REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse anti-Tom20	Santa Cruz Biotechnology	Cat#sc-17764; RRID: AB_628381
Rabbit anti-Tom20	Cell Signaling Technology	Cat#42406S; RRID: AB_2687663
Rabbit anti-LC3	Cell Signaling Technology	Cat#2775S; RRID: AB_915950
Rabbit anti-LC3	Novus Biologicals	Cat# NB100-2220
Mouse anti-LAMP1	Santa Cruz Biotechnology	Cat#SC20011; RRID: AB_626853
Rabbit anti-PDI	Cell Signaling Technology	Cat#3501S; RRID: AB_2156433
Rabbit anti-GM130	Cell Signaling Technology	Cat#12480S; RRID: AB_2797933
Mouse anti-GAPDH	Millipore Sigma	Cat# MAB374; RRID: AB_2107445
Rabbit anti-CerS1	Novus Biologicals	Cat# NBP1-59733
Mouse anti-Ceramide	Enzo Life Sciences	Cat# ALX-804-196-T050; RRID: AB_2051116
Mouse anti-S100A10	Invitrogen	Cat# MA5-24769
Rabbit anti-P-Y-1000 MultiMab	Cell Signaling Technology	Cat#8954S; RRID: AB_2687925
Mouse anti-Tim23	ThermoFisher	Cat#67535-1-IG
Rabbit anti-ANXA2	ProteinTech	Cat#11256-1-AP; RRID: AB_2057311
Mouse anti-ANXA2	ProteinTech	Cat#60051-1-IG; RRID: AB_2057309
Mouse anti-V5-tag	Invitrogen	Cat#37-7500
Rabbit anti-V5-tag	Cell Signaling Technology	Cat#13202; RRID: AB_2687461
Rabbit anti-DYKDDDDK (FLAG)-tag	Cell Signaling Technology	Cat#14793S; RRID: AB_2572291
Mouse anti-DYKDDDDK (FLAG)-tag	Cell Signaling Technology	Cat#8146S; RRID: AB_10950495
Rabbit anti-Actin	Sigma-Aldrich	Cat# A2066; RRID: AB_476693
Mouse Normal IgG	Millipore Sigma	Cat#12–371; RRID: AB_145840
Rabbit Normal IgG	Millipore Sigma	Cat#12–370; RRID: AB_145841
Rabbit/Mouse Anti-Porphyromonas gingivalis	Dr. Özlem Yilmaz lab	Lee et al.6,25
Rabbit anti-FimA	Dr. Özlem Yilmaz lab	Yilmaz et al.13
Rabbit anti-Nucleoside diphosphate kinase (NDK)	Dr. Özlem Yilmaz lab	Atanasova et al.17
Rabbit HRP-conjugated secondary antibody	Cell Signaling Technology	Cat#7074; RRID: AB 2099233
Bacterial and virus strains
Porphyromonas gingivalis 33277 strain	ATCC	Cat#33277
Porphyromonas gingivalis ΔfimA mutant of 33277 strain	Dr. Özlem Yilmaz lab	Yilmaz et al.13
Porphyromonas gingivalis Δndk mutant and Δndk- complemented 33277 strains	Dr. Özlem Yilmaz lab	Yilmaz et al.13
Chemicals, peptides, and recombinant proteins
LCL768	Laboratory of Zdzislaw Szulc	N/A
Rapamycin	Sigma-Aldrich	Cat#R0395
Sodium Selenite	Thermo Fisher Scientific	Cat#18-613-846
Ethanol absolute (200 proof)	Koptec	Cat#64-17-5
DMEM	Cytiva	Cat# SH30243.01
PBS pH 7.4 (1x)	Gibco	Cat# 10010-023
Fetal Bovine Serum	Avantor	Cat # 97068-085
MEM Non-essential Amino Acids (100X)	Gibco	Cat#11140050
Penicillin-Streptomycin (100X)	Corning	Cat # 30-002-CI
PlasmocinTM Prophylactic	InvivoGen	Cat# ant-mpp
0.05% trypsin-0.02% EDTA	Corning	Cat# 25-052-CI
Trypan Blue solution	MilliporeSigma	Cat# T8154
MTT Cell Proliferation Assay	ATCC	30-1010K
4% paraformaldehyde (PFA)	Boster	Cat# AR1068
G418	InvivoGen	Cat#ant-gn-1
Puromycin	InvivoGen	Cat#ant-pr-1
Polyethylenimine (PEI, 1 mg/mL)	Laboratory of Besim Ogretmen	N/A
Effectene transfection reagent	Qiagen	Cat#301425
Polybrene	Sigma-Aldrich	Cat#TR-1003-G
4X Laemmli Dye	Laboratory of Besim Ogretmen	N/A
Pierce RIPA buffer	Thermo Fisher Scientific	Cat# 89900
Pierce IP Lysis Buffer	Thermo Fisher Scientific	Cat# 87787
Protease Inhibitor Cocktail	Sigma-Aldrich	Cat# P8340
HALT Phosphatase Inhibitor	ThermoFisher Scientific	Cat# 78428
SuperSignal™ West Pico PLUS Chemiluminescent Substrate	Thermo Fisher Scientific	Cat# 34580
Protein Assay Dye Reagent	Bio-Rad	Cat#5000006
Precision Plus Protein Dual Color Standard	Bio-Rad	Cat#1610374
Magnetic SureBeads protein A or G	Bio-Rad	Cat#1614833
Polyvinylidene Difluoride (PVDF) Membrane	Cytivia	Cat#10600021
1X Tris-Glycine Transfer Buffer	Novex	Cat#LC3675
