TABLE 4.
TraF mutant phenotypes
| traF allele | Phenotype
|
Primer usede (bp coordinates) | |||||
|---|---|---|---|---|---|---|---|
| TrbC maturationa | Transfer frequencyb | Dpsc
|
Pilus formationd | ||||
| PRD1 | PRR1 | Pf3 | |||||
| Wild type | C | 0.9 × 10−1 | + | + | + | + (b) | Reference 14 |
| ΔtraF | L | <1 × 10−7 | − | − | − | − | Reference 19 |
| traFS37A | C/L | 0.8 × 10−4 | − | − | − | − | Reference 19 |
| traFC59A | C/L | 0.8 × 10−1 | + | + | + | + (i) | GTCATGTTCGCCCCGCCGCAAG (46,405–46,426) |
| traFC80A | C/L | 0.7 × 10−1 | + | + | + | + (i) | GGCGGTTTCGCCCCCGGCGA (46,344–46,363) |
| traFK89Q | C/L | 0.5 × 10−3 | − | − | − | − | Reference 19 |
| traFK89L | C/L | 1.6 × 10−4 | − | − | − | − | CTACATGATGCTGCGAGTTTTAG (46,315–46,337) |
| traFK89R | C/L | 0.8 × 10−2 | − | − | − | − | CTACATGATGAGGCGAGTTTTAG (46,315–46,337) |
| traFR90L | C/L | 0.8 × 10−1 | + | + | + | + (b) | CATGATGAAGCTAGTTTTAGCCG (46,312–46,334) |
| traFP129I | C | 0.9 × 10−1 | + | + | + | + (b) | CGGCCGCTGATTCGTTATCAG (46,196–46,216) |
| traFD155I | L | <1 × 10−7 | − | − | − | − | CACGTCTTTCCTCGGCCGCTAC (46,118–46,139) |
| traFD155N | C/L | 3.1 × 10−3 | − | − | − | − | CACGTCTTTCAACGGCCGCTAC (46,118–46,139) |
| traFR157A | C/L | 3.6 × 10−2 | + | + | + | + (i) | CTTTCGACGGCGCCTACTTCGG (46,112–46,133) |
| traFY158F | C | 0.9 × 10−1 | + | + | + | + (b) | CGACGGCCGCTTCTTCGGGCC (46,109–46,130) |
Detection by Western blotting and MS as described in Materials and Methods. Pilin maturation is characterized as follows: C, circular pilin; L, linear TrbC*; C/L, circular pilin and linear TrbC* were detectable simultaneously.
Transconjugants per donor cell after 1 h of incubation with recipient HB101 Nxr at 37°C as described in Materials and Methods. The given frequencies represent the average values of three independent experiments.
Donor phage specificity (Dps) is characterized as follows: +, Dps positive; −, Dps negative. Data were derived from standard phage plaque assays and electron microscopy; for details, see Materials and Methods.
Pilus formation is characterized as follows: + (b), great amounts of pili were only detectable as bundles; + (i), few pili were only detectable as individuals; −, no pili were detectable.
Only the transcriptive strand primers used are given. Nucleotides derived from the original sequence are written in italics; mutagenized nucleotides are in boldface letters. RP4 coordinates of the nucleotides are given in parentheses according to published sequence data (GenBank accession no. M93696).