Table 1.

Potential off-targets (pOTs) ranked as “critical” by CRISPRroots.

COORDINATES(1-based inclusive)	OFF-TARGET+CONTEXT	PAM	BINDING_STRUCT(Q-T)	FULL MATCH-MISMATCH PATTERN	ΔG_B	N. MISMATCH/UNUSED	GENES INTERESTED
Expression-based pOTs for B2M spacer: ACTCACGCTGGATAGCCTCC on-target ΔG_B= -25.73, specificity score CRISPRspec = 7.86 (high specificity)
chr3:53322664-53322685:+	CACTGCAGCCTGGACAGCCTCC	TGG	XXXXXXX|||||W|||||||_XXXXXXXXX|||||W|||||||	MMM||MM|||||W|||||||_MMM||MM|||||W|||||||	-16.57	7	CACNA1D
chr21:44945403-44945424:-	CCCCTCCCACAGGACAGCCTCC	TGG	XXXXXXXXX|||W|||||||_XXXXXXXXXXX|||W|||||||	M|||M|W|M|||W|||||||_M|||M|W|M|||W|||||||	-15.63	9	SLX9
chr17:16429570-16429591:-	GAACAAACTGTGGACAGCCTCC	CAG	XXXXXXXX||||W|||||||_XXXXXXXXXX||||W|||||||	||MM||MM||||W|||||||_||MM||MM||||W|||||||	-14.72	8	LRRC75A
chr6:136406447-136406468:-	CCTTTCCCTCCTGATAGCCTCC	TGG	XXXXXXXXXX||||||||||_XXXXXXXXXXXX||||||||||	MM||M|M|WM||||||||||_MM||M|M|WM||||||||||	-14.25	10	MAP7
chr10:99651259-99651280:-	AACCTCACTTGGGACAGCCTCC	CAG	XXXXXXXXX|||W|||||||_XXXXXXXXXXX|||W|||||||	M|||||MMM|||W|||||||_M|||||MMM|||W|||||||	-14.07	9	ENTPD7
chrX:20097313-20097334:+	TGCTACTGGCTGGACAGCCTCC	TGA	XXXXXX||||||W|||||||_XXXXXXXX||||||W|||||||	MMM|MM||||||W|||||||_MMM|MM||||||W|||||||	-13.62	6	MAP7D2
chr5:128098860-128098881:+	CCTCTCTACCAGAATAGCCTCC	AAG	XXXXXXXXX|W|||||||||_XXXXXXXXXXX|W|||||||||	M|||MMM|M|W|||||||||_M|||MMM|M|W|||||||||	-11.79	9	SLC12A2
chr16:69161920-69161941:-	AGACATTAACTGGATAACCTCC	AGA	XXXXXXX|||||||W|||||_XXXXXXXXX|||||||W|||||	||MMMMW|||||||W|||||_||MMMMW|||||||W|||||	-11.33	7	UTP4
chr2:223751416-223751437:+	TTCATCACCCCCAATAGCCTCC	TGA	XXXXXXXXXXW|||||||||_XXXXXXXXXXXXW|||||||||	MM||||M|WMW|||||||||_MM||||M|WMW|||||||||	-10.18	10	AP1S3
Expression-based pOTs TRAC spacer: TCAGGGTTCTGGATATCTGT on-target ΔG_B= -21.58, specificity score CRISPRspec = 5.20 (medium specificity)
chr1:116623693-116623714:-	GACTGTGGGACTGGATATCTGT	GAG	XXXXXXXX||||||||||||_XXXXXXXXXX||||||||||||	WMMM||MM||||||||||||_WMMM||MM||||||||||||	-10.65	8	IGSF3
chr10:29617348-29617369:-	CAACATGGCTATGGATATCTGT	AAG	XXXXXXXXX|||||||||||_XXXXXXXXXXX|||||||||||	M||M||W|M|||||||||||_M||M||W|M|||||||||||	-10.35	9	SVIL
chr11:108439331-108439352:+	AGCATGAGATATGGATATCTGT	AAG	XXXXXXXXX|||||||||||_XXXXXXXXXXX|||||||||||	WMM|W|M|M|||||||||||_WMM|W|M|M|||||||||||	-10.35	9	POGLUT3
