B‐1 lymphocytes increase metastatic behavior of melanoma cells through the extracellular signal‐regulated kinase pathway

Abstract

Increasing evidence indicates that tumors require a constant influx of myelomonocytic cells to support their malignant behavior. This is caused by tumor‐derived factors, which recruit and induce functional differentiation of myelomonocytic cells, most of which are macrophages. Although myeloid lineages are the classical precursors of macrophages, B‐lymphoid lineages such as B‐1 cells, a subset of B‐lymphocytes found predominantly in pleural and peritoneal cavities, are also able to migrate to inflammatory sites and differentiate into mononuclear phagocytes exhibiting macrophage‐like phenotypes. Here we examined the interplay of B‐1 cells and tumor cells, and checked whether this interaction provides signals to influence melanoma cells metastases. Using in vitro coculture experiments we showed that B16, a murine melanoma cell line, and B‐1 cells physically interact. Moreover, interaction of B16 with B‐1 cells leads to up‐regulation of metastasis‐related gene expression (MMP‐9 and CXCR‐4), increasing its metastatic potential, as revealed by experimental metastases assays in vivo. We also provide evidence that B16 cells exhibit markedly up‐regulated phosphorylation of the extracellular signal–regulated kinase (ERK) when cocultured with B‐1 cells. Inhibition of ERK phosphorylation induced by B‐1 cells with inhibitors of MEK1/2 strongly suppressed the induction of MMP‐9 and CXCR‐4 mRNA expression and impaired the increased metastatic behavior of B16. In addition, constitutive levels of ERK1/2 phosphorylation in B‐1 cells are necessary for their commitment to affect the metastatic potential of B16 cells. Our findings show for the first time that B‐1 lymphocytes can contribute to tumor cell properties required for invasiveness during metastatic spread. (Cancer Sci 2008; 99: 920–928)

It is known from a variety of experimental systems that during tumor progression and metastasis, an active crosstalk occurs between tumor cells and their stroma, mainly mediated by direct cell–cell contact, or paracrine cytokine and growth factor signaling.^{( 1} , ² , ^{3 )} This tumor–stroma interplay suggests that tumors are not autonomous masses of cells but function as a complex system of many cell types.^{( 4 )} However, the precise nature of the cells that comprise normal stroma, how these cells or newly recruited cells are altered during tumor progression, and how they reciprocally interact are still poorly understood.

Most solid tumor masses, regardless of their histological type, contain a significant proportion of inflammatory cells. Among these cells, the tumor‐associated macrophages (TAMs), constitute the major inflammatory component of the stroma of many tumors.^{( 5 )} The role of TAMs in tumor progression and metastasis is extensive, affecting different aspects of the neoplastic tissue, since they produce a myriad of cytokines, chemokines, growth factors, metalloproteinases, and other bioactive mediators that may facilitate tumor‐cell proliferation, survival, and invasion.^{( 6} , ^{7 )}

Myelomonocytic lineage represents precursor cells that serve as a source for the constant renewal of tissue macrophages on demand as well as in steady‐state conditions. It is thought that monocytes in the peripheral circulation are recruited to the tumor site by the release of chemotactic cytokines where they differentiate to become TAMs.^{( 8} , ^{9 )}

More recently, immature myeloid cells (ImCs), which express the Gr‐1 (Ly6G) and Mac‐1 (CD11b) markers have also been demonstrated to accumulate in tumor sites.^{( 10} , ^{11 )} ImCs derived from tumor‐bearing mice are able to differentiate in vitro toward macrophages,^{( 10} , ¹² , ¹³ , ^{14 )} suggesting that undifferentiated myeloid cells represent another source of TAMs in the neoplastic tissue.

Although it is well established that myeloid lineages are the classical precursors of macrophages, several lines of evidences suggest that in addition to myeloid lineages, B‐lymphoid lineages can also generate phagocytic descendents exhibiting macrophage‐like characteristics. This is based on studies showing that B‐1 cells, an exclusive subset of B‐lymphocytes that are found predominantly in pleural and peritoneal cavities,^{( 15} , ^{16 )} are able to differentiate in vitro into mononuclear phagocytes exhibiting macrophage‐like phenotypes.^{( 17 )} Moreover, B‐1 cells in vivo can exit the peritoneal cavity and migrate to sites of inflammation where they differentiate into macrophage‐like cells.^{( 17 )} In another study, a subset of normal mouse splenic B‐lymphocytes, B‐1a subset, became B/macrophage (B/M) cells after coculture with normal fibroblasts, which simultaneously expressed the B‐cell markers B220, functional surface IgM, and surface IgD, along with the macrophage markers F4/80 and Mac‐1.^{( 18 )} Together these findings suggest that both B‐lymphoid and myeloid lineages are not distantly related but share signatures in their potential as precursors of mononuclear phagocytic cells.