Bovine Serum Albumin (BSA)	Sigma-Aldrich	Cat#A7906-500G
Saponin	Thermo Fisher Scientific	Cat#A18820.14
Pierce Silver Stain Kit	Thermo Fisher Scientific	Cat#24612
Bio-Safe Coomassie Brilliant Blue	Bio-Rad	Cat #1610786
Duolink in situ hybridization	Sigma-Aldrich	Cat#DUO92101
Antigen Unmasking Solution, Citrate-Based (pH 6.0)	Vector Laboratories	Cat# H-3300
Vectashield Antifade Mounting Media with DAPI	Vector Laboratories	Cat#H-1200-10
Duolink In Situ PLA Probe	Millipore Sigma	Cat# DUO92002
MtPhagy Dye	Dojindo	Cat#MT02
LysoTracker Green Dye	Thermo Fisher Scientific	Cat#L7526
QuikChange XL Site-Directed Mutagenesis kit	Agilent Technologies	Cat#200516
Sulfamethoxazole	Thermo Fisher	Cat#S036125G
Trimethoprim	Thermo Fisher	Cat#AC455120050 Cat#C5678-500G
Carboxymethylcellulose (CMC)	MilliporeSigma	N/A
Human recombinant ANXA2 protein	R&D Systems	Cat#9409-AN-050
Porphyromonas gingivalis recombinant FimA protein	Laboratory of Dr. Özlem Yilmaz	Yilmaz et al.13
Porphyromonas gingivalis recombinant NDK protein	Laboratory of Dr. Özlem Yilmaz	Atanasova et al.17
Pierce Protein Transfection Reagent	Thermo Fisher Scientific	Cat#89850
DPBS	Thermo Fisher Scientific	Cat#28344
Critical commercial assays
Mitochondrial Isolation Kit for Cultured Cells	Thermo Fisher Scientific	Cat#89874
DNeasy Blood and Tissue Kit	Qiagen	Cat#69506
Deposited data
Original, uncropped western blot image files
Proteomics data	ProteomeXchange	PXD051568
Experimental models: Cell lines
Human: UMSCC1A	Millipore Sigma	Cat#SCC070
Human: UMSCC22A	Millipore Sigma	Cat#SCC076
Human: 293T	ATCC	Cat# CRL-3216
Mouse: MOC2	Kerafast	Cat# EWL002-FP
Human: UMSCC47	Millipore Sigma	Cat#SCC071
Human: UMSCC104	Millipore Sigma	Cat#SCC072
Human: SCC152	ATCC	Cat# CRL-3240
Experimental models: Organisms/strains
Mouse: C57BL/6J	The Jackson Laboratory	Strain#000664; RRID:IMSR_JAX:000664
Mouse: Nu/J	The Jackson Laboratory	Strain#002019; RRID:IMSR_JAX:002019
Oligonucleotides
Human E142A ANXA2 Forward Primer GAAGACACCTGCTGCGTATGACGC	Integrated DNA Technologies, IDT	N/A
Human E142A ANXA2 Reverse Primer GCTCAGAAGCGTCATACGCAGCAGG	Integrated DNA Technologies, IDT	N/A
Human K49A LC3 Forward Primer GCTGCCCGTCCTGGACGCGACCAAGTTTTTGTTC	Laboratory of Dr. Besim Ogretmen	N/A
Human K49A LC3 Reverse Primer CCGGGACCAAAAACTTGGTCGCGTCCAGGACGGG	Laboratory of Dr. Besim Ogretmen	N/A
Human F52A LC3 Primers	Laboratory of Dr. Besim Ogretmen	Dany et al.27
Human G120A LC3 Primers	Laboratory of Dr. Besim Ogretmen	Dany et al.27
P. gingivalis 16S rRNA FISH Probe 5′-CAATACTCGTATCGCCCGTTATTC-3′	Laboratory of Dr. Özlem Yilmaz	Lee et al.6
Recombinant DNA
ANXA2 Human shRNA	Millipore Sigma	TRCN0000056145 (Clone ID), 302 (Gene ID), NM_001002857 (RefSeq), pLKO.1 vector
LC3 Human shRNA	Laboratory of Dr. Besim Ogretmen	Dany et al.27
CerS1 Human shRNA	Laboratory of Dr. Besim Ogretmen	Olenik et al.26
psPAX2 Lentiviral Packaging Plasmid	Laboratory of Dr. Besim Ogretmen	Addgene plasmid #12260, http://n2t.net/addgene:12260, RRID:12260
pMD2.G VSV-G Envelope Expressing Plasmid	Laboratory of Dr. Besim Ogretmen	Addgene plasmid #12259, http://n2t.net/addgene:12259, RRID:12259
pHAGE-mt-mKeima	Laboratory of Dr. Richard Youle	Addgene plasmid #131626, http://n2t.net/addgene:131626, RRID:131626
Software and algorithms
ImageJ Version 1.54days	NIH Image	https://imagej.net/ij/index.html
Fiji	NIH Image	http://imagej.net/Fiji
Prism 8.0.1	GraphPad	https://www.graphpad.com/scientific-software/prism/
BioRender	BioRender	https://www.biorender.com/
Duolink Image Tool Software	Olink Bioscience	N/A
FV10i	Olympus Corp.	FV10-ASW http://www.grapecity.com