Mechanism of inhibition of tumor angiogenesis by β‐hydroxyisovalerylshikonin

Abstract

Shikonin and β‐hydroxyisovalerylshikonin (β‐HIVS) from Lithospermum erythrorhizon inhibit angiogenesis via inhibition of vascular endothelial growth factor receptors (VEGFR) in an adenosine triphosphate‐non‐competitive manner, although the underlying molecular mechanism has not been fully understood. In the present study, we found that β‐HIVS inhibited angiogenesis within chicken chorioallantoic membrane approximately threefold more efficiently than shikonin. β‐HIVS also significantly inhibited angiogenesis in two other assays, induced either by Lewis lung carcinoma cells implanted in mouse dorsal skin or by VEGF in s.c. implanted Matrigel plugs and metastasis of Lewis lung carcinoma cells to lung. Therefore, using β‐HIVS as a bioprobe, we investigated the molecular mechanism of shikonin's anti‐angiogenic actions. β‐HIVS inhibited the phosphorylation and expression of VEGFR2 and Tie2 without affecting VEGFR1 and fibroblast growth factor receptor 1 levels. β‐HIVS suppressed the phosphorylation but not the expression of extracellular signal‐regulated kinase, and an Sp1‐dependent transactivation of the VEGFR2 and Tie2 promoters, thereby suppressing the proliferation of vascular endothelial and progenitor cells. This was mimicked by an Sp1 inhibitor mithramycin A and partially rescued by Sp1 overexpression. These results implicate potential use of shikonin and β‐HIVS as leading compounds for clinical application in the future by virtue of their unique properties including: (i) inhibition of VEGFR2 and Tie2 phosphorylation in an adenosine triphosphate‐non‐competitive manner; (ii) simultaneous inhibition of the phosphorylation and expression of VEGFR2 and Tie2; and (iii) bifunctional inhibition of the growth in endothelial cells and vascular remodeling. (Cancer Sci 2009; 100: 269–277)

Angiogenesis and/or vasculogenesis are essential for the growth of solid tumors.^{( 1 )} Angiogenesis is the growth and sprouting of additional blood vessels from pre‐existing blood vessels, while vasculogenesis is the formation of primitive vascular networks through differentiation of vascular progenitor cells (VPC) into endothelial cells.^{( 1 )} Tumor cells produce angiogenic factors, such as vascular endothelial growth factor (VEGF) and angiopoietins (Ang)‐1 and ‐2.^{( 2} , ^{3 )} The VEGF/VEGF receptor (VEGFR) signaling pathway is essential for recruiting VPC and stimulating their differentiation into endothelial cells as well as for drawing endothelial cells from pre‐existing blood vessels and stimulating their growth,^{( 1 )} whereas the Ang/Tie2 signaling pathway is important for sustaining interaction between endothelial and mural cells and stabilizing the vasculature.^{( 4 )} VEGF and Ang‐1 bind to VEGFR and Tie2, respectively, on the surface of endothelial and progenitor cells, stimulate the activities of respective receptor tyrosine kinases and exert their biological functions.

Because newly formed blood vessels serve as a conduit for nutrition and a route for metastasis, tumor angiogenesis is a target for the treatment of solid tumors.^{( 5 )} SU5416, ZD6474 and PTK787 have been developed as potent inhibitors of the phosphorylation of VEGFR tyrosine kinase.^{( 6 )} A number of angiogenesis inhibitors have been developed to target receptor tyrosine kinases and/or their downstream mitogen activated protein kinase (MAPK) signaling cascades.^{( 7 )}

Shikonin and β‐hydroxyisovalerylshikonin (β‐HIVS) are major components in the root (radix) of the plant Lithospermum erythrorhizon ^{( 8 )} (see Fig. 1 for their chemical structures), which is used traditionally as an oriental medicinal herb. They inhibit several receptor tyrosine kinases (e.g. v‐Src, epidermal growth factor receptor and VEGFR) in an adenosine triphosphate (ATP)‐non‐competitive manner.^{( 9 )} They also inhibit the growth of various lines of cancer cells and induce their apoptosis, suggesting their potential use as novel anticancer reagents.^{( 9 )} Furthermore, Hisa et al.^{( 10 )} reported that shikonin suppresses angiogenesis. However, the underlying molecular mechanism is not fully understood. Moreover, the direct effect of β‐HIVS on the vascular endothelial cells and angiogenesis has not been studied.

Figure 1.

Chemical structure of shikonin and β‐hydroxyisovalerylshikonin (β‐HIVS). MW, molecular weight.

In this manuscript, we aim to clarify the detailed molecular mechanism of anti‐angiogenic activity of shikonins. First, based upon the previous report that β‐HIVS inhibited tyrosine kinases including VEGFR2 in endothelial cells stronger than shikonin, we explored the hypothesis that β‐HIVS might inhibit angiogenesis stronger than shikonin and used β‐HIVS to accomplish the aim. We found that β‐HIVS suppressed the phosphorylation of both VEGFR2 and Tie2 as well as, surprisingly, the expression of both VEGFR2 and Tie2. This accompanied a reduction in an Sp1‐dependent transactivation and upstream extracellular signal‐regulated kinase (ERK) activation, culminating in reduced growth of vascular endothelial and progenitor cells, and inhibition of tumor angiogenesis. These results evidence that shikonin and β‐HIVS have unique anti‐angiogenic properties of bifunctional inhibition of the growth in endothelial cells and vascular remodeling and provide insights into development of novel anti‐angiogenic inhibitors using shikonins as leading compounds in terms of: (i) simultaneous inhibition of the phosphorylation and expression of VEGFR2 and Tie2; and (ii) inhibition of VEGFR2 and Tie2 phosphorylation in an ATP‐non‐competitive manner.

Materials and Methods

Reagents.  Shikonin was isolated from the plant, Lithospermum radix, as described before^{( 8 )} and β‐HIVS was purchased from Wako Pure Chemical Industries (Osaka, Japan). Mithramycin A was obtained from Sigma‐Aldrich (St Louis, MO, USA). Sp1‐expressing vector was constructed as described previously.^{( 11 )}

Chicken chorioallantoic membrane (CAM) assay.  Fertilized Dekalb chicken eggs (Omiya Kakin, Saitama, Japan) were placed in a humidified egg incubator. After a 4.5‐day incubation at 38°C, a 1% solution of methylcellulose containing shikonin and β‐HIVS at one of various concentrations was loaded inside a silicon ring that was placed onto the surface of the CAM. After further incubation for 2 days, a fat emulsion was injected into the chorioallantois, so that the vascular networks stood out against the white background of the lipid. Anti‐angiogenic responses were evaluated under a stereomicroscope and photographed with a ×7.25 objective. Quantitative analyses were performed with angiogenesis‐measuring software.^{( 12 )}

Mouse dorsal air sac (DAS) assay.  Millipore chambers (Millipore, Billerica, MA, USA) were filled with either RPMI‐1640 medium alone or a suspension of 4 × 10⁶ Lewis lung carcinoma (LLC) cells in the medium and sealed with membrane filters (0.45‐µm pores). The chambers were implanted s.c. in DAS, created surgically by injection of an appropriate amount of air, in 7‐week‐old female ICR mice (Charles River, Yokohama, Japan). These mice were i.p. administered β‐HIVS (30 mg/kg bodyweight) dissolved in a solution of 5% dimethylsulfoxide (DMSO), 15% Cremophor EL (Sigma‐Aldrich) and 5% glucose in saline. One and three days later, the mice were killed with an overdose of diethyl ether. The skin was carefully removed and angiogenesis that had been induced around the chamber was examined under a stereomicroscope and photographed with a ×5.6 objective. Quantitative analyses were performed with angiogenesis‐measuring software (ver. 2.0; KURABO, Osaka, Japan). All surgical procedures were performed under pentobarbital (Dainabot, Osaka, Japan) anesthesia. All animal experiments were performed according to the guidelines of the Animal Experiments Committee of RIKEN.

Matrigel plug assay.  Matrigel (BD Biosciences, Bedford, MA, USA) was mixed with 200 units/mL heparin (Nacalai Tesque, Kyoto, Japan), with and without 50 ng/mL VEGF (Pepro Tech, Rocky Hill, NJ, USA) and 5 µM β‐HIVS in 0.1% DMSO. The Matrigel mixture was injected s.c. into 5‐week‐old female C57BL/6 mice (Charles River). The mice were killed 7 days later. The Matrigel plugs were removed and fixed in 4% paraformaldehyde for 4 h, dehydrated through a graded ethanol series and embedded in paraffin (Nacalai Tesque). Vertical sections (5 µm) were mounted on slides and stained with hematoxylin–eosin or subjected to immunostaining as detailed below and observed under an inverted microscope (model DM IRB; Leica Microsystems, Wetzlar, Germany).

Metastasis assay.  A suspension of 5 × 10⁵ LLC cells was injected underneath the dorsal skin of 7‐week‐old female C57BL/6 mice. The mice were administered β‐HIVS i.p. every other day for 3 weeks at a dose of 10 mg/kg bodyweight and killed with an overdose of diethyl ether. Lungs were carefully removed, examined under a microscope for the presence of tumors and photographed. Colonies of metastatic tumor cells observed on the whole lung surface were counted. No obvious adverse effects appeared after treatment of animals with β‐HIVS under this condition.

Immunostaining.  For fluorescence immunostaining, we used a combination of chicken antibodies against the cytoplasmic region of platelet/endothelial cell adhesion molecule‐1 and fluorescein‐5‐isothiocyanate‐conjugated rabbit antibodies against chicken IgG (Zymed Laboratories, Carlsbad, CA). Immunohistochemical staining of VEGFR2 was performed with an avidin–biotin kit (Vectastain Elite ABC kit; Vector Laboratories, Burlingame, CA, USA) according to the manufacturer's instructions using VEGFR2‐specific rabbit monoclonal antibody (Cell Signaling Technology, Danvers, MA, USA). Immunostained sections were counterstained with Mayer's hematoxylin, dehydrated, mounted and observed under the inverted microscope.

Cell cultures.  Culture of human umbilical vein endothelial cells (HUVEC) and maintenance, differentiation and sorting of the CCE/nLacZ ES cell cultures were performed as described, respectively.^{( 12} , ^{13 )} VPC differentiated from CCE/nLacZ ES cell (the VEGFR2 [Flk‐1] immunopositive cells) labeled with phycoerythrin were collected using the FACS VantageSE (Becton Dickinson Labware, Bedford, MA, USA) and recultured on dishes coated with type IV collagen in a modified minimum essential medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal calf serum (Invitrogen). Bovine aortic endothelial cells (BAEC) were grown in a modified minimum essential medium containing 10% newborn calf serum (Hyclone Laboratories, Logan, UT, USA). NIH3T3 cells stably overexpressing VEGFR2 (NIH3T3‐VEGFR2 cells) were maintained as described.^{( 14 )}

Immunoprecipitation and western blotting analysis.  Cells were washed several times with Tris‐buffered saline (20 mM Tris‐HCl, 137 mM NaCl) that contained Complete protease inhibitor cocktail (Roche, Indianapolis, IN, USA). Cells were lyzed in 1% Triton X‐100 in 20 mM HEPES, pH 6.8 containing Complete protease inhibitor cocktail, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride (PMSF) and 0.5 mM Na₃VO₅, and subjected to immunoprecipitation with anti‐phosphotyrosine conjugated agarose beads (AG10; Upstate Biotechnology, Lake Placid, NY, USA) at 4°C overnight, washed with the lysis buffer three times and solubilized in sodium dodecylsulfate (SDS) buffer (200 mM Tris‐HCl, pH 6.8, 6% w/v SDS, 30% glycerol, 150 mM dithiothreitol (DTT), 0.03% w/v Bromophenol Blue) followed by western analysis using Tie2‐specific antibodies (1:1000 dilution, Upstate Biotechnology) or directly subjected to western analysis using phospho‐VEGFR2‐specific antibodies (1:1000 dilution; Cell Signaling Technology) or phospho‐ERK‐specific antibodies (1:2000 dilution, Cell Signaling Technology). Cell lysates were also subjected to western analysis using antibodies to VEGFR2, Tie2 and ERK, followed by reprobing with glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH)‐specific antibody (1:3000 dilution; HyTest, Turku, Finland) as a loading control. Immunoreactive bands of proteins were detected with ECL‐Plus chemiluminescence reagents (GE Healthcare, Buckinghamshire, UK).

Reverse transcriptase‐polymerase chain reaction (RT‐PCR).  Untreated (control cells) and cells treated with β‐HIVS or mithramycin A were washed twice with phosphate‐buffered saline and total RNA was extracted with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). RT‐PCR was performed with the SuperScrip First‐Strand Synthesis System (Invitrogen). Amplification by PCR was performed with pairs of specific primers summarized in Table 1.

Table 1.

Primers for reverse transcription polymerase chain reaction experiments

Gene		Sequence	Nucleotide#
Human VEGFR1	Sense	5′‐TTTGGATGAGCAGTGTGAGC‐3′	2415
	Antisense	5′‐TTGGTTTCTTGCCTTGTTCC‐3′	2866
Human VEGFR2	Sense	5′‐GCATGGTCTTCTGTGAAGCA‐3′	587
	Antisense	5′‐CCAGAGATTCCATGCCACTT‐3′	1018
Human Tie2	Sense	5′‐TACACCTGCCTCATGCTCAG‐3′	527
	Antisense	5′‐GCAGAGACATCCTGGAAGC‐3′	993
Human FGFR1	Sense	5′‐GGCAAGGAATTCAAACCTGAC‐3′	697
	Antisense	5′‐CATCACGGCTGGTCTCTCTTC‐3′	1224
Human GAPDH	Sense	5′‐ACCCAGAAGACTGTGGATGG‐3′	610
	Antisense	5′‐CCCTGTTGCTGTAGCCAAAT‐3′	1030
Human VEGF	Sense	5′‐CTACCTCCACCATGCCAAGT‐3′	48
	Antisense	5′‐AAATGCTTTCTCCGCTCTGA‐3′	458
Human Ang‐1	Sense	5′‐TATGCCAGAACCCAAAAAGG‐3′	855
	Antisense	5′‐GGGCACATTTGCACATACAG‐3′	1258
Human Ang‐2	Sense	5′‐CCACAAATGGCATCTACACG‐3′	878
	Antisense	5′‐AAGTTGGAAGGACCACATGC‐3′	1345

Gel shift assay.  Oligonucleotides corresponding to the GC box (Sp1 binding) motif within human VEGFR2 promoter (–85 to –64; 5′‐CGGGAGAGACCCTCCTCCGCCC‐3′)^{( 15 )} were synthesized, double‐stranded, end‐labeled and used for the gel shift assays as described.^{( 16 )} Nuclear proteins (6 µg) were incubated for 15 min at 4°C with 3.5 ng of ³²P‐labeled probe in binding buffer (25 mM HEPES‐KOH, 25 mM KCl, 5 mM MgCl₂, 50 µM ZnSO₄ and 8% glycerol) and separated on a 4% polyacrylamide gel at 4°C in running buffer (25 mM Tris‐HCl, 190 mM glycine and 1 mM EDTA, pH 8.5). The gels were dried and radioactive bands were detected on a Fujix Bas 2500 Bio‐imaging analyzer (Fuji Photo Film, Tokyo, Japan).

Transfection and luciferase assay.  Transfections and assays of luciferase activity were performed as described previously^{( 16 )} using a combination of LipofectAMINE Plus regent (Invitrogen) and a GC3‐Luc vector (500 ng/dish), which was constructed by inserting a synthesized oligodeoxynucleotide cassette corresponding to three sequential repeats of the GC box motifs and TATA box upstream of the luciferase cDNA of the pGL3 vector (Promega, Madison, WI, USA), or Tie2‐luc vector (500 ng/dish).^{( 17 )} On the day after the transfection, the cells were washed, and treated with 5 µM β‐HIVS in a medium containing 2.5% serum for 10 h, and luciferase activity of the cells was determined as before.^{( 16 )}

Statistical analysis.  Data are expressed as mean ± standard deviation or ± standard error. Statistical significance was assessed by one‐way anova followed by Scheffe's Student's t‐test.

Results

Inhibition of the blood vessel formation in CAM by β‐HIVS.  The effect of β‐HIVS and shikonin on in vivo angiogenesis was examined in the CAM assay (Fig. 2A). The formation of intricate vascular networks, developing within control CAM (Fig. 2A,a), was moderately suppressed with shikonin at a concentration of 720 ng/egg (250 µM inside the ring, Fig. 2A,d), whereas β‐HIVS exerted much stronger anti‐angiogenic activity in a dose‐dependent manner at concentrations of 9.7–970 ng/egg (corresponding to 2.5–250 µM inside the ring, Fig. 2A,e–g) (the actual concentrations of shikonin and β‐HIVS within CAM tissues were lower than these concentrations due to diffusion of the drug). Treatment with 250 µM β‐HIVS inhibited angiogenesis with CAM by 50%, more efficiently than 29% with 250 µM shikonin. The result of plotting the inhibition curve suggested that β‐HIVS is a threefold more potent anti‐angiogenic inhibitor than shikonin (Fig. 2B). Staining with hematoxylin–eosin of vertical sections of CAM tissues revealed that exposure to 250 µM β‐HIVS for 48 h caused a 55% reduction in the number of capillaries that developed underneath the chorionic epithelium without affecting epithelial cells composing the chorionic membrane (Fig. 2C).

Figure 2.

Suppression of in vivo blood vessel formation and morphological changes induced in chicken chorioallantoic membrane (CAM) tissues by shikonins. (A) The 4.5‐day‐old CAM were treated with increasing concentrations of shikonin and β‐hydroxyisovalerylshikonin (β‐HIVS) for 48 h and then patterns of angiogenesis were photographed. (a) Vehicle (10% ethanol); (b) 2.5 µM shikonin; (c) 25 µM shikonin; (d) 250 µM shikonin; (e) 2.5 µM β‐HIVS; (f) 25 µM β‐HIVS; (g) 250 µM β‐HIVS. Scale lines, 100 µm. The total area and the number of branches of blood vessels were analyzed with angiogenesis measuring software and are shown under each panel. Asterisks indicate significant differences (P < 0.05) from the control (a). A total of 18 eggs (six eggs/experiment × three experiments) were evaluated and representative results are shown. (B) Percentages of inhibition in the number of branches are plotted against concentrations of shikonin and β‐HIVS. () Shikonin; () β‐HIVS. (C) The 4.5‐day‐old CAM were treated with vehicle (10% ethanol inside the ring = control). Note that the actual concentration of ethanol within CAM tissue was lower than that concentration due to diffusion of ethanol) (left panel) or 970 ng/egg β‐HIVS (right panel) for 48 h. Vertical sections (3 µm) were mounted on slides, stained with hematoxylin–eosin, and observed under a Leica model DM IRB microscope (Leica Microsystems, Wetzlar, Germany). CAM tissue was composed of four different layers, including a thin chorionic epithelium (ce), microvasculatures (mv), a thick mesenchymal layer (fb) consisting of sparsely distributed fibroblasts and a few small blood vessels (bv), and a thin allantoic epithelium (ae). Scale lines, 50 µm. Representative micrographs from a total of 18 CAM tissues (six eggs/each × three experiments) are shown. Numbers of blood vessels were counted and are shown under each panel. Values are mean ± standard deviation (n = 6). Relative changes are shown as a percentage of control in parenthesis. Asterisks indicate significant differences (P < 0.05) from controls. (A–C) Representative results from two or three independent experiments that all gave similar results.

Suppression of in vivo angiogenesis by β‐HIVS in DAS and matrigel plug assay.  Figure 3A shows the result of DAS assays using murine LLC cells. From pre‐existing blood vessels beneath the epidermis (Fig. 3A,a), strikingly disorganized and tortuous vessels were induced towards tumor cells in the chamber (Fig. 3A,b), which was reduced by 42% in mice administered β‐HIVS at 30 mg/kg bodyweight (Fig. 3A,c). Under the same condition, the bodyweight of the mice with implanted chambers did not change significantly (data not shown). No obvious sign of toxicity in kidney vasculature and tracheal mucosa (Supplementary Fig. S1a,b) or proteinuria (Supplementary Fig. S2A) was observed in β‐HIVS‐administrated mice, while moderate damage was seen in the liver (Supplementary Fig. S1,f). To determine whether β‐HIVS might act on blood vessel cells and inhibit blood vessel formation, we examined the effect of β‐HIVS in the Matrigel plug assay (Fig. 3B). Invasion of cells was observed in the control Matrigel that contained VEGF without β‐HIVS (Fig. 3B,a). When β‐HIVS was administered in the Matrigel at a concentration of 5 µM, the VEGF‐induced invasion of cells was inhibited by approximately 42% (Fig. 3B,b). More than 47% of the invading cells were platelet/endothelial cell adhesion molecule‐1 immunopositive endothelial cells and/or the progenitor cells (Fig. 3B,a,d). No obvious sign of toxicity was observed in β‐HIVS treated mice. These results suggested that β‐HIVS suppressed tumor‐induced blood vessel formation in vivo, at least in part, via a direct action on vascular endothelial and/or progenitor cells. Moreover, spontaneous metastasis of implanted LLC cells to the lung was suppressed to 46% by i.p. administration of β‐HIVS (10 mg/kg bodyweight) for 3 weeks (Fig. 4). The bodyweight of the mice did not change significantly and only the weights of original tumor tissues were reduced by 46% (data not shown).

Figure 3.

Suppression of tumor‐induced and vascular endothelial growth factor (VEGF)‐induced in vivo angiogenesis by β‐hydroxyisovalerylshikonin (β‐HIVS) in dorsal air sac (DAS) and Matrigel plug assay. (A) DAS assay, chambers filled with either medium alone (a) or Lewis lung carcinoma (LLC) cells (b,c) were implanted into 7‐week‐old mice. Aliquots (100 µL) of vehicle or β‐HIVS (30 mg/kg bodyweight) were injected i.p. every other day for 3 days starting at 1 day after implantation (b and c, respectively). The next day the dorsal skin was peeled off and blood vessel formation was examined under a microscope and photographed. Representative micrographs from six mice in each group are shown. Scale lines, 5 mm. Areas of tumor‐induced blood vessels were analyzed with angiogenesis‐measuring software and these areas are given under each photograph. Relative areas are given as percentages in parentheses. Values represent average ± standard deviation (n = 6). An asterisk represents a significant difference (P < 0.05) from the results obtained with the vehicle alone. (B) Matrigel plug assay, Matrigel plugs containing 50 ng/mL VEGF ± 5 µM or 10 µM β‐HIVS were implanted into mice s.c. One week later, the Matrigel plugs were collected and stained with hematoxylin–eosin (a–c) and platelet/endothelial cell adhesion molecule‐1 (PECAM‐1)‐specific antibody (d–f). (a,d) VEGF alone (control); (b,e) VEGF plus 5 µM β‐HIVS; (c,f) VEGF plus 10 µM β‐HIVS. Representative data from a total of nine micrographs (three fields × three mice) are presented. Scale lines, 100 µm. The number of invading cells in each micrograph was counted and the relative values are presented as percentages under each photograph. Values represent average ± standard error (n = 9, three fields × three mice). An asterisk indicates a significant difference (P < 0.05) from the control. (A,B) Representative results from two or three independent experiments that all gave similar results.

Figure 4.

Inhibition of tumor metastasis by β‐hydroxyisovalerylshikonin (β‐HIVS). The effect of β‐HIVS on metastasis of Lewis lung carcinoma (LLC) cells was assessed as described in Materials and Methods. (a) Vehicle; (b) β‐HIVS. Representative photographs from a total of five mice are shown. Relative changes in colonies of metastatic tumor cells are shown as a percentage of control in parenthesis. Scale lines, 5 mm. Values are mean ± standard deviation (n = 5). An asterisk indicates a significant difference (P < 0.05) from the control group. A representative result from two independent experiments that gave similar results is shown.

β‐HIVS suppressed the phosphorylation and expression of both VEGFR2 and Tie2, and inhibited the growth of both vascular endothelial and progenitor cells.  We investigated the molecular mechanism by which β‐HIVS inhibited blood vessel formation via a direct effect on the vascular endothelial and/or progenitor cells. Simultaneous inclusion of VEGF and β‐HIVS suppressed the proliferation of HUVEC and VPC in a dose‐dependent manner, reducing their cell numbers to 20% at 10 µM and 2.5 µM (IC₅₀, 3 and 1 µM), respectively (Fig. 5A). We next examined whether β‐HIVS could abrogate the growth stimulating and survival signals by inhibiting the phosphorylation of the angiogenic growth factor receptors in endothelial cells as implicated in the previous report using a reconstituted system in other cell types.^{( 9 )} As seen in the upper panel of Figure 5(B,a), induction of phosphorylated 230 kDa VEGFR2 due to VEGF treatment was almost completely blocked by pretreatment with 5 µM β‐HIVS for 24 h (compare Fig. 5B,a lanes 2 and 3). A similar result was observed with NIH3T3 cells that constitutively overexpressed VEGFR2 (Fig. 5B,b). Surprisingly, levels of VEGFR2 protein expression itself were also significantly reduced following β‐HIVS‐pretreatment (Fig. 5B,a lane 3 in middle panel). In addition, β‐HIVS suppressed the phosphorylation and expression of Tie‐2 (Fig. 5B,c lane 3 in upper and middle panels, respectively). Under the same condition, levels of GAPDH, an internal control, was unchanged (Fig. 5B, a and c, lane 3 in lower panels).

Figure 5.

Suppression by β‐hydroxyisovalerylshikonin (β‐HIVS) of vascular endothelial and progenitor cell growth accompanying reduced phosphorylation and expression of vascular endothelial growth factor receptors (VEGFR)2 and Tie2. (A) One day after human umbilical vein endothelial cells (HUVEC) or vascular progenitor cells (VPC; 1 × 10⁵ cells) had been seeded onto 3.5‐cm dishes, they were incubated for 24 h in growing medium that contained 50 ng/mL vascular endothelial growth factor (VEGF) and increasing concentrations of β‐HIVS. Cells were stained with Trypan blue, and numbers of unstained viable cells were counted and plotted as percentages relative to values for untreated control cells (1.7 × 10⁵ cells in a 3.5‐cm dish). Values represent mean ± standard deviation (n = 3) () HUVEC; () VPC. (B) After HUVEC and NIH‐3T3‐VEGFR2 cells had been incubated for 24 h with or without 5 µM β‐HIVS in medium containing 2.5% serum, cells were stimulated with either 50 ng/mL VEGF (a,b), or 100 ng/mL Ang‐1 (c) for 5 min, and then lyzed immediately. The amount of each phosphorylated receptor (upper panels) as well as the total amount of each receptor (middle panels) and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH, a loading control; lower panels) were assessed as described in Materials and Methods. (A,B) Representative results from three independent experiments that all gave similar results.

β‐HIVS suppressed MAPK and Sp1‐dependent expression of VEGFR2 and Tie2 mRNA.  We next investigated the molecular mechanism by which β‐HIVS reduced the expression of VEGFR2 and Tie2 in the further detail. β‐HIVS abrogated cellular production of phospho‐ERK (Fig. 6A lane 3 in upper panel) without changing the levels of total ERK themselves (Fig. 6A lane 3 in lower panel). It has been reported that Sp1 is a downstream transcription factor of ERK and transactivates the promoter of the VEGFR2 gene.^{( 18 )} Therefore, we next examined whether β‐HIVS might suppress the expression of VEGFR2 via reduction of Sp1 activity. Treatment of cells with β‐HIVS lowered the Sp1 binding and transactivation activities toward the GC box motif within the VEGFR2 gene promoter (Fig. 6B,C, respectively). β‐HIVS also weakly inhibited binding activity of Sp3 transcription factor (Fig. 6B). Comparable reductions were observed in transactivation of the Tie2 promoter (Fig. 6D) and in the expression of VEGFR2 and Tie2 mRNA (Fig. 7A), which were mimicked by mithramycin A, a specific inhibitor of the binding of Sp1/Sp3 to the GC box^{( 19 )} (6, 7). Both β‐HIVS and mithramycin A marginally affected mRNA levels of VEGFR1 and FGF receptor 1 (FGFR1) (Fig. 7A,B). Inhibition by β‐HIVS was partially blocked by Sp1 overexpression in BAEC (Fig. 6E,F). β‐HIVS also did not affect the levels of Sp1, VEGF, and Angs‐1 and 2. Finally, suppression of the expression of VEGFR2 was also observed during the inhibition of angiogenesis in vivo, as assessed by immunostaining of the Matrigel plugs (Fig. 7C). In contrast to the large numbers of VEGFR2‐positive cells in control Matrigel plugs (Fig. 7C,a), the number of VEGFR2‐positive cells was reduced to 44 ± 11% of the control values (Fig. 7C,b) by inclusion of β‐HIVS in the Matrigel plug at 5 µM.

Figure 6.

Suppression in mitogen activated protein kinase (MAPK)‐Sp1 pathway by β‐hydroxyisovalerylshikonin (β‐HIVS). (A) β‐HIVS on the activation of externally regulated kinases (ERK). After human umbilical vein endothelial cells (HUVEC) had been incubated for 24 h with or without 5 µM β‐HIVS in medium that contained 2.5% serum, cells were stimulated with 50 ng/mL vascular endothelial growth factor (VEGF) for 5 min, and cell lysates were prepared and subjected to western blot analysis. Upper panel, changes in phosphorylated ERK protein. Lower panel, changes in total amounts of ERK protein. (B) β‐HIVS on Sp1 binding. After treatment of HUVEC with 5 µM β‐HIVS for 24 h, nuclear extracts were prepared and Sp1 binding to the VEGFR2 GC box motif was assessed by gel shift assay. Lane 1, vehicle; lane 2, 5 µM β‐HIVS; lane 3, vehicle + anti‐Sp1 immunoglobulin (Ig)G; lane 4, vehicle + Sp3 IgG; lane 5, vehicle + unlabeled oligonucleotide. (C) GC3 motif‐luciferase reporter activity. Bovine aortic endothelial cells (BAEC) were transfected with a GC3 motif‐luciferase chimeric gene construct. The day after transfection, the medium was changed and the cells were treated with 5 µM β‐HIVS or 10 nM mithramycin A for 10 h. Transactivation activity was assessed by luciferase reporter assay and plotted as percentages of the values for the control (vehicle). (D) Tie2 promoter‐luciferase reporter activity. BAEC were transfected with a Tie2‐luciferase chimeric gene construct. The day after transfection, the medium was changed and cells were treated with 5 µM β‐HIVS or 10 nM mithramycin A for 10 h. Transactivation activity was assessed by luciferase reporter assay and plotted as percentages of the values for the control (vehicle). (E), (F) Partial rescue of β‐HIVS's inhibition in GC3 motif‐luciferase (E) and Tie2 promoter‐luciferase (F) reporter activities with constitutively active MEK. BAECs were transfected with combinations of either a GC3 motif‐luciferase (E) or a Tie2 promoter‐luciferase (F) chimeric gene construct and empty vector or constitutively active MEK gene‐expressing vector. The next day of transfection, medium was changed and cells were treated with 5 µM β‐HIVS for 10 h. Transactivation activity was assessed as before, and plotted as percentages of the values for the control (vehicle). (A–F) Representative results from two or three independent experiments that all gave similar results. (C)–(F). Values represent means ± standard deviation (n = 3) Asterisks indicate significant differences (P < 0.05) from respective controls.

Figure 7.

Suppression of expression of vascular endothelial growth factor receptor (VEGFR) and Tie2 by β‐hydroxyisovalerylshikonin (β‐HIVS). (A) β‐HIVS on mRNA levels of several growth factor receptors. Human umbilical vein endothelial cells (HUVEC) were treated for 24 h with 5 µM β‐HIVS. Changes in mRNA levels of the indicated genes were assessed by reverse transcription polymerase chain reaction (RT‐PCR). Relative changes in levels were calculated after normalization to levels of GAPDH mRNA and are presented as percentages in parentheses under each band. (B) 10 h after HUVEC were treated with 10 nM mithramycin A, changes in mRNA levels were determined by RT‐PCR as before. Relative changes in levels were calculated after normalization to levels of GAPDH mRNA and are presented as percentages in parentheses under each band. (C) β‐HIVS on VEGFR2 expression in vivo. Matrigel plugs containing 50 ng/mL vascular endothelial growth factor (VEGF) ± 5 µM β‐HIVS were implanted s.c. into mice. A week later, the Matrigel plugs were collected and immunostained with VEGFR2. (a) Minus β‐HIVS; (b) plus β‐HIVS. Scale lines, 50 µm. The antigen‐positive cells in each micrograph were counted and relative changes in numbers are presented as percentages under each photograph. Values represent average ± standard error (n = 5). An asterisk indicates a significant difference (P < 0.05) from the control. Representative data from a total of nine micrographs (three fields × three mice) are presented. (A–C) Representative results from two or three independent experiments that all gave similar results.

