGTCACCTGGTTGCTGCAA -3′ and 5′- CAGTCACCTGGTTGCTGCAA -3′ |
This paper | N/A |
| RNA sequence, mouse Egln(Phd3):5′- TGCTGAAGAAAGGGCAGAAG -3′ and 5′- GCACACCACAGTCAGTCTTTA-3′ |
This paper | N/A |
| Software and algorithms | ||
| FlowJo | BD |
https://www.flowjo.com, RRID:SCR_008520, version 10.2 |
| mothur | Schloss et al., 200945 |
https://mothur.org/, RRID:SCR_011947, version 1.40.2 and 1.42.3 |
| LEfSe | Segata et al., 201148 |
http://huttenhower.sph.harvard.edu/galaxy , RRID:SCR_014609, version 1.1.2 |
| ggpubr | https://cloud.r-project.org/web/packages/ggpubr/index.html |
https://CRAN.R-project.org/package=ggpubr, RRID:SCR_021139, version 0.4.0 |
| ggplot2 | Wickham, 2016 49 |
https://cran.r-project.org/web/packages/ggplot2/index.html, RRID:SCR_014601v ersion 3.3.5 |
| R | R Foundation |
http://www.r-project.org/, RRID:SCR_001905, version 4.1.3 |
| ImageJ | Schindelin et al., 201250 |
https://imagej.net/software/fiji/, RRID:SCR_003070 ,version 1.53c |
| Seahorse Wave Desktop Software | Agilent |
https://www.agilent.com/en/products/cell-analysis/software-download-for-wave-desktop, RRID:SCR_014526, version 2.6.1.53 |
| Graph Pad Prism | Graph Pad Software Inc |
http://www.graphpad.com/, RRID:SCR_002798, version 8.0.0, |
| Excel2016 | Microsoft |
https://www.microsoft.com/en-us/microsoft-365/excel, RRID:SCR_016137, version 2105 |