Skip to main content
. 2024 May 21;5(5):101573. doi: 10.1016/j.xcrm.2024.101573
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
AMMO1 Snijder et al.12 N/A
1D8 Zhu et al.13 N/A
72A1 Hoffman et al.49 N/A
5E3 Hong et al.25 N/A
2B7 This paper N/A
2C1 This paper N/A
2C5 This paper N/A
2D5 This paper N/A
2G4 Audet et al.50 N/A
anti-M13 HRP antibody NBbiolab Cat #S004H
anti-hCD3 antibody VENTANA Cat#790-4341
anti-hCD20 antibody VENTANA Cat#760–2531
anti-human IgG HRP antibody Abcam Cat# ab97160; RRID:AB_10688252
Goat anti-human IgG Shuangliu Zhenglong Biochem Lab Cat#H0111-6
Bacterial and virus strains
EBV Akata GFP Zhu et al.13 N/A
EBV CNE2 GFP Zhang et al.51 N/A
E.coli: TG1 strain AlpVHHs Cat# P006
Helper phage: M13KO7 NEB Cat# N0315S
Chemicals, peptides, and recombinant proteins
Sodium butyrate Sigma Aldrich Cat# V900464
12-O-tetradecanoylphorbol-13-acetate Beyotime Cat# S1819
BsmBI-v2 NEB Cat# R0739L
Vaccinia Capping Enzyme Novoprotein Cat# GMP-M062
2′-O-Methyltransferase Novoprotein Cat# GMP-M072
Critical commercial assays
Ni Sepharose excel Cytiva Cat#17371202
rProtein A Sepharose Fast Flow resin Cytiva Cat#17127906
GoScript™ Reverse Transcription System Promega Cat# A5001
T7 High Yield RNA Transcription kit Novoprotein Cat# E131
Tissue DNA kit Omega Cat# D3396-02
EBER detection kit ZSGB-BIO Cat# ISH-7001–100
ChamQ Universal SYBR qPCR Master Mix Vazyme Biotech Cat# Q711-02
Superdex 200 Increase 10/300 GL Cytiva Cat# 28990944
EZ-Link Sulfo-NHS-Biotin ThermoFisher Cat#21338
Dual-Glo luciferase assay system Promega Cat# E2940
Blood DNA Extraction Kit TIANGEN Cat #DP304-03
Standard EBV genome BDS biotech Cat#BDS-BW-087
Streptavidin (SA) sensors ForteBio, Pall LLC Cat# 18-5019
Protein A sensors ForteBio, Pall LLC Cat# 18-5010
Deposited data
CryoEM Maps of gH/gL/gp42-2C1 complex This paper EMD-37249
CryoEM Maps of gH/gL/gp42-2B7 complex This paper N/A
Atomic Model of gH/gL/gp42-2C1 complex This paper PDB 8KHR
Original Data This paper Research Data Deposit: https://www.researchdata.org.cn/; RDDB2024979584
Atomic Model of gH/gL/gp42/E1D1 complex Sathiyamoorthy et al.31 PDB: 5T1D
Atomic Model of EBV gH/gL complex Matsuura et al.52 PDB: 3PHF
Atomic Model of gp42/HLA-DR1 complex Mullen et al.29 PDB: 1KG0
Experimental models: Cell lines
CNE2-EBV Zhang et al.53 N/A
293T ATCC CRL-3216
293F Thermofisher Cat# R79007
NOK Piboonniyom et al.54 N/A
HK1 Huang et al.55 N/A
HNE1 Zhan et al.56 N/A
AGS ATCC CRL-1739
HEK293 ATCC CRL-1573
HEK293-HLAII This paper N/A
Raji ATCC CCL-86
Bjab Klein et al.57 N/A
Daudi ATCC CCL-213
Akata-EBV Molesworth et al.58 N/A
Akata Wang et al.59 N/A
Experimental models: Organisms/strains
NOD-Prkdcscid IL2Rγnull mice (NPG®) Beijing Vitalstar Biotech Co., Ltd. N/A
Oligonucleotides
Forward primer specific for EBV BALF5 gene: 5′- CCCAACACTCCACCACACC -3′ This paper N/A
Reverse primer specific for EBV BALF5 gene: 5′- TCTTAGGAGCTGTCCGAGGG -3′ This paper N/A
Primers for HLA-II qPCR assay, See Table S1 This paper N/A
Recombinant DNA
pCAGGS-gH Hann et al.60 N/A
pCAGGS-gL Hann et al.60 N/A
pCAGGS-gB Hann et al.60 N/A
pCAGGS-gp42 This paper N/A
pCAG-T7 Okuma et al.61 N/A
pT7EMCluc Okuma et al.61 N/A
pcDNA3.1-gL-Linker-gH-His Zhu et al.13 N/A
pcDNA3.1-gL-Linker-gH This paper N/A
pCRC8400-gp42(34-223aa)-His This paper N/A
pLVX-HLA-DRA1 This paper N/A
pLVX-HLA-DRB1 This paper N/A
pcDNA3.1-HLA-DRA1∗01:01 Walker et al.62 N/A
pcDNA3.1-HLA-DRB1∗04:01 Walker et al.62 N/A
pcDNA3.1-EphA2 Zhu et al.13 N/A
pUC57-T7-T7 polymerase-poly(A) This paper N/A
Pcomb3XSS Andris-Widhopf et al.63 Addgene Plasmid, #63890; RRID: Addgene_63890
Software and algorithms
GraphPad Prism version 8 Graphpad https://www.graphpad.com
ChimeraX Goddard et al.64 https://www.cgl.ucsf.edu/chimerax/
Chimera Pettersen et al.65 https://www.cgl.ucsf.edu/chimera/
cryoSPARC v3 Punjani et al.66 https://cryosparc.com
Coot Emsley et al.67 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
Phenix Adams et al.68 http://phenix-online.org
MolProbity Chen et al.69 http://molprobity.biochem.duke.edu/
Alpha Fold2 Jumper et al.70 https://alphafold.ebi.ac.uk/
PyMOL Schrödinger, Inc.71 https://pymol.org/
Biorender Biorender http://www.biorender.com
Other
Biacore™ 8K Cytiva https://www.cytivalifesciences.com/en/us/shop/protein-analysis/spr-label-freeanalysis/spr-systems/biacore-8k-p-05540
ÄKTA pure™ 25M Cytiva https://www.cytivalifesciences.com/en/us/shop/chromatography/chromatography-systems/akta-pure-p-05844
Octet RED96 Forte'Bio, Pall LLC https://www.sartorius.com/en/products/biolayer-interferometry
CytoFLEX Beckman Coulter https://www.beckman.com/flow-cytometry/research-flow-cytometers/cytoflex