Discussion

In this manuscript, we report the novel molecular mechanism, by which shikonins inhibit tumor angiogenesis. First, we found that β‐HIVS exhibits much stronger anti‐angiogenic activity than shikonin (Fig. 2A). We anticipate that an isovaleryl group present in the β‐HIVS molecule will be found to play an important role in potentiating its anti‐angiogenic action compared with that of shikonin. Administration of β‐HIVS in mice weakly caused liver damage in the DAS (Supplementary Fig. S1,f), but not in the Matrigel plug assay (data not shown). β‐HIVS did not affect epithelial cells constituting chorionic membrane in the CAM assay (Fig. 2B), vasculature in the kidney and tracheal mucosa (Supplementary Fig. S1,b,d), proteinuria (Supplementary Fig. S2A) and pre‐existing blood vessels underneath the skin in DAS assay (Fig. 3A). These results suggest that the anti‐angiogenic effect of β‐HIVS may not be due to cytotoxic effects. Furthermore, neither cellular levels of GAPDH (5, 7) nor ERK (Fig. 6A) was affected by β‐HIVS. These results suggest that it affects only proliferating cells that require growth factor stimuli. In Figure 3, because formation of new blood vessels was inhibited the number of platelet/endothelial cell adhesion molecule (PECAM)‐negative non‐endothelial cells such as macrophages were also thought to be reduced.

β‐Hydroxyisovalerylshikonin appears to target the MAPK‐Sp1 pathway (5, 6) and downstream expression of VEGFR2 and Tie2, thereby inhibiting the growth of vascular endothelial and progenitor cells (Fig. 5A). This is consistent with previous reports that the Ras‐MAPK signaling pathway plays an important regulatory role in angiogenesis,^{( 20 )} and Sp1, a downstream transcription factor of ERK, transactivates the VEGFR2 promoter.^{( 15} , ^{21 )} On the other hand, the transactivation of Tie2 promoter by Sp1 is a novel finding. The results in Fig. 6 definitely suggest a role of Sp1 in the expression of both VEGFR2 and Tie2. In Fig. 6(B), lane 3, we could not see an obvious supershift of the Sp1 band, but saw diminishment in the Sp1 band. We think that this is because the anti‐Sp1 immunoglobulin G we used for the supershift experiment competitively binds to Sp1's DNA binding domain and therefore that Sp1's bind diminished instead of being uppershifted. The suppressed expression in growth factor receptors is relatively selective for VEGFR2 and Tie2 (Fig. 7A). The effect would be dependent on cell type and experimental conditions. Combination of the current findings and what was reported previously^{( 15} , ^{21 )} suggests that the primary target of β‐HIVS is the phosphorylation of several tyrosine kinase receptors in vascular endothelial and/or progenitor cells, and as a secondary effect, the expression of VEGFR2 and Tie2 is suppressed due to reduced MAPK‐Sp1 signaling (Fig. 8). It was recently reported that the autocrine VEGF/VEGFR2 signaling pathway is required for homeostasis of blood vessels.^{( 22 )} Indeed, β‐HIVS at higher concentrations (10 µM) induced apoptosis in vascular endothelial cells (Supplementary Fig. S3).

Figure 8.

Hypothetical molecular mechanism. Shikonin and β‐hydroxyisovalerylshikonin (β‐HIVS) suppress angiogenesis by inhibiting the phosphorylation of vascular endothelial growth factor receptor (VEGFR)2 and Tie2, subsequent inhibition of externally regulated kinases (ERK) and downstream Sp1, culminating in suppression of VEGFR2 and Tie2 expression. ATP, adenosine triphosphate.

Both VEGF/VEGFR and Ang/Tie2 signaling pathways were important for tumor‐associated angiogenesis^{( 5} , ^{23 )} and vasculogenesis.^{( 4 )} Several compounds have been shown to inhibit either the expression or the phosphorylation of VEGFR2.^{( 24 )} Most of the clinically‐used anti‐angiogenic reagents are inhibitors that target VEGFR,^{( 24 )} whereas a few angiogenesis inhibitors (all‐trans retinoic acid and 3’‐sulfoquinovosyl‐1’‐monoacylglycerol) have been reported to suppress the expression of Tie2.^{( 12} , ^{25 )} Thus, anti‐angiogenic activity targeting Tie2 has been drawing increased attention.^{( 26} , ^{27 )}β‐HIVS simultaneously suppressed both the expression and the phosphorylation of VRGFR2 as well as Tie2, suggesting that shikonins would be a novel leading compound to develop an anti‐angiogenic reagent with unique bifunctional inhibition of the growth of endothelial cells and vascular remodeling. We are now examining the potential synergistic effect of a combinational use of β‐HIVS and other clinically‐used VEGFR2 inhibitors in the Matrigel plug assay, based upon our previous finding that the combination of β‐HIVS and STI571 suppresses phosphorylation of the BCR/ABL‐encoded tyrosine kinase more efficiently than either β‐HIVS or STI571 alone in K562 cells.^{( 28 )}

Supporting information

Fig. S1. Morphological changes in the vasculature in the kidney, tracheal mucosa and liver.

Fig. S2. Effect of β‐HIVS on proteinuria.

Fig. S3. Induction of apotosis in HUVEC cultures by β‐HIVS.

Please note: Wiley‐Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

Supporting info item

Supporting info item

Supporting info item

Supporting info item