Table 1.
Characteristics of primers for Q-PCR experiments
| Sequencesa | Exon or ANb | Amplicon size (bp) | Tm (°C) |
|---|---|---|---|
| Genes encoding PADs | |||
| PADI1 | |||
| agagtgacatcgtggacattc | 15 | 231 | 86 |
| gctcgtggtaggacaagtagtc | 16 | ||
| PADI2 | |||
| ggtgggatgagcagcaagcgaatc | 14 | 165 | 86 |
| gaacagagcgggcaggtcaatgatg | 15 | ||
| PADI3 | |||
| gcagagtgtgacatcattgacatcc | 15 | 173 | 87 |
| gaccgcaccttctcctccag | 16 | ||
| PADI4 | |||
| ccacacggggcaaactgtc | 6 | 170 | 87 |
| cagcagggagatggtgaggg | 7 | ||
| PADI6 | |||
| cgtggagaagtgcattcacctgaac | 14 | 152 | 86 |
| gcctcgcaaaggacctcttggg | 15 | ||
| Differentiation marker genes | |||
| FLG | |||
| gcaaggtcaagtccaggagaa | NM_002016 | 122 | 85 |
| ccctcggtttccactgtctc | |||
| IVL | |||
| gccaggtccaagacattcaac | NM_005547 | 110 | 86 |
| gggtggttatttatgtttgggtgg | |||
| KRT10 | |||
| tgatgtgaatgtggaaatgaatgc | NM_000421 | 147 | 83 |
| gtagtcagttccttgctcttttca | |||
| LGALS7 | |||
| ctggcacggtgctgagaat | NM_002307 | 149 | 88 |
| cttgctgttgaagaccacctc | |||
| House keeping genes | |||
| YWHAZ | |||
| acttttggtacattgtggcttcaa | NM_003406 | 94 | 82 |
| ccgccaggacaaaccagtat | |||
| B2M | |||
| acccccactgaaaaagatga | NM_004048 | 114 | 83 |
| atcttcaaacctccatgatg | |||
| GAPDH | |||
| tgcaccaccaactgcttagc | NM_002046 | 87 | 84 |
| ggcatggactgtggtcatgag | |||
Tm Melting temperature of the amplicon as observed during experimental validations of the primer pairs for real time PCR
aFor each gene, the first sequence is the upper primer and the second one is the lower; PADI peptidylarginine deiminase, FLG profilaggrin, IVL involucrin, KRT10 keratin 10, LGALS7 galectin 7, YWHAZ tyrosine 3/tryptophan 5-monooxygenase activation protein, zeta polypeptide, B2M beta-2-microglobulin, GAPDH glyceraldehyde-3-phosphate dehydrogenase
bAN GenBank accession number. For PADI genes, the ANs are as follows: PADI1, AB033768; PADI2, AB030176; PADI3, AB026831; PADI4, AB017919; PADI6, AY422079