chr8:9039809-9039830:-	AAATTAGGTTCTAGATATCTGC	CAG	XXXW||||||W||||||||W_XXXXXW||||||W||||||||W	MMMW||||||W||||||||W_MMMW||||||W||||||||W	-9.97	3	ERI1
chr4:88385686-88385707:+	GAGAAGAGTTAAGGATATCTGT	AAG	XXXXXXXXXX||||||||||_XXXXXXXXXXXX||||||||||	MM||W|||MM||||||||||_MM||W|||MM||||||||||	-9.03	10	HERC6
chr1:236562926-236562947:-	TAAGAGTTTTCCGGATATCTGC	GGA	XXXXXXX||W|||||||||W_XXXXXXXXX||W|||||||||W	MM||MM|||W|||||||||W_MM||MM|||W|||||||||W	-8.38	7	HEATR1
chr2:223689455-223689476:-	ACATTTGGCTCAGGATATCTGT	GGA	XXXXXXXXXX||||||||||_XXXXXXXXXXXX||||||||||	MMMM||W||M||||||||||_MMMM||W||M||||||||||	-8.02	10	AP1S3
chr7:137405020-137405041:+	ATTAAGGTACCTGGACATCTGT	GGA	XXXXXXXX|||||W||||||_XXXXXXXXXX|||||W||||||	|M|||MMW|||||W||||||_|M|||MMW|||||W||||||	-7.41	8	DGKI
chr17:75469014-75469035:-	GTGCTGGGTCCTGGACATCTAC	AGG	XXX||||W|||||W||||WW_XXXXX||||W|||||W||||WW	M|M||||W|||||W||||WW_M|M||||W|||||W||||WW	-7.2	3	CASKIN2
chr1:41800632-41800653:-	CATCAGAGCCCTAGACATCTGT	AGG	||||W|WW||W||W||||||_XX||||W|WW||W||W||||||	||||W|WW||W||W||||||_||||W|WW||W||W||||||	-6.39	0	HIVEP3
chr12:113874481-113874502:-	TTTCAGGTTCCAGGATACCTGT	CAG	XXXXXXXXXX|||||W||||_XXXXXXXXXXXX|||||W||||	|||||M|W|M|||||W||||_|||||M|W|M|||||W||||	-6.18	10	RBM19
chr15:23000525-23000546:+	AGGTAGGCTTCAAGATATCTGT	GGA	XXXXXXXXXXW|||||||||_XXXXXXXXXXXXW|||||||||	MM|||M|||MW|||||||||_MM|||M|||MW|||||||||	-5.74	10	TUBGCP5
chr9:111415068-111415089:-	TAGGAGGATTTTGAATATCTGT	AGA	XXXXXXXXX||W||||||||_XXXXXXXXXXX||W||||||||	MM|||W||M||W||||||||_MM|||W||M||W||||||||	-5.43	9	ECPAS
chr13:59914820-59914841:-	ATTAAGGATTATAGACATCTGT	GAG	XXXXXXXXXXW||W||||||_XXXXXXXXXXXXW||W||||||	|M|||W||M|W||W||||||_|M|||W||M|W||W||||||	-4.15	10	DIAPH3
chr6:107080973-107080994:-	TATCAGGGACTTGAACATCTGT	GGA	XXXXXXXXX||W|W||||||_XXXXXXXXXXX||W|W||||||	||||||MWM||W|W||||||_||||||MWM||W|W||||||	-3.38	9	BEND3
chr7:137402130-137402151:+	GATCAGGGACTTGAACATCTGT	AGA	XXXXXXXXX||W|W||||||_XXXXXXXXXXX||W|W||||||	||||||MWM||W|W||||||_||||||MWM||W|W||||||	-3.38	9	DGKI
chr7:158615207-158615228:-	TACCAGGGACTTGAACATCTGT	GGA	XXXXXXXXX||W|W||||||_XXXXXXXXXXX||W|W||||||	W|||||MWM||W|W||||||_W|||||MWM||W|W||||||	-3.38	9	NCAPG2
chr6:159762279-159762300:-	TGTCAGGCCTTTGGATