Type IV Pilus Genes pilA and pilC of Pseudomonas stutzeri Are Required for Natural Genetic Transformation, and pilA Can Be Replaced by Corresponding Genes from Nontransformable Species

Abstract

Pseudomonas stutzeri lives in terrestrial and aquatic habitats and is capable of natural genetic transformation. After transposon mutagenesis, transformation-deficient mutants were isolated from a P. stutzeri JM300 strain. In one of them a gene which coded for a protein with 75% amino acid sequence identity to PilC of Pseudomonas aeruginosa, an accessory protein for type IV pilus biogenesis, was inactivated. The presence of type IV pili was demonstrated by susceptibility to the type IV pilus-dependent phage PO4, by occurrence of twitching motility, and by electron microscopy. The pilC mutant had no pili and was defective in twitching motility. Further sequencing revealed that pilC is clustered in an operon with genes homologous to pilB and pilD of P. aeruginosa, which are also involved in pilus formation. Next to these genes but transcribed in the opposite orientation a pilA gene encoding a protein with high amino acid sequence identity to pilin, the structural component of type IV pili, was identified. Insertional inactivation of pilA abolished pilus formation, PO4 plating, twitching motility, and natural transformation. The amounts of ³H-labeled P. stutzeri DNA that were bound to competent parental cells and taken up were strongly reduced in the pilC and pilA mutants. Remarkably, the cloned pilA genes from nontransformable organisms like Dichelobacter nodosus and the PAK and PAO strains of P. aeruginosa fully restored pilus formation and transformability of the P. stutzeri pilA mutant (along with PO4 plating and twitching motility). It is concluded that the type IV pili of the soil bacterium P. stutzeri function in DNA uptake for transformation and that their role in this process is not confined to the species-specific pilin.

The soil bacterium Pseudomonas stutzeri is capable of natural genetic transformation (10). This phenomenon involves the binding of extracellular DNA to the bacterial cell, the active uptake of the bound DNA, and the heritable integration of its genetic information. Natural transformation has been observed in bacterial species from various taxonomic and trophic groups, including Proteobacteria, cyanobacteria, and Archaeobacteria, and is considered a major mechanism of horizontal gene transfer encompassing chromosomal and plasmid DNA (25, 45, 46).

The physiological state in which cells are transformable is termed competence and is reached in the late log phase of broth-grown cultures of P. stutzeri (22). Competence is also achieved in media prepared from aqueous extracts of various soils (23, 24). During these studies, it was found that P. stutzeri responds to limitations of single nutrients like C, N, or P by an up-to-290-fold stimulation of transformation (23, 24). Other studies showed that P. stutzeri cells can take up DNA adsorbed on the surface of sand grains (22). Further, P. stutzeri is naturally transformable by broad-host-range plasmids like RSF1010 (3), even when these plasmids do not contain inserts of chromosomal P. stutzeri DNA (9). More recently, the transformation of P. stutzeri in nonsterile soil by added DNA or by DNA released from bacteria in the soil was demonstrated (42). Initial observations suggested that P. stutzeri preferentially takes up DNA of its own species (10, 22), but recent studies show that DNA from other prokaryotic or eukaryotic sources is taken up with efficiency similar to that with which P. stutzeri DNA is taken up (N. Weger, R. Hashemi, and W. Wackernagel, unpublished data).

In an attempt to identify the genetic determinants for competence and transformability and to provide the basis for studies on the regulation of their expression, we have isolated transformation-deficient mutants of P. stutzeri after transposon and insertion mutagenesis. Here, we report on mutants which demonstrate that P. stutzeri has genes for the formation of type IV pili (50) and that these are essential for genetic transformation of P. stutzeri. In particular, we show that insertional inactivation of the newly identified gene for the structural protein component of pili, pilA, and another new gene necessary for pilus formation, pilC, abolished transformation by chromosomal and plasmid DNA through the prevention of competence-specific DNA binding.

MATERIALS AND METHODS

Bacterial strains and culture conditions.

