|
| Antibodies |
|
| Rabbit anti-NKX2–1 antibody |
Abcam |
Cat#ab76013; RRID:AB_1310784 |
| Goat anti-RFP antibody |
My Biosource |
Cat#MBS448122 |
| Rabbit anti-proSFTPC antibody |
Seven Hills |
Cat#r76694 |
| Goat anti-RAGE antibody |
R&D Systems |
Cat#AF1145 |
| Mouse anti-HT1–56 antibody |
Terrace Biotech |
SKU: TB-29AHT1–56 |
| Rabbit anti-ZO-1 antibody |
ThermoFisher |
Cat#61–7300; RRID:AB_2533938 |
| Rabbit anti-YAP antibody |
Cell Signaling Technology |
Cat#14074 |
| Rabbit anti-phospho-YAP antibody |
Cell Signaling Technology |
Cat#13008 |
| Rabbit anti-Hexokinase1 antibody |
Proteintech |
Cat#19662–1-AP; RRID:AB_10859778 |
| Alexa Fluor 647 donkey anti-rabbit |
Invitrogen |
Cat#A31573; RRID:AB_2536183 |
| Alexa Fluor 488 donkey anti-mouse |
Invitrogen |
Cat#A21202; RRID:AB_141607 |
| Alexa Fluor 647 donkey anti-goat |
Invitrogen |
Cat#A21447; RRID:AB_2535864 |
| Alexa Fluor 546 donkey anti-goat |
Invitrogen |
Cat#A11056; RRID:AB_2534103 |
| Alexa Fluor 488 donkey anti-rabbit |
Invitrogen |
Cat#A21208; RRID:AB_2535794 |
| Alexa Fluor 488 donkey anti-goat |
Invitrogen |
Cat#A11055; RRID:AB_2534102 |
| Anti-rabbit IgG, HRP-linked antibody |
Cell Signaling Technology |
Cat#7074 |
| Anti-goat IgG, HRP-linked antibody |
Jackson ImmunoRsearch |
Cat#705–036-147; RRID:AB_2340392 |
|
| Bacterial and virus strains |
|
| Cre Recombinase Adenovirus |
Vector Biolabs |
Cat#1700 |
|
| Biological samples |
|
| Primary Human Lung samples |
Gift from Dr. Barry Stripp, Cedars Sinai |
N/A |
|
| Chemicals, peptides, and recombinant proteins |
|
| Growth Factor Reduced Matrigel |
Corning |
Cat#356234 |
| mTeSR 1 complete kit |
StemCell Technologies |
Cat#85850 |
| DMEM |
Gibco |
Cat#2414671 |
| IMDM |
ThermoFisher |
Cat#12440053 |
| Glutamax |
Life Technologies |
Cat#35050–061 |
| Ham's F12 |
Cellgro |
Cat#10–080-CV |
| B27 supplement |
Invitrogen |
Cat#17504–44 |
| N2 supplement |
Invitrogen |
Cat#17502–048 |
| Primocin |
Invivogen |
Cat#ANTPM1 |
| 7.5% BSA Fraction V |
ThermoFisher |
Cat#15260–037 |
| 1-thioglycerol (MTG) |
Sigma |
Cat#M6145 |
| Ascorbic Acid |
Sigma |
Cat#A4544 |
| SB431542 |
Sigma |
Cat#S4317 |
| Y-27632 (ROCK inhibitor) |
Tocris |
Cat#1254 |
| Growth Factor Reduced 3D Matrigel |
Corning |
Cat#354230 |
| Dispase |
Gibco |
Cat#17105–041 |
| Retinoic acid |
Sigma |
Cat#R2625 |
| 0.05% Trypsin-EDTA |
Gibco |
Cat#25300062 |
| Fetal bovine serum |
Gibco |
Cat#16141079 |
| Paraformaldehyde |
Electron Microscopy Sciences |
Cat#19208 |
| Normal donkey serum |
Sigma |
Cat#D9663 |
| Antigen Unmasking Solution, Citric Acid Based |
Vector Laboratories |
Cat#H-3300–250 |
| Hoechst 33342 |
Thermo Fisher |
Cat#H3570 |
| Triton-X |
Sigma |
Cat#T9284 |
| Calcein Blue |
ThermoFisher |
Cat#C1429 |
| DRAQ7 |
Abcam |
Cat#ab109202 |
| Dorsomorphin |
Fisher Scientific |
Cat#NC0275327 |
| CHIR99021 |
Fisher Scientific |
Cat#44–235-0 |
| rhKGF (FGF7) |
Fisher Scientific |
Cat#251KG050 |
| rhBMP4 |
R&D systems |
Cat#314-BP |
| rh IL-1beta |
Gibco |
Cat#200–01B |
| rhFGF18 |
Gibco |
Cat#100–28 |
| TRULI (LATS-IN-1) |
MedChem Express |
Cat#HY-138489 |
| TDI-011536 |
MedChem Express |
Cat#HY-150042 |
| Dexamethasone |
Sigma |
Cat#D4902 |
| 8-bromoadenosine 30,50-cyclic monophosphate sodium salt (cAMP) |
Sigma |
Cat#B7880 |
| 3-Isobutyl-1-methylxanthine (IBMX) |
Sigma |
Cat#I5879 |
| Polybrene |
Tocris |
Cat#7711 |
| Phalloidin (Texas Red) |
Invitrogen |
Cat#T7471 |
| Puromycin Dihydrochloride |
ThermoFisher Scientific |
Cat#A1113802 |
| Geneticin Sulfate |
Life Technologies |
Cat#11811–023 |
| Dimethyl Sulfoxide (DMSO) |
Sigma Aldrich |
Cat#D2650 |
| ProLong Diamond Antifade Mountant |
Invitrogen |
Cat#P36965
|
| West Femto Maximum Sensitivity Substrate |
Thermo Scientific |
Cat#PI34096 |
| Restore PLUS Western Blot Stripping Buffer |
Thermo Scientific |
Cat#46430 |
| Human Serum |
Sigma-Aldrich |
Cat#H6914 |
|
| Critical commercial assays |
|
| RNeasy Mini Kit |
QIAGEN |
Cat#74104 |
| QIAzol Lysis Reagent |
QIAGEN |
Cat#79306 |
| TaqMan Fast Universal PCR Master Mix (2X) |
Thermo Fisher |
Cat#4364103 |
| High-Capacity cDNA Reverse Transcription Kit |
Applied Biosytems |
Cat#4368814 |
| P3 Primary Cell 4D-Nucleofector X Kit |
Lonza |
Cat#V4XP-3032 |
| Human VEGFA ELISA Kit |
Abcam |
Cat#119566 |
| Click-iT EdU Cell Proliferation Kit |
ThermoFisher |
Cat#C10340
|
|
| Deposited data |
|
| scRNAseq data: WT YAP, YAP5SA (Figure 3) |
This paper |
GEO: GSE221342
|
| scRNAseq data: L+DCI, YAP5SA, CK+DCI (Figure 6) |
This paper |
GEO: GSE221343
|
| scRNAseq data: L+DCI time series (Figure 6) |
This paper |
GEO: GSE246243
|
| scRNAseq data: 3D vs ALI (Figure 7) |
This paper |
GEO: GSE221344
|
|
| Experimental models: Cell lines |
|
| Human: Donor iPSC line targeted with SFTPCtdTomato (SPC2-ST-B2) |
Kotton Lab; Hurley et al.52
|
http://stemcellbank.bu.edu
|
| Human: Normal donor iPSC line targeted with NKX2–1gfp (BU3 NG) |
Kotton Lab; Hawkins et al.54
|
http://stemcellbank.bu.edu
|
| Human: Normal donor iPSC line targeted with NKX2–1gfp and AGERtdTomato (BU3 NGAT) |
This paper |
http://stemcellbank.bu.edu
|
|
| Oligonucleotides |
|
| Oligonucleotide primers |
Integrated DNA Technologies |
N/A |
| P1 (AGER left homology arm) |
This paper |
5'AGGACTCTTGTCCCAAAGGC 3' |
| P2 (AGER right homology arm) |
This paper |
5'CTGGGGTGTGGGGTTAAAGT 3' |
| P3 (Puromycin resistance Fwd) |
This paper |
5'ACTTGTGTAGCGCCAAGTGC 3' |
| P4 (Puromycin resistance Rev) |
This paper |
5'ACACACACTCGCCTCCTGTT 3' |
| P5 (tdTomato insert Fwd) |
This paper |
5'CTGATCCCCTCAGACATTCTCAGGA 3' |
| P6 (tdTomato insert Rev) |
This paper |
5'GAGCTGCCGCTGCCGGT 3' |
|
| Recombinant DNA |
|
| p2701-AGER-tdTomato |
This paper |
Addgene 216470 |
| p2702-AGER-gRNA1 |
This paper |
Addgene216471 |
| p2703-AGER-gRNA2 |
This paper |
Addgene216472 |
| p2704-AGER-gRNA3 |
This paper |
Addgene 216473 |
| p2706-pHAGE-EF1aL-YAP5SA-UBC-GFP |
This paper |
Addgene 216475 |
| p2709-pHAGE2-Ef1aL-YAP5SA-UBC-tagBFP-loxP |
This paper |
Addgene216478 |
| p2710-pHAGE2-Ef1aL-WTYAP-UBC-tagBFP-loxP |
This paper |
Addgene 216479 |
|
| Software and algorithms |
|
| ImageJ |
National Institutes of Health |
https://imagej.nih.gov/ij/
|
| Prism |
GraphPad |
https://www.graphpad.com
|
| FlowJo |
Becton Dickinson & Company |
https://flowjo.com/solutions/flowjo
|
|
| Other |
|
| StemDiff Definitive Endoderm Kit |
StemCell Technologies |
Cat#05110 |
| Gentle Cell Dissociation Reagent |
StemCell Technologies |
Cat#07174 |
| 0.4μm pore Polyester Membrane Transwell Insert |
Corning |
Cat#3470 |
| Accutase |
Sigma |
Cat#A6964 |
| TaqMan probe: 18S
|
Thermo Fisher |
4318839 |
| TaqMan probe: SFTPC
|
Thermo Fisher |
Hs00161628_m1 |
| TaqMan probe: NAPSA
|
Thermo Fisher |
Hs00362192_m1 |
| TaqMan probe: NKX2–1
|
Thermo Fisher |
Hs00968940_m1 |
| TaqMan probe: CYR61
|
Thermo Fisher |
Hs00155479_m1 |
| TaqMan probe: ANKRD1
|
Thermo Fisher |
Hs00173317_m1 |
| TaqMan probe: AGER
|
Thermo Fisher |
Hs00542584_g1 |
| TaqMan probe: CAV1
|
Thermo Fisher |
Hs00971716_m1 |
| TaqMan probe: CLIC5
|
Thermo Fisher |
Hs00213494_m1 |
| TaqMan probe: PDPN
|
Thermo Fisher |
Hs00366766_m1 |
| TaqMan probe: MKI67
|
Thermo Fisher |
Hs04260396_g1 |
| TaqMan probe: HOPX
|
Thermo Fisher |
Hs05028646_s1 |
| TaqMan probe: SFTPA1
|
Thermo Fisher |
Hs00831305_s1 |
| TaqMan probe: SNAI1
|
Thermo Fisher |
Hs00195591_m1 |
| TaqMan probe: TWIST1
|
Thermo Fisher |
Hs04989912_s1 |
| TaqMan probe: ECAD (CDH1)
|
Thermo Fisher |
Hs01023895_m1 |
| TaqMan probe: TP63
|
Thermo Fisher |
Hs00978340_m1 |
| TaqMan probe: SCGB3A2
|
Thermo Fisher |
Hs00369678_m1 |
| TaqMan probe: CTGF
|
Thermo Fisher |
Hs00170014_m1 |
| TaqMan probe: AXIN2
|
Thermo Fisher |
Hs00610344_m1 |
| TaqMan probe: LEF1
|
Thermo Fisher |
Hs01547250_m1 |
| TaqMan probe: VEGFA
|
Thermo Fisher |
Hs00900055_m1 |
