Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens, female) | 293T | ATCC | ATCC: CRL-3216 | |
| Cell line (Homo sapiens, male) | MRC5 +ACE2 | Raymonda et al., 2022 | ATCC: CCL-171 | |
| Strain (coronavirus) | SARS-CoV-2 | BEI resources | NR-52282 | Isolate Hong Kong/VM20001061/2020 |
| Strain (coronavirus) | SARS-CoV-2 | European Virus Archive | 014 V-03890 | Isolate BetaCoV/France/ IDF0372/2020 |
| Commercial assay or kit | RNA Clean & Concentrator-5 kit | Zymo | R1013 | |
| Software, algorithm | GraphPad Prism | Dotmatics | Prism 10, version 10.2.2 (341) | |
| Software, algorithm | Chimera | Pettersen et al., 2004 | X-1.6.1 | |
| Gene (Homo sapiens) | TRMT1 | GenBank | Gene ID: 55621 | |
| Recombinant DNA reagent (plasmid) | pcDNA3.1-TRMT1-FLAG | Dewe et al., 2017 | Fu Lab plasmid, mammalian expression vector for wild-type TRMT1 fused to FLAG | |
| Recombinant DNA reagent (plasmid) | pcDNA3.1-TRMT1-GFP | Dewe et al., 2017 | Fu Lab plasmid, mammalian expression vector for wild-type TRMT1 fused to GFP | |
| Recombinant DNA reagent (plasmid) | pcDNA3.1-TRMT1-FLAG-Q530N | This paper | Fu Lab plasmid, mammalian expression vector for TRMT1-Q530N variant fused to FLAG | |
| Recombinant DNA reagent (plasmid) | pcDNA31.-TRMT1-FLAG-N-term | This paper | Fu Lab plasmid, mammalian expression vector for N-terminal TRMT1 fragment fused to FLAG | |
| Recombinant DNA reagent (plasmid) | pcDNA31.-TRMT1-FLAG-C-term | This paper | Fu Lab plasmid, mammalian expression vector for C-terminal TRMT1 fragment fused to FLAG | |
| Recombinant DNA reagent (plasmid) | pLenti-CMV-GFP-Blast | Addgene | Addgene #17445 | |
| Recombinant DNA reagent (plasmid) | pLenti-CMV-TRMT1-FLAG | This paper | Fu Lab plasmid, lentiviral expression vector for wild-type TRMT1 fused to FLAG | |
| Recombinant DNA reagent (plasmid) | pLenti-CMV-TRMT1-FLAG-Q530N | This paper | Fu Lab plasmid, lentiviral expression vector for TRMT1-Q530N fused to FLAG | |
| Recombinant DNA reagent (plasmid) | psPAX2 | Addgene | Addgene # 12260 | |
| Recombinant DNA reagent (plasmid) | pMD2.G | Addgene | Addgene #12259 | |
| Other | MagSTREP ‘type3’ XT beads, 5% suspension | IBA Lifesciences | 2-4090-002 | For protein purification |
| Other | DYKDDDDK-Tag Monoclonal Antibody Magnetic Microbead | Syd Labs | PA004830 | For protein purification |
| Antibody | anti-TRMT1 aa 201–229 (mouse monoclonal) | Santa Cruz Biotechnologies | G3, sc-373687 | Western blot (1:1,000) |
| Antibody | anti-TRMT1 aa 609–659 (rabbit polyclonal) | Bethyl | A304-205A | Western blot (1:500) |
| Antibody | IBA LifeSciences StrepMAB-Classic (mouse monoclonal) | Fisher Scientific | NC9261069 | Western blot (1:1000) |
| Antibody | ANTI-FLAG M2 (Mouse monoclonal) | Sigma | F3165 | Western blot (1:5000) |
| Antibody | anti-SARS-CoV-2 nucleoprotein N protein (Rabbit polyclonal) | Sino Biological | 40068-RP01 | Western blot (1:1000) |
| Antibody | anti-actin C4 (Mouse monoclonal) | EMD Millipore | MAB1501 | Western blot (1:1,000) |
| Antibody | IRDye 800CW anti-mouse IgG (goat polyclonal) | Fisher Scientific | 925–32210 | Western blot secondary (1:10,000) |
| Antibody | IRDye 680RD anti-Mouse IgG (Goat polyclonal) | Li-COR | 925–68070 | Western blot secondary (1:10,000) |
| Other | Odyssey Imager instrument | Li-Cor | CLx | For imaging infrared dye immunoblots. |
| Software, algorithm | Image Studio | Li-Cor | Version 5.2 | |
| Software, algorithm | Fiji (Fiji is just ImageJ) | Schindelin et al., 2012 | Release 2.15.1 | |
| Recombinant DNA reagent (plasmid) | RRL.sin.cPPT.SFFV/ Ace2.WPRE (MT136) |
Rebendenne et al., 2021 | Addgene 145842 | |
| Antibody | anti-ACE2 Antibody (Goat polyclonal) | R&D systems | AF933 | Western blot (1:200) |
| Sequence-based reagent | SARS_For | This paper | QRT-PCR | ACAGGTACGTTAATAGTTAATAGCGT |
| Sequence-based reagent | SARS_Rev | This paper | QRT-PCR | ATATTGCAGCAGTACGCACACA |
| Sequence-based reagent | GAPDH_For | This paper | QRT-PCR | GCTCACCGGCATGGCCTTTCGCGT |
| Sequence-based reagent | GAPDH_Rev | This paper | QRT-PCR | TGGAGGAGTGGGTGTCGCTGTTGA |