The bacterial strains and plasmids used are listed in Table 1. P. stutzeri and Escherichia coli were grown on Luria-Bertani (LB) agar plates or in LB liquid medium (37). Incubations were at 37°C. If necessary, LB medium was supplemented with ampicillin (1 g liter⁻¹ for P. stutzeri; 100 mg liter⁻¹ for E. coli), gentamicin (10 mg liter⁻¹), kanamycin (60 mg liter⁻¹), streptomycin (1 g liter⁻¹ for P. stutzeri; 100 mg liter⁻¹ for E. coli), rifampin (20 mg liter⁻¹) or nalidixic acid (50 mg liter⁻¹). The minimal medium for P. stutzeri was minimal pyruvate (MP) agar medium (23).

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant genotype or characteristic(s)	Source or reference
Strains
E. coli
S17-1	recA	44
SF8recA	recA56	17
XL10	recA; Tcr	Stratagene
P. stutzeri
APS121	recA::Tn5; Kmr	54
JM375	Rifr Smr	10
JM302	hisX	10, 43
LO15	JM302, Rifr Nalr	This study
	LO15(pRSF1010d)	This study
	LO15(pUCP19)	This study
Tf81	LO15pilC::pSUP102GmTn5B20	This study
	Tf81(pRSF1010d)	This study
	Tf81(pCOM81)	This study
	Tf81(pCOM81a)	This study
Tf300	LO15pilA::Gmr	This study
	Tf300(pUCP19)	This study
	Tf300(pAW102-O)	This study
	Tf300(pAW103-K)	This study
	Tf300(pAW107-Dn)	This study
	Tf300(pUCA1)	This study
Plasmids
pRSF1010	Smr Sur	3
pRSF1010d	pRSF1010 with an 800-bp PstI deletion inactivating the Sur gene	This study
pCOM81	pRSF1010d carrying 10.8 kb of chromosomal JM375 DNA	This study
pCOM81a	pCOM81 subclone carrying 3.1 kb of chromosomal JM375 DNA	This study
pSUP102GmTn5B20	Kmr Gmr	44
pSI1	his+ Smr	43
pST81	About 40 kb of religated chromosomal DNA of Tf81 including insertion of pSUP102GmTn5B20	This study
pUCP19, pUCP18	oricolE1oripRO1600 Apr	40
pAW102-O	pUCP19 carrying pilA+ of P. aeruginosa PAO	53
pAW103-K	pUCP19 carrying pilA+ of P. aeruginosa PAK	53
pAW107-Dn	pUCP18 carrying pilA+ of D. nodosus	53
pUCA1	pUCP19 carrying pilA+ of LO15	This study
pUCA1Gm	pUCA1 with a Gmr insertion in pilA+	This study
pUCGm	Apr Gmr	41

DNA manipulations and plasmid and strain constructions.

Plasmids and genomic DNA were prepared by using Qiagen columns (Qiagen, Hilden, Germany) according to the instructions of the manufacturer. Electrocompetent cells of P. stutzeri and E. coli were prepared according to the methods of Pemberton and Penfold (33) and Dower et al. (13), respectively. A gene bank of JM375 was obtained by partial digestion of chromosomal DNA with PstI, ligation of fragments of about 6 to 12 kb to RSF1010d (Table 1), and transformation of P. stutzeri APS121 by electroporation (12.5 kV cm⁻¹, 25 μF, 200 Ω; Gene Pulser; Bio-Rad Laboratories, Richmond, Calif.). The subclone pCOM81a was constructed by treatment of pCOM81 with EcoRI and NdeI and subsequent ligation resulting in a 7.7-kb deletion. The plasmid was electroporated into Tf81. Plasmid pST81 was obtained by partial restriction of chromosomal Tf81 DNA with SacI, ligation, and transformation of E. coli SF8recA. The pilA complementing plasmid pUCA1 was constructed by PCR amplification of the pilA gene from chromosomal LO15 DNA using the primers PILAPRO4 (5′CATGCCGGCATACTAGACAT3′) and PILA4 (5′TTAGGAGCACTTGCCTGGCTTGTAC 3′), ligation to SmaI-treated pUCP19, and transformation of E. coli XL10. For construction of Tf300, pUCA1 was treated with BglII and ligated to a gentamicin resistance gene from pUCGm DNA (40). For mutant constructions, integration of insertion mutant alleles was by homologous recombination during plate transformation.

Transposon mutagenesis of P. stutzeri.

