Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
(PDB: 4FE5, sequence: GGACAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGUCC). We show the RhoFold-predicted 3D structure in colour overlaid on the groundtruth structure in grey. Designs recover the base pairing patterns and tertiary structure of the RNA, as measured by high self-consistency score. gRNAde’s perplexity is correlated well with 3D self-consistency scores and can be useful for ranking designs.