However, in spite of the conceivable role of myeloid precursor cells themselves, and their descendents such as TAMs, as modulators of the tumor microenvironment, the interaction between tumor cells and B‐lymphoid lineages such as B‐1 cells and the influence that these cells may exert on tumor progression and metastasis have never been addressed.

In the present study we explored the interplay of B‐1 cells and melanoma cells, aiming to uncover if this interaction provides signals to modulate melanoma‐cell metastases. We established an in vitro heterotypic coculture system and determined the nature of the intercellular communication between B‐1 and melanoma cells. We also evaluated how this interaction affects melanoma‐cell metastases in vivo and examined particular aspects of molecular pathways known to be involved in the metastatic process.

Materials and Methods

Mice.  Female C57BL/6 wild‐type mice, 6–8‐weeks‐old, were obtained from the animal facilities at the National Institute of Pharmacology (INFAR), Federal University of São Paulo (UNIFESP). Female C57BL/6 interleukin‐10 (IL‐10) knock‐out mice, 6–8‐weeks‐old, were a gift from Dr João Santana da Silva (Department of Pharmacology, School of Medicine, University of São Paulo (USP), Riberão Preto). All mice were housed in a specific pathogen‐free facility and were given autoclaved food and water. The procedures that were followed in animal studies were reviewed and approved by our Institutional Animal Committee.

Cell culture.  B16 melanoma cells: B16 mouse melanoma cells with low metastatic potential were used in this study.^{( 19 )} Cells were maintained in RPMI‐1640 medium (Sigma, St Louis, MO, USA) supplemented with 10% of fetal calf serum (FCS) (Cultilab, Campinas, SP, Brazil) and 0.01% of antibiotics (complete medium). Cultures were kept at 37°C in a humidified atmosphere of 5% CO₂‐incubator as monolayer cultures. B‐1 cells: B‐1 lymphocytes were obtained as previously described by Almeida et al.^{( 17 )} Briefly, peritoneal cavity washout of C57BL/6 wild‐type or C57BL/6 IL‐10 knock‐out mice was seeded onto a tissue culture dish for 2 h at 37°C. Adherent cells were detached by scraping, and they were washed and resuspended in RPMI‐1640 medium containing 10% heat‐inactivated FCS and 0.01% of antibiotics, and cultured for 7 days without changing the medium. B‐1 cells grew in these cultures as free‐floating cells. B‐1 cell cultures obtained from peritoneal washes were assessed by flow cytometry (FACS) analysis using anti‐B220 and anti‐MAC1 antibodies before each experiment.

Cocultures of B16 and B‐1 cells.  B16 cells (10⁵) were plated onto culture dishes in complete medium and cells were left to adhere for 24 h. After this period, the medium was removed from B16 cells culture, 10 mL of complete medium containing nonadherent B‐1 cells (10⁶) was added, and both cells were cocultured for different times. After those periods B‐1 cells were removed by aspiration and adherent B16 cells were washed three times with phosphate‐buffered saline (PBS) to remove all the remaining B‐1 cells. B16 cells were then trypsinized, resuspended in 10 mL of complete medium, and B16/B‐1 cells free from cocultures were systematically analyzed for the presence of B‐1 cells markers B220 and Mac‐1 by FACS, to assure that B16 cells were indeed free from B‐1 cells after coculturing. B16 and B‐1 monocultures or B16 cells/B‐1‐cell free from cocultures were used either for total‐cell‐extract preparation or submitted to experimental metastasis assay. Alternatively, after adhesion of B16 cells to the plates, cells were washed with PBS and cultures were serum‐starved overnight. After this period, B‐1 cells (10⁶) were added to B16 cell plates and both cells were kept in serum free conditions for 1 h. B‐1 cells were then removed as described above and B16/B‐1 cells free from cocultures were used for total‐cell‐extract preparation and Western blot analysis.

Analysis of cell surface molecules by FACS.  Cells were collected and washed twice with PBS and adjusted at a concentration of 10⁶ cells/sample. Cells were double‐stained with phycoerytrin‐labeled anti‐B220 and fluorescein‐isothiocyanate‐labeled anti‐MAC‐1 (Pharmingen, San Diego, CA, USA), diluted 1:100 in 1% bovine serum albumine (BSA) in PBS, and incubated for 1 h in the dark, on ice. After this, cells were washed and resuspended in 500 µL PBS and doubled‐marked cell populations were analyzed by the CellQuest program using FACSCalibur (Beckton Dickinson, Mountain View, CA, USA).

Inhibition of cellular attachment.  To yield a nonadherent culture condition, cells were plated onto culture dishes precoated with agarose 1% and incubated at 37°C and 5% CO₂ for 72 h. After this, cells in suspension were collected from the agarose coated dishes by pipetting and cell viability was evaluated by trypan blue dye exclusion test. Cell aggregates were mechanically separated, counted, and prepared for experimental metastasis assay.

Experimental metastasis assay.  Cells were collected and resuspended in PBS to a concentration of 10⁶ cells per ml. Then, 10⁵ cells (0.1 mL) were injected into the lateral tail vein of syngeneic C57BL/6 mice using a 27‐gauge needle. Each experimental group contained at least three animals. Mice were sacrificed 14 days postinoculation, lungs were surgically removed, and metastatic tumor colonies in the lungs were macroscopically scored.

Total cell lysate, Western blotting, antibodies, and inhibitors.  For total protein extraction, cells were washed twice with ice‐cold PBS pH 7.4, and then lyzed in 100 µL of lyzes buffer (20 mM Tris‐HCl pH 7.4, 100 mM NaCl, 1 mM Na₃VO₄, 50 mM NaF, 0.5% NP‐40, 1 mM PMSF, 10 µg/mL each leupeptin and aprotinin), for 10 min at 4°C, followed by centrifugation at 17 740g for 15 min at 4°C. The supernatant was collected and protein concentration was measured by the Bradford method. Cell lysates were prepared with 5 X Laemmli buffer and boiled for 5 min at 95°C. Equivalent amounts of protein (40 µg) were separated by sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS‐PAGE) and immunoblotted following standard protocol,^{( 20 )} using the following antibodies: phospho‐ERK (E‐4, sc‐7383) and total ERK (K‐23, sc‐94), obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). For experiments aiming to inhibit phosphorylation of ERK, the MEK inhibitor (PD98059) from Cell Signaling Technology (Beverly, MA, USA) was employed.

Electron microscopy.  Cocultures of B16 and B‐1 cells were performed in cover glass inside a 12‐well plate (Costar). After 48 h of coculture, samples were fixed in 50% glutaraldehyde, 4% formaldehyde, and 0.2 M sodium cacodylate, pH 7.2 for 2 h. Samples were washed with 0.1 M cacodylate buffer for 1 h each. After being postfixed with 2% osmium tetroxide in 0.1 M cacodylate buffer, samples were washed three times and dehydrated in a crescent concentration of ethanol and propylene oxide. Samples were embedded in Araldite resin and kept under a vacuum for 4 h and were then polymerized at 60°C for 40 h. Araldite‐embedded samples were cut with glass knives. Ninety to 95 µm thick sections were placed onto 300 mesh copper or nickel grids and stained with 2% aqueous uranyl acetate for 8 min. These preparations were subsequently stained with lead citrate in distilled water for 4 min. Grids were examined and cells were photographed with a JEOL JEM 1200 EX II electron microscope (JEOL, Tokyo, Japan).

IL‐10 detection by ELISA.  IL‐10 concentration was determined in culture supernatants of B‐1 cells obtained from wild‐type or IL‐10 knock‐out mice. B‐1 cells were cultivated as described above and supernatants were collected after 7 days of culturing and were maintained at 70°C until use. For cytokine determination, microplates (Nunc) were sensitized overnight at room temperature with anti‐IL‐10 monoclonal antibodies (R&D Systems, Minneapolis, MN, USA) following the manufacturerís recommendations. Plates were washed four times with PBS containing 0.05% Tween 20 (PBS‐T), and non‐specific binding was prevented by incubating the plates for 2 h at room temperature with 200 µL per well of 3% BSA in PBS. Plates were washed four times with PBS‐T and incubated for 2 h with 100 µL per well of each supernatant, or with the IL‐10 standard curve (R&D Systems) diluted serially in PBS containing 2% BSA. Plates were then washed four times with PBS‐T and incubated for 2 h with 100 µL/well of anti‐IL‐10 antibodies (R&D Systems) at room temperature. Plates were then washed four times with PBS‐T and incubated for 20 min with streptavidin‐HRP at room temperature. Reactions were stopped with 4 N H2SO4 (50 µL/well). Absorbance was read at 450 nm in a microplate reader apparatus (Labsystem Multiskan MN; UNH, Santa Fe, NM, USA). The sensitivity of the test was 20 pg/mL. Results are reported as mean ± SD.

Quantitative real‐time reverse transcription–polymerase chain reaction (RT‐PCR).  Total RNA was extracted from cell cultures with Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufactureís instructions. Three micrograms of RNA were reverse‐transcribed to cDNA with Superscript III (Invitrogen) and normalized by PCR for glyceraldehydes 3′‐phosphate dehydrogenase (GAPDH), according to the manufacturerís recommendations. Real‐time PCR was performed on an ABI 7000 Real Time PCR System (Applied Biosystems, Foster City, CA, USA) using the SYBR Green PCR Master Mix (Applied Biosystems). The primers were obtained from Invitrogen, and the sequences optimized for real‐time PCR were as follows: CXCR4 sense 5′‐TGGAACCGATCAGTGTGAGT‐3′ and antisense 5′‐GTAGATGGTGGGCAGGAAGA‐3′, MMP‐9 sense 5′‐CATTCGCGTGGATAAGGAGT‐3′ and antisense 5′‐GGTC CACCTTGTTCACC TCA‐3′, GAPDH sense 5′‐AAATG GTGAAGGTCGGTGTG‐3′ and antisense 5′‐TGAAGGGG TCGTTGATGG‐3′. Samples were run in triplicate in three independent assays and relative quantification of mRNA levels was performed using the comparative threshold cycle method, with amplification of the target genes and GAPDH in separate tubes.

Statistical analysis.   All data represent at least three independent experiments and are expressed as mean ± SD. Statistical comparisons were made by anova and by the Tukey–Kramer test. P‐values of less than 0.05 were considered statistically significant.

Results

Establishment and characterization of the coculture system.  In order to determine whether B‐1 cells (B‐1) may affect the metastatic potential of melanoma cells, 10⁶ nonadhesive B‐1 was cocultured for 48 and 72 h with 10⁶ B16 mouse melanoma cells of low metastatic potential. After these periods, B‐1 was washed off from the cocultures and B16 cells were injected into the lateral tail vein of mice to investigate metastasis formation in vivo. FACS showed that the doubled‐marked cell population for B‐1 markers B220 and Mac‐1 were presented on B‐1 cells cultivated alone but were absent either on B16 cells monoculture or on B16/B‐1 cells free after coculture, indicating the absence of B‐1 (Fig. 1a). After 14 days of inoculation, metastatic tumor colonies in the lungs of animals were macroscopically scored. The results in Figure 1b show that inoculation of B16 from cocultures significantly increased the numbers of lung colonies in a coculture in a time‐dependent manner compared with the control groups inoculated either with B16 or B‐1 cultivated alone. Also cocultures of 72 h were generated to investigate the influence of increasing the number of B1 cells on a fixed population of B16 cells. As shown in Figure 1c, the metastatic behavior of B16 cells was significantly increased when up to 10⁵ B‐1 cells, but not bellow this threshold, were present in the coculture.

Figure 1.

B‐1 increases the metastatic behavior of B16 cells after coculturing. (a) B‐1 and B16 cells cultured alone or B16/B‐1 cells free from cocultures of 72 h were double‐stained for B‐1 markers B220 and MAC‐1 and analyzed by flow cytometry analysis as described in Materials and Methods. Double‐marked cells populations are shown on the upper right panel and the percentage of cells is indicated. (b) B‐1 and B16 cultured alone or B16 cocultured with B‐1 (B16 + B1) were cultured for 48 and 72 h. After these periods, cells cultivated alone or B16/B‐1 cells free from cocultures were collected and submitted to experimental metastasis assay. (c) B16 cultured alone or 1 × 10⁶ B16 cells cocultured with different concentrations of B‐1 cells, as indicated, were cultured for 72 h. After this period, B16 cells cultivated alone or B16/B‐1 cells free from cocultures were collected and submitted to experimental metastasis assay. (d) B‐1, B16, or B16 cocultured with B‐1 (B16 + B1), were plated under nonadherent conditions for 72 h. After this period, cells from monocultures or mixed cocultured cells were collected and submitted to experimental metastasis assay, as described in Materials and Methods. Data bars represent the mean number of tumor colonies per lung per experimental condition ± SE. P < 0.05 represents statistical significance.

In our coculture system, B16 is a plastic adherent cell while B‐1 is nonadherent. Therefore, we checked if the increased metastatic behavior of B16, induced by the presence of B‐1, is dependent on the adhesion of B16 to the plastic. To test this, both cell types were cocultured onto a nonadhesive substrate for 72 h and subjected to experimental metastasis assay in vivo. As shown in Figure 1d, animals injected with B16/B‐1 cells cocultured in suspension also produced significantly larger numbers of lung colonies compared to control groups injected either with B16 or B‐1 cultured alone on the same conditions. Loss of cell viability was not observed in monocultures of both cell types when held in suspension for 72 h (data not shown). Together these findings indicate that the presence of B‐1 altered the metastatic potential of B16 to behave more aggressively and that adhesion of B16 is not necessary for this effect.

To test whether direct physical contact between B16 and B‐1 is required, conditioned media from B‐1 were added to B16‐cell culture. As shown in Figure 2a, no significant differences in the numbers of lung metastasis were observed when B16 cells were cultured in their own media compared to B16 cells cultured in conditioned media either from B‐1‐cell single cultures or from cocultures of B16/B‐1 cells. On the other hand, the numbers of lung metastasis were significantly increased when B16/B‐1 cells free from cocultures were injected. These results indicate that B‐1 soluble factors alone are not sufficient to support the increased metastatic behavior of B16, suggesting that intercellular contact between them may occur. This idea is supported by experiments where B16 and B‐1 cells were cocultured for 48 h followed by electron transmission microscopy analysis. Figure 2b shows a small B‐1 cell with its atypical nuclear morphology with re‐entrances delimiting two distinct lobes.^{( 21 )} Membrane projections on B‐1 are also seen contacting some regions of the B16 cell membrane, which in some areas is protruding in the form of an arm surrounding B‐1. These observations indicate that there is indeed physical contact between these cells during the coculture.

Figure 2.

B‐1 physically interacts with B16 in vitro. (a) B16 cells were cultured for 72 h alone (B16), cocultured with B1 (B16 + B1), or placed in conditioned medium from 5 days with cultures of either B‐1 cells (B1‐med) or cocultures of B16/B1 cells (B16/B1‐med). After this period, B16 cells from monocultures or B16/B‐1 cells free from coculture were collected and submitted to experimental metastasis assay. Bars represent the mean number of tumor colonies per lung per experimental condition ± SE. P < 0.05 represents statistical significance. (b) Transmission electron microscopy of B16 and B‐1 cells from cocultures of 48 h. Arrows indicate points of interaction between B‐1 and B16 cell membranes. (Scale bar: 1 µm).

ERK phosphorylation is increased in B16 cells after interaction with B‐1 cells.  Considering that B16 and B‐1 can physically interact, we explored if signaling intermediates involved in metastasis could be activated in B16 cells upon interaction with B‐1. Therefore we checked ERK, a downstream kinase of the MAPK pathway. Activation of ERK requires its phosphorylation by the MEK kinases, resulting in a substantial translocation of phosphorylated ERK to the nucleus, where it functions to modify the activity of transcription factors, thereby regulating genetic program.^{( 22 )} Using an antibody that specifically recognizes the dually phosphorylated‐activated form of ERK, we found that under serum‐starved conditions basal phosphorylation of ERK was detected in both B16 and B‐1 cells (Fig. 3a,b). On the other hand, B16 showed a slight increase in the phosphorylation of ERK upon addition of serum, whereas in B‐1 phospho‐ERK levels remained unchanged, indicating that both cell types have ERK phosphorylation constitutively.

Figure 3.

Extracellular signal–related kinase (ERK) phosphorylation is increased in B16F10 after coculture with B‐1. (a) B16 and (b) B‐1 monocultures were serum starved overnight and stimulated or not with 10% fetal calf serum (FCS) for 1 h, as indicated. (c) B16 cultured alone or 1 × 10⁶ B16 cells cocultured with different concentrations of B‐1 cells, as indicated, were cultured for 72 h. After this period, B16 cells cultivated alone or B16/B‐1 cells free from cocultures were analyzed for detection of phospho‐ERK levels. Whole‐cell extracts of each treatment were probed with antiphospho‐ERK (p‐ERK) and anti‐ERK (Total ERK) by Western blot analysis.

To test whether interaction with B‐1 would augment the levels of phospho‐ERK in B16, these cells were cocultured or not for 72 h with different concentrations of B‐1 cells. After this period, cell extracts of B16 monocultures or B16/B‐1 cells free from cocultures were produced and submitted to immunobloting for detection of ERK phosphorylation. As shown in Figure 3c, a considerable increase in phosphorylation of ERK was observed in B16 when up to 10⁵ B‐1 cells were present in the cocultures. Interestingly, this result clearly correlates with the B‐1 dose‐dependent increased metastatic behavior of B16 cells shown in Figure 1c.

Increased metastatic potential of B16 cells is mediated by the up‐regulation of ERK phosphorylation.  We asked whether increased phosphorylation of ERK induced by B‐1 contributes to the enhanced metastatic potential of B16. Therefore, we first treated B16 monocultures in the presence or absence of different concentrations of either PD98059 or U0126, two pharmacological inhibitors of MEK, which is the upstream kinase of ERK. As shown in Figure 4a,b, basal levels of ERK phosphorylation were almost completely abrogated in B16 monocultures in the presence of 40 µM PD98059 or with 10 µM U0126, respectively. Treatment with PD98059 or U0126 at concentrations and time of incubation did not affect the cell viability of B16 cells as determined by trypan blue staining (data not shown).

Figure 4.

Increased metastatic behavior of B16 cells induced by B‐1 is dependent on the levels of extracellular signal–regulated kinase (ERK) phosphorylation. (a,b) B16 and B‐1 cells were cultured alone in complete medium and treated or not with different concentrations of PD098059 or U0126 for 24 h, as indicated. After this period, extracts were prepared and analyzed for detection of phospho‐ERK levels by Western blot. (c,d) B16 cells were cultured alone or B16 + B1 cells were cocultured in the absence (B16 + B1) or presence of different concentrations of either PD098059 or U0126 for 72 h, as indicated. After this period, B16 cells from monocultures or B16/B‐1 cells free from cocultures were collected and submitted to either immunobloting analysis for detection of phospho‐ERK levels (upper panel) or to experimental metastasis assay (lower panel). Bars represent the mean number of tumor colonies per lung per experimental condition ± SE. P < 0.05 represents statistical signficance.

Next we checked if using either PD98059 or U0126 to prevent the increased phosphorylation of ERK induced by B‐1 would inhibit the enhanced metastatic behavior of B16. Therefore, cocultures of B16/B‐1 cells were treated or not with different concentrations of PD98059 or U0126 for 72 h. After this period, B‐1 cells were eliminated from the cocultures and B16 cells only were submitted either to immunobloting for detection of phospho‐ERK levels or to experimental metastasis assay. As shown in Figure 4c,d (upper panel), irrespective of whether cocultures were treated with 40 µM PD98059 or with 10 µM U0126, but not bellow these concentrations, phospho‐ERK remained at levels similar to those observed in untreated B16 single cultures. In contrast, phospho‐ERK levels were increased in B16 from untreated cocultures. Interestingly, by preventing the increased phosphorylation of ERK induced by B‐1 with either of the MEK inhibitors, the numbers of B16 metastatic nodules were not as statistically different as those found in animals injected with B16 cultured alone in the absence of the drugs, while B16 from untreated cocultures developed significantly more metastatic nodules (Fig. 4c,d, compare upper and lower panel). Together these results indicate that there is a clear association between increased phosphorylation of ERK induced by B‐1 and the augmentation of the metastatic potential of B16 cells.

B‐1 induces metastasis‐related gene expression in B16 cells.  To further explore the biological influence of B‐1 on the metastatic potential of B16 cells, we evaluated the expression of metastasis‐related genes such as metalloproteinase‐9 (MMP‐9) and the chemokine receptor CXCR4.^{( 23} , ²⁴ , ²⁵ , ²⁶ , ^{27 )} As shown in Figure 5, MMP‐9 and CXCR4 mRNA expression were enhanced in B16 cells which were cocultured with B‐1 compared to B16 cells cultured alone. In contrast, increased MMP‐9 and CXCR4 mRNA expression were inhibited in B16 cells from cocultures with B‐1 in the presence of PD98059. Together these results suggest that the increased phosphorylation of ERK induced by B‐1 regulates the expression of metastasis‐related genes in B16 cells, which in turn may contribute to their enhanced metastatic behavior.

Figure 5.

B‐1 induces the expression of metastasis‐related genes in B16. B16 cells were either cultured alone or cocultured with B‐1 in the presence or absence or PD98059 (40 µM) for 48 h. For cocultures, only B16/B‐1 cells free after coculture were analyzed. The relative levels of matrix metalloproteinase‐9 (MMP‐9) and CXCR4 were measured by real‐time polymerase chain reaction. Each value represents the mean ± SEM for three samples. P < 0.05 represents statistical significance.

B‐1 requires constitutive levels of ERK phosphorylation to change the metastatic potential of B16 cells.  Our results showed that ex vivo B‐1 cells have constitutive levels of ERK phosphorylation (Fig. 3b). Therefore, we evaluated if this signaling pathway is implicated in the commitment of B‐1 to mediate the increased metastatic potential of B16.

It is known that B‐1 cells produce and utilize IL‐10 as an autocrine growth factor.^{( 28 )} Moreover, there have been several reports suggesting that IL‐10 promotes ERK activation,^{( 29} , ³⁰ , ³¹ , ^{32 )} while others have associated the efficient transcription of IL‐10 with ERK activity.^{( 33 )} Based on these premises, we checked the status of ERK phosphorylation in B‐1 cells derived from the peritoneal cavity of IL‐10 knockout mice. As shown in Figure 6a, IL‐10 was present in the supernatant of B‐1 cultures from wild‐type mice (B‐1 wt), whereas it was absent in cultures of B‐1 from IL‐10 knockout mice (B‐1 KO). Interestingly, ERK phosphorylation levels were notably lower in B‐1 KO compared to those found in B‐1 wt (Fig. 6b), showing that the magnitude of constitutive ERK phosphorylation is different in these two cells. When we checked ERK phosphorylation in B16 from cocultures with B‐1 KO, phospho‐ERK remained basal, whereas these levels were augmented in B16 from cocultures with B‐1 wt (Fig. 6c). In addition, increased phosphorylation of ERK was impaired in B16 from cocultures in which B‐1 wt were pretreated with 40 µM PD98059 before coculturing (Fig. 6c), a concentration which was able to completely inhibit ERK phosphorylation in B‐1 cells cultured alone (Fig. 6d). Consistent with these findings, cocultures in the presence of B‐1 wt, but not with B‐1 KO or B‐1 wt pretreated with PD98059, increased the metastatic behavior of B16 cells as revealed by the numbers of lung colonies (Fig. 6e). Taken together, these results support the hypothesis that constitutive levels of ERK phosphorylation in B‐1 take part in the commitment of these cells to affect the metastatic potential of B16.

Figure 6.

B‐1 requires constitutive levels of phospho‐extracellular signal–regulated kinase (ERK) to increase the metastatic behavior of B16 cells. (a) Determination of interleukin‐10 (IL‐10) production in culture supernatants of B‐1 cells isolated either from wild‐type mice (B‐1wt) or from IL‐10 knockout mice (B‐1KO). (b–d) Western blot analysis for detection of phospho‐ERK levels; (b) total extracts from monocultures of B‐1wt and B1KO; (c) B16 cells were serum‐starved overnight and cocultured or not for 48 h with B1wt (B16 + B1wt), B1KO (B16 + B1KO), or with B‐1wt pretreated with 40 µM PD98059 for 24 h before coculturing (B16 + [B1wt + PD]). Cells from monocultures or B16/B‐1 cells free from cocultures were collected and total extracts were produced. (d) B‐1 cells monocultures were treated or not with different concentrations of PD98059 for 24 h. (e) B16 cells were treated as described in (c) and B16 cells from monocultures or B16/B‐1 cells free from cocultures were collected and submitted to experimental metastasis assay. Bars represent the mean number of tumor colonies per lung per experimental condition ± SE. P < 0.05 represents statistical significance.

To rule out that IL‐10 produced by B‐1 wt could increase ERK phosphorylation in B16, these cells were treated with recombinant IL‐10 (rIL‐10). As shown in Figure 7, rIL‐10 was not able to increase phospho‐ERK levels (Fig. 7a) and this was correlated with the inability of either rIL‐10 or conditioned medium from B‐1 wt cultures to enhance the metastatic potential of B16 (Fig. 7b).

Figure 7.

Phospho‐extracellular signal–regulated kinase (ERK) levels and the metastatic behavior of B16 cells are not increased by recombinant interleukin‐10 (rIL‐10). (a) B16 cells were serum starved overnight and cells were treated or not with different concentrations of recombinant IL‐10 (rIL‐10) for different times or stimulated with 10% fetal calf serum (FCS) for 1 h, as indicated. Total cell extracts were produced and analyzed for phospho‐ERK levels by Western blot. (b) B16 cells were serum starved overnight and cocultured or not with B‐1 cells for 48 h in the presence or absence of different concentrations of rIL‐10 or B‐1 conditioned medium (B1‐med), as indicated. B16 cells from monocultures or B16/B‐1 cells free from cocultures were collected and submitted to experimental metastasis assay. Bars represent the mean number of tumor colonies per lung per experimental condition ± SE. P < 0.05 represents statistical significance.

Discussion

Melanoma invasion and metastasis formation is a multifactorial process and extensive research has demonstrated that regulatory signals originate from the surrounding host cells either directly through physical contact or indirectly through soluble factors, and extracellular matrix molecules are critical determinants of melanoma development.^{( 34} , ^{35 )}

In the current study, we presented evidence that in vitro interaction of low‐metastatic murine melanoma cells (B16) with B‐1 cells, an exclusive subset of B lymphocyte that are found predominantly in pleural and peritoneal cavities,^{( 15} , ^{16 )} resulted in metastatic potential enhancement of B16. Our results showed that B16/B‐1 cells physically interact in vitro and that B‐1 soluble factors are not sufficient to induce the increased metastatic behavior of B16, suggesting that cell–cell contact participates in this effect.

We also suggest that the metastasis‐promoting effects of B‐1 on B16 cells requires activation of the ERK signaling pathway. B16 cells from cocultures with B‐1 presented increased ERK phosphorylation. When the augmentation of ERK phosphorylation was prevented by different MEK inhibitors, the increased metastatic behavior of B16 cells was impaired. In contrast, B16 cells cultured alone showed constitutive basal levels of ERK phosphorylation, and complete inhibition of ERK activity in these cells with either of the MEK inhibitors did not inhibit their ability to form metastases (Fig. 4c,d, and data not shown). This observation suggests that the intrinsic phenotype of this low‐metastatic melanoma cell line may be supported by another pathway unrelated to the minimal background of ERK activity. Interestingly, phospho‐ERK levels in B16 cells from cocultures with B‐1 were increased above the basal levels observed in B16 cultured alone, showing that mediated B‐1 increased phosphorylation of ERK over this threshold is required to trigger more aggressive metastatic behavior.

There is substantial evidence that suggests that activation of the ERK pathway is important to melanoma cell invasion, motility, and MMP production,^{( 36} , ³⁷ , ^{38 )} and therefore the activation may be necessary for extravasation and/or for migration to a supportive environment in the lung. Indeed, we have found increased mRNA expression of MMP‐9 in B16 cells cocultured with B‐1, whereas treatment of cocultured cells with the MEK inhibitor (PD98059) counteracted this effect. Like others, our data support the role of the ERK signaling pathway as being involved in the regulation of MMP‐9 expression in cancer cells.^{( 23} , ³⁹ , ^{40 )} Moreover, mRNA expression of the chemokine receptor CXCR4, which has been described as playing an important role in metastasis, providing migratory direction to tumor cells,^{( 41 )} was also increased in B16 cells cocultured with B‐1. The role of CXCR4 in melanoma metastasis is consistent with previously reported findings showing that B16 melanoma cells transfected with CXCR4 produced an increased number of pulmonary nodules compared to mock‐transfected cells.^{( 42 )} Strikingly, we showed that mRNA expression of CXCR4 was abolished in B16 from cocultures with B‐1 in the presence of PD98059, suggesting that CXCR4 expression is by some means controlled by the increased activity of ERK induced by B‐1. Although the mechanism for this effect remains to be defined, a recent report has provided evidence that downstream components of the ERK pathway, such as Ets1, play a critical role in CXCR4 transcription and protein expression.^{( 43 )}

A remarkable finding in this report was the requirement of constitutive levels of ERK phosphorylation in B‐1 for their commitment to induce the increased metastatic potential of B16. We showed that when inhibiting constitutive phosphorylation of ERK in B‐1 cells with PD98059, neither ERK phosphophorylation nor the metastatic potential of B16 cells were increased. This observation was further supported by studies using B‐1 cells from IL‐10 knockout mice which showed considerably low levels of constitutive ERK phosphorylation compared to higher levels in B‐1 cells from wild‐type mice. Moreover, transmission electron microscopy from cocultures of B16/B1 cells, where B‐1 cells were either pretreated with PD98059 before coculturing or both cell types were cocultured in the presence of PD98059, reveled the absence of physical‐membrane contact between these cells (data not shown), suggesting that constitutive ERK activity in B‐1 plays a role in mediating this heterotypic interaction.

Constitutive phosphorylation of ERK has been previously demonstrated in B‐1 but not in B‐2 cells.^{( 44 )} Although ERK activity is not necessary for the extended survival of B‐1 cells in culture,^{( 44 )} it is currently unknown what functional aspects of B‐1 cell physiology are regulated by this kinase. Considering our results, we do not yet comprehend why B‐1 cells require constitutive levels of ERK phosphorylation to increase the metastatic potential of B16 cells. However, accumulating evidence has demonstrated that differences in the duration, magnitude, and subcellular compartmentalization of ERK activity determine signaling specificity.^{( 45} , ⁴⁶ , ^{47 )} Since our data argue in favor of a physical contact between B‐1 and B16 cells, it is reasonable to speculate that only at the extent of constitutive levels, but not below this threshold, can phosphorylated ERK control regulatory programs by allowing the expression of B‐1‐specific cell‐surface molecule(s), which in turn communicates with B16 cells through an interactive network of cell–cell signaling.

In addition to constitutive ERK activation, it has been suggested that B‐1 cells also present constitutively active forms of the signal transducer and activator of transcription (Stat)‐3, which seems to play a role in the self‐renewing growth characteristics of B‐1 cells.^{( 48} , ⁴⁹ , ^{50 )} Although the role of tyrosine phosphorylation for Stat3 nuclear translocation and transactivation of responsive genes^{( 51 )} is clear, evidence suggests that phosphorylation at a serine residue (Ser⁷²⁷) on Stat3 also regulates its transcriptional activity.^{( 52} , ^{53 )} However, there is conflicting evidence about the identity of the kinase responsible for this serine phosphorylation and also its functions, with some reports attributing the phosphorylation to the ERKs.^{( 54 )} Whether the requirement of constitutive ERK activity in B‐1 to increase the metastatic potential of B16 is mediated by phosphorylation of Stat3 on Ser⁷²⁷ remains to be determined.

To our knowledge, these data provide the first evidence that B‐1‐lymphocytes can directly impact on the metastatic potential of tumor cells. Although in vivo B‐1 cells home predominantly in on the peritoneal and pleural cavities, these cells can exit from coelomatic cavities and migrate to an inflammatory milieu where they differentiate into macrophage‐like cells, implying that myeloid and lymphoid lineages may have a common ancestry.^{( 17 )} Infiltration of myeloid lineage cells into malignant tissue is a common feature of many epithelial neoplasms and is thought to contribute to cancer development. In this scenario, it is possible to envisage that B‐1 cells can also migrate to neoplastic lesions in vivo, contributing to metastatic spread. We are currently addressing this question by examining tumor tissue isolates for the presence of B‐1 cells. It will be of great interest to determine whether the observed effect of B‐1 on the metastatic behavior of melanoma cells presented in this study also takes place in such dynamic microenvironmental contexts in vivo.