Transposon mutagenesis of P. stutzeri was performed essentially according to the method of Simon et al. (43) using cells from the mobilizing E. coli strain S17-1 carrying pSUP102GmTn5B20 as donor cells and from LO15 as recipient cells. After conjugation on a filter for 16 h at 37°C, the cells were resuspended in 0.9% NaCl and plated on LB agar supplemented with rifampin, nalidixic acid, and kanamycin.

DNA sequencing.

DNA sequencing was performed by the dideoxynucleotide chain termination method (38) with a cycle sequencing kit (GATC, Constance, Germany) and thermosequenase (Amersham, Braunschweig, Germany). The sequencing products were separated on a 1500 Long Run DNA Sequencer (GATC) and directly blotted onto a positively charged nylon membrane according to the instructions of the manufacturer. For sequencing of the pilABCD region, pCOM81a and pST81 were used.

Plate transformation of P. stutzeri. (i) Qualitative plate transformation.

The method of Hahn et al. (18) was adapted to P. stutzeri. P. stutzeri colonies were replica plated onto MP agar supplemented with kanamycin, rifampin, and nalidixic acid. The plates contained a low concentration of histidine (0.5 mg liter⁻¹) sufficient for growth of about two generations (for integration and expression of the his⁺ allele) and were streaked with 2 μg of chromosomal DNA of JM375 (his⁺). Clones which formed his⁺ colonies within 2 days were considered transformation proficient; nongrowing clones were suspected to be transformation-deficient.

(ii) Quantitative plate transformation.

The quantitative plate transformation procedure was performed according to the method of Lorenz and Wackernagel (23), except that 10 μg of JM375 DNA ml⁻¹ was used and incubation of the cells on a fresh LB agar plate with DNA was overnight at 37°C.

Transformation in liquid culture.

Competent cells were prepared and stored at −80°C as described previously (22). The cells were thawed at room temperature and aerated at 37°C for 2 to 3 h. Culture samples of 0.25 ml were mixed with 0.25 μg of transforming his⁺ DNA from a concentrated stock solution and incubated for 90 min at 37°C. Then DNase I was added (final concentration, 100 μg ml⁻¹). After incubation for 15 min at 37°C the cells were plated on LB (viable count) and MP (his⁺ transformants) agar. The frequency of transformation was defined as the number of his⁺ colonies per viable count.

Plating of PO4 and determination of twitching motility.

Plaque formation of PO4 on P. stutzeri was performed in a spot test as described by Bradley (8). Twitching motility was determined by inspecting single colonies of P. stutzeri for spreading zones on LB agar after incubation in a humid atmosphere at 37°C for 10 days.

DNA binding and uptake of competent cells.

Purified transforming DNA isolated from P. stutzeri JM375 (his⁺) was labeled with ³H-deoxythymidine triphosphate (specific activity, 63 Ci/mmol) by nick translation using the kit of Promega (Madison, Wis.). The DNA was purified by filtration on Microcon-100 (Amicon, Witten, Germany). The specific radioactivity of the DNA was 7 × 10⁶ cpm/μg. The DNA fragments had a mean size of about 20 kb, as determined by gel electrophoresis. A competent cell suspension stored at −80°C was thawed at room temperature and aerated for 2 to 3 h at 37°C. To 0.5 ml of cell suspension, 0.5 μg of ³H-DNA (in a 1-μl volume) was added and aeration was continued for 90 min. The cells of 0.5-ml samples either treated with DNase I (100 μg/ml for 15 min at 37°C) or not treated were sedimented through 1 ml of 10% glycerol for 15 min at 15,000 × g. The cell pellet was resuspended in 0.4 ml of wash buffer (0.5% NaCl, 10 mM Tris HCl [pH 7.5]) and again sedimented through 10% glycerol. This was done a third time. The cells were then resuspended in 1 ml of wash buffer, and the radioactivity associated with the cells was determined in a liquid scintillation counter. The cell number was determined in a 5-μl sample in a counting chamber under the light microscope to relate radioactivity to the number of recovered cells.

Electron microscopy.

Sample grids with Formvar film were touched to microcolonies grown after 12 to 15 h at 37°C on LB agar plates. The grids were floated for 10 min on a drop of 1% uranyl acetate for staining. After air drying for 15 min, transmission electron microscopy was performed with a Zeiss JM109A electron microscope.

Nucleotide sequence accession number.

The nucleotide sequence of the pilABCD region has been deposited in the EMBL database under accession no. AJ132364.

RESULTS

Isolation of transformation-deficient mutants.

After transposon mutagenesis about 3.3 × 10⁴ Km^r mutants of LO15 (hisX) were screened for transformation deficiency by a qualitative replica plate transformation assay. The putative transformation-deficient clones were examined for their UV sensitivity to discriminate possible recombination-deficient mutants which were assumed to be detected by their repair deficiency. Additionally, the clones were subjected to a screening for extracellular DNase activity according to the method of Basse et al. (4) to exclude the possibility that the transformation deficiency resulted from increased DNase production. Finally, the mutants were electroporated with pSI1 (42) carrying the hisX gene. Those mutants which then did not grow on histidine-free minimal medium were assumed to have a transposon insertion in another his gene. Such mutants were found, suggesting that the genes for histidine biosynthesis are not clustered on the P. stutzeri genome. With the 39 mutants remaining after these tests a quantitative plate transformation test was performed. Compared to that of the LO15 cells, the transformation frequencies of the various mutants ranged from 0.1 to less than 0.00003.

Identification of a pilC insertion mutant.

One mutant (Tf81) was not transformable with chromosomal DNA (Table 2) or with plasmid DNA (Weger et al., unpublished data). Strain Tf81 was used in complementation studies with 6- to 12-kb JM375 chromosomal DNA fragments present in plasmids of a P. stutzeri gene bank. Clones of Tf81 obtained by electroporation with gene bank plasmids were screened for the ability to be naturally transformed by chromosomal his⁺ DNA. A gene bank plasmid which restored transformability of Tf81 (pCOM81) (Table 2) had an insert of about 10.8 kb. Subcloning of insert fragments revealed that a 3.1-kb fragment fully complemented Tf81. Sequencing of the insert showed that it covered a complete open reading frame (ORF) of 405 triplets which was probably transcribed from the sulfonamide resistance gene promoter of the vector pRSF1010. The deduced amino acid sequence displayed two transmembrane helices and had 75% amino acid identity to PilC of Pseudomonas aeruginosa, which is a highly hydrophobic accessory protein in type IV pilus biogenesis (29). Sequencing of genomic DNA of Tf81 confirmed that in this strain pilC was inactivated by transposon insertion (see below). This suggested that P. stutzeri has type IV pili and that they might be necessary for genetic transformation. The formation of type IV pili by P. stutzeri LO15 and Tf81 was tested with the pilus-dependent phage PO4 (8). As shown in Table 2, the phage plated on LO15 cells, indicating that these had intact pili, and did not plate on strain Tf81. Complementation of Tf81 with pCOM81 or pCOM81a restored plating of PO4 (Table 2).

TABLE 2.

Transformation frequencies, PO4 sensitivities, and twitching motilities of P. stutzeri

Straina	Relevant pil allele		Transformation frequencyb	PO4 plating behaviorc	Twitching motilityd
	Chromosome	Plasmid
LO15	pil+		1	+	+
Tf81	pilC		≤0.00003	−	−
Tf81(pCOM81)	pilC	pilC+	1.1	+	+
Tf81(pCOM81a)	pilC	pilC+	1.1	+	+
Tf300	pilA		≤0.00019	−	−
Tf300(pUCA1)	pilA	pilA+	0.9	(+)	+

^aAs controls, the vectors corresponding to the plasmids with the pilC⁺ or pilA⁺ gene were introduced into LO15, Tf81, or Tf300, generating LO15(pRSF1010d), LO15(pUCP19), Tf81(pRSF1010d), and Tf300(pUCP19). These strains exhibited transformation frequencies, PO4 plating behaviors, and twitching motilities similar to those exhibited by the corresponding strains lacking vector plasmids. 

^bTransformation frequencies obtained by plate transformation are given relative to that obtained with LO15 (2 × 10⁻⁵). 

^cPhage titer was 10⁸ phages ml⁻¹, and 0.02-ml volumes were spotted. +, confluent lysis of cells; (+), single plaques, −, no visible plaques. 

^d+, twitching motility was observed; −, twitching motility was not observed after 10 days of incubation on LB agar plates. 

Electron microscopic examination of LO15 revealed the presence of pili which were about 6 nm thick and 1 to 2 μm long (Fig. 1) resembling the type IV pili of P. aeruginosa. Pili were mainly found at the cell poles. The pili were absent from cells of the Tf81 mutant (Fig. 1), indicating that pilC is required for pilus biogenesis. The PO4 plating test was applied to the other transformation-deficient mutants. Of these mutants, 32 were resistant to PO4 and 6 were not.

FIG. 1.

Transmission electron microscopic visualization of type IV pili. From left to right, the three images show strain LO15 (pil⁺), the pilC mutant Tf81, and the pilA mutant Tf300. Magnification, ×38,000. On each of the three cells, the polar flagellum is also visible.

Twitching motility.

We noticed that extended incubation of P. stutzeri LO15 colonies at 37°C in a humid atmosphere produced a thin growth halo around the colonies (Fig. 2). This resembled the phenomenon of twitching motility seen before with strains of P. stutzeri (19) and other type IV pilus-producing strains (19, 50, 54). The growth halo was absent in cultures of strain Tf81, the pilC mutant (Fig. 2). In cultures of Tf81 with pCOM81 or pCOM81a, twitching motility was fully restored (Table 2).

FIG. 2.

Twitching motility of P. stutzeri on agar plates. Cells were streaked on LB agar and incubated for 10 days in a humid atmosphere at 37°C. On the left side is LO15 (pil⁺) and on the right side is the pilC mutant Tf81.

Characterization of pilB, pilD, and orfX.

The nucleotide sequences of the insert in pCOM81a upstream and downstream of pilC showed incomplete ORFs with deduced amino acid sequences similar to PilB and PilD of P. aeruginosa. Since the gene bank plasmid contained no further chromosomal DNA beyond the partial pilB and pilD genes, we used a new strategy to obtain the missing DNA. Previously, we had noticed that Tf81 was not only kanamycin resistant, as expected from the Tn5B20 insertion, but also gentamicin resistant. This could be explained if not only the transposon but also its vector pSUP102Gm, containing a gentamicin resistance gene (43), had been inserted into the chromosome. Such events occur when a Tn5-containing plasmid dimerizes and then cointegrates by transposase action. This leads to various types of transposition cointegrates in the host chromosome (6). PCR analyses indicated that in the P. stutzeri mutant Tf81, transposition from the presumably dimeric plasmid was mediated by two IS50R elements, resulting in a chromosomal insertion of the vector with two IS50R elements at the borders and one internal IS50L element. By partial restriction of chromosomal Tf81 DNA with SacI (which cleaves only once in pSUP102GmTn5B20), ligation, and transformation of E. coli, plasmids mediating resistance to kanamycin and gentamicin were obtained. One plasmid, named pST81, with a size of about 40 kb was used for the sequencing of regions adjacent to pilC. Before that, the transposon insertion site was identified to be about in the middle of pilC (nucleotide [nt] position 2528), verifying the complementation of Tf81 by pCOM81a. Then, the remaining parts of pilB and pilD were sequenced. The deduced PilB and PilD protein sequences had 79.5% and 79.0% amino acid identity to PilB and PilD of P. aeruginosa, which are accessory proteins in type IV pilus biogenesis (29). The probably cytoplasmically located PilB protein of P. stutzeri contains a conserved ATP or GTP binding site at nt positions 5438 to 5461. The PilD protein is probably integrated in the inner membrane by six membrane-spanning sequences. Downstream of pilD a gene named orfX was sequenced which codes for a conserved hypothetical protein with unknown function found in many other species. Mutants of Neisseria gonorrhoeae containing an insertion in orfX exhibited a severely restricted growth phenotype but expressed pili and were naturally transformable (14).

Identification of pilA.

The sequence upstream of pilB contained an ORF of 420 nt oriented opposite to pilB. The derived protein had 50.3% amino acid identity to fimA of Xanthomonas campestris, which is a type IV pilin (31). The sequence also had high similarity to pilin genes of other species that all share a short hydrophilic leader peptide and the characteristic hydrophobic N-terminal region starting with a phenylalanine in the mature protein (2). The PilA protein of P. stutzeri contains a putative ATP or GTP binding site motif at nt positions 5438 to 6461, unusual for pilin proteins. It is not clear whether this site is functional in ATP or GTP hydrolysis or in which processes this would be involved.

A defective pilA allele was constructed by insertion of a gentamicin resistance gene into the BglII site of pUCA1 to yield pUCA1Gm (Table 1). The mutant allele was naturally transformed into the chromosome of an LO15 cell to yield the pilA::Gm^r strain Tf300. The strain was PO4 resistant, did not show twitching motility (Table 2), and had no pili visible in the electron microscope (Fig. 1). Strain Tf300 was deficient for transformation with chromosomal DNA (Table 2) and plasmid DNA (Weger et al., unpublished data). All defects of Tf300 were complemented by plasmid pUCA1 (Table 2), although the PO4 plating efficiency was lower than that observed for LO15. Overexpression of pilA in P. aeruginosa was previously observed to reduce PO4 plating (54). These findings would be consistent with pilA providing the structural protein for type IV pilus biogenesis.

The pilA gene of P. aeruginosa is under the control of a ς⁵⁴ promoter (32). A putative ς⁵⁴ promoter consensus sequence is present in the P. stutzeri sequence at nt positions 5065 to 5081. Upstream, a putative NifA-like recognition sequence (nt positions 5007 to 5023) is present that might be a transcriptional activator binding site characteristic for ς⁵⁴ promoters (20). The pilA gene of P. stutzeri presumably starts at nt position 5126, preceded by a typical ribosome binding site, and ends at nt position 5546, followed by a perfect inverted repeat sequence of 13 nucleotides (ΔG, −28.7 kcal mol⁻¹) that could function as a rho-independent transcription terminator.

DNA binding and uptake.

In transformation-deficient mutants of Acinetobacter sp. strain BD4 with defects in genes coding for pilin-like and accessory proteins for pilus biogenesis, the binding of DNA was abolished (21, 36). We measured the interaction of ³H-labeled chromosomal P. stutzeri DNA with LO15 cells. In previous experiments we had shown that the kinetics of DNA binding, uptake (measured as the fraction of DNase I-resistant DNA associated with the cells), and transformant formation were parallel and reached a plateau after about 90 min of incubation of competent cells with DNA (Weger et al., unpublished data). When the cells were taken from the competence peak (reached at a culture density of about 0.5 × 10⁹ to 1 × 10⁹ cells/ml), DNA binding of about 150 pg/5 × 10⁸ cells was found (Table 3) and about one-third of the DNA associated with the cells was taken up into a DNase I-resistant state within 90 min. The DNA concentration of 1 μg/ml in these experiments was below saturation and corresponded to the concentration used in normal transformation experiments. DNA binding, DNA uptake, and transformation were drastically reduced when cells were allowed to grow further or to stationary phase (Table 3). These findings suggested competence-specific binding and uptake of DNA by LO15 cells. In contrast, cells of pilA and pilC mutants, grown to the phase in which maximum competence of LO15 was observed, bound roughly eight- and sixfold less DNA, respectively, and uptake was reduced about fourfold (Table 3). Even with stationary-phase cells of the pilA and pilC mutants, some DNA binding and uptake were seen as with LO15. Apparently, cells of the parental strain and the pil mutants bind low amounts of DNA irrespective of competence and a part of this DNA is not degradable by DNase I. The data in Table 3 indicate that mature pilin or type IV pilus formation is necessary for the transformation-related binding and uptake of DNA by P. stutzeri.

TABLE 3.

Binding and uptake of ³H-thymidine-labeled DNA by cells of LO15 and transformation-deficient mutants

Strain	Culturea	No. of pg of DNA/5 × 108 cellsb		n	Transformation frequencyc
		Bound	Taken up
LO15	Competent	152.3 ± 41.0	41.0 ± 28.3	6	2 × 10−4
	Postcompetent	20.0 ± 8.2	4.9 ± 1.3	3	3 × 10−7
	Overnight	7.7 ± 5.4	6.7 ± 2.7	4	≤5 × 10−8
Tf300 (pilA)	Competent	17.9 ± 5.5	10.4 ± 3.9	8	≤2 × 10−8
	Overnight	13.3 ± 8.1	5.2 ± 2.6	2	ND
Tf81 (pilC)	Competent	26.7 ± 11.5	10.0 ± 2.2	6	≤2 × 10−8
	Overnight	6.4 ± 1.4	4.8 ± 0.7	2	ND

^aCompetent cultures were from the late logarithmic growth phase and had titers of about 5 × 10⁸ cells/ml, postcompetent cell cultures had titers of about 3 × 10⁹ cells/ml, and overnight cultures had titers of about 8 × 10⁹ cells/ml; cell titers were adjusted with culture supernatant to concentrations of 5 × 10⁸ to 8 × 10⁸ cells/ml. 

^bThe data shown are averages ± standard deviations (n = 3 to 8) or deviations from the mean (n = 2). 

^chis⁺ transformants were obtained by liquid transformation (see Materials and Methods) at a concentration of 1 μg of chromosomal his⁺ DNA/ml of culture; ND, not determined in these experiments because strains were transformation deficient. 

Complementation of pilA by heterologous genes coding for pilin.

Watson et al. showed that twitching motility and PO4 plating can be partially restored in P. aeruginosa by heterologous pilA (54). To investigate whether a pilA defect of P. stutzeri can be complemented by foreign structural genes for type IV pili, Tf300 was transformed with plasmids carrying the pilin genes of P. aeruginosa PAK, P. aeruginosa PAO, or Dichelobacter nodosus (54). The foreign pilin genes supported twitching motility and partially restored PO4 plating (Table 4).

TABLE 4.

Transformation frequencies, PO4 sensitivities, and twitching motilities of Tf300 complemented with different heterologous genes coding for pilin

Straina	Relevant genotype		Transformation frequencyb	PO4 plating behaviorc	Twitching motilityd
	Chromosome	Plasmide
LO15a	pilA+		1	+	+
Tf300a	pilA		≤0.00019	−	−
Tf300	pilA	pAW102-O	1.4	(+)	+
Tf300	pilA	pAW103-K	0.3	(+)	+
Tf300	pilA	pAW107-Dn	0.8	(+)	+

^aAs controls, the vector corresponding to the plasmids with the heterologous pilA⁺ genes was introduced into LO15 and Tf300, generating LO15(pUCP19) and Tf300(pUCP19). These strains exhibited transformation frequencies, PO4 plating behaviors, and twitching motilities similar to those exhibited by the corresponding strains lacking vector plasmids. 

^bTransformation frequencies are given relative to that obtained with LO15 (2 × 10⁻⁵). 

^cPhage titer was 10⁸ phages ml⁻¹, and 0.02-ml volumes were spotted. +, confluent lysis of cells; (+), single plaques; −, no visible plaques. 

^d+, twitching motility was observed; −, twitching motility was not observed after 10 days of incubation on LB agar plates. 

^epAW102-O carried pilA⁺ of P. aeruginosa PAO, pAW103-K carried pilA⁺ of P. aeruginosa PAK, and pAW107-Dn carried fimA⁺ of D. nodosus. 

Additionally, pili were seen in the electron microscope (Weger et al., unpublished data). This supported the suggestion made above that PilA of P. stutzeri is the structural protein of the pilus and that in P. stutzeri the processes of twitching motility and PO4 plating are not dependent on the species-specific pilin.

Even more interesting is the finding that the transformation deficiency of Tf300 was effectively complemented by the three heterologous genes (Table 4). This is the first time that genes from nontransformable species were shown to function in replacing a protein essential for DNA uptake of a naturally transformable species.

DISCUSSION

The characterization of the first transformation-deficient mutant isolated from P. stutzeri following transposon mutagenesis revealed that a gene essential for type IV pilus biogenesis was inactivated. This gene was termed pilC. The deduced protein was highly similar to PilC of P. aeruginosa and that of the corresponding proteins involved in pilus biogenesis, protein secretion, and DNA uptake of other bacteria (2). The pilC mutant of P. stutzeri did not plate the type IV pilus-dependent phage PO4, was defective in the pilus-mediated phenomenon of twitching motility, and had no pili visible in the electron microscope. It was further found that pilC of P. stutzeri is located in a cluster of pil genes including pilB and pilD and that a prepilin-coding gene, pilA, is located next to pilB and transcribed in the opposite direction. This arrangement of genes is identical to that in P. aeruginosa (29). In this organism, pilB, pilC, and pilD code for accessory proteins for pilus genesis, of which PilD is the prepilin peptidase necessary for processing of prepilin to pilin and methylation of the N-terminal phenylalanine (30, 49). Insertional inactivation of pilA in P. stutzeri abolished pilus formation, twitching motility, PO4 plating, and transformability. These defects were reversed by providing the cloned pilA gene in trans, indicating the absence of a polar effect of the insertion (Table 4). From these observations and the fact that heterologous genes for pilus structural proteins restored pilus formation (verified by electron microscopy) in the pilA mutant, it is concluded that the soil bacterium P. stutzeri has type IV pili, with pilA coding for the structural protein.

So far, predominantly pathogenic bacteria including N. gonorrhoeae, Neisseria meningitidis, P. aeruginosa, D. nodosus, Moraxella spp., and Legionella pneumophila were shown to have type IV pili (48, 50), which are thought to mediate adhesion to epithelial cells, which is believed to be a key step in the initiation of infections (5, 44). Recently, the bacterium Azoarcus was shown to have type IV pili which are essential for the establishment of bacteria on the root surface of rice seedlings and for adhesion to the mycelium of an ascomycete (11). It is not clear whether pili have a function in interactions of the soil bacterium P. stutzeri with host organisms.

Our studies with pilA and pilC mutants show that for natural transformation of P. stutzeri expression of pilA and pilC is required. The function of PilC may be limited to the export of processed PilA, but it is conceivable that other proteins necessary for competence are also dependent on PilC for export. From our data we cannot distinguish whether only the export of mature pilin or the formation of pili is required for competence. This question also remains open when looking at other transformable gram-negative bacteria which form type IV pili. On the one hand, nonpiliated mutants of N. gonorrhoeae (15, 41), N. meningitidis (51), Moraxella liquefaciens (7), and Legionella pneumophila (47) have lost transformability or give 1,000-fold lower transformation frequencies. On the other hand, strains of an Acinetobacter sp. defective in genes coding for type IV prepilin-like and accessory proteins were transformation deficient but fully piliated (21, 35). Further, proteins having remarkable levels of amino acid sequence identity to those of pilin and accessory proteins PilB, PilC, and PilD are required for competence of Haemophilus influenzae (12) and the gram-positive bacteria Bacillus subtilis (1, 28), S. pneumoniae (34) and S. gordonii (26). However, the proteins do not promote pilus formation in these bacteria.

The role of pili or pilin in DNA uptake is not yet clear. In extension of the phage PO4 infection theory of Bradley (8), it has been hypothesized that in Neisseria pilus retraction would translocate DNA into the periplasmic space (16). In Acinetobacter, the pilin-like and accessory proteins are necessary for binding of DNA by competent cells (21, 35). Our studies with radiolabeled DNA suggest that also in P. stutzeri PilA protein or pili are required for competence-specific binding of DNA and are probably also involved in its transport into a DNase-resistant state. That the mere formation of pili from pilin is not sufficient for successful DNA uptake is concluded from the transformation deficiency of a pilT mutant which is hyperpiliated (Weger et al., unpublished data). The mutant cells are defective in twitching motility and PO4 infection, suggesting that retractable pili are necessary for these processes and DNA uptake. In Neisseria, the piliated pilT strains were also defective in DNA uptake and twitching motility (55). The Neisseria pili do not bind DNA (27). Thus, our presently favored model of DNA uptake by P. stutzeri (and perhaps other transformable gram-negative organisms) would include pilus-mediated binding of DNA to a receptor protein not exposed to DNA in the absence of pilus formation. Binding is followed by retraction of the pilus, with concomitant translocation of DNA (perhaps together with the putative DNA binding protein) into a DNase I-resistant state. This could be the periplasmic space. Recent studies show that the pilin-like proteins of B. subtilis (encoded by comGC, comGD, comGE, and comGG) direct DNA to the competence-specific DNA binding protein ComEA (36). From the periplasm, DNA is translocated through the cytoplasmic membrane.

Substitution of the P. stutzeri pilA gene by the corresponding genes from three nontransformable bacteria caused transformation, pilus formation, twitching motility, and PO4 infection. This underlines the necessity of functional pili for DNA uptake and, at the same time, indicates the absence of species specificity of pilin for DNA internalization and other functions. It also suggests that the presumptive ATP or GTP binding site observed in the amino acid sequence of the P. stutzeri PilA protein is not involved in transformation, since the heterologous proteins do not have such a site. The fact that several of the transformation-deficient mutants isolated from P. stutzeri are not defective for pilus biogenesis indicates that other gene functions are additionally required for transformation. When these genes are identified it will be interesting to see whether complements to them are lacking in P. aeruginosa and other pseudomonads, which lack could explain why these organisms are not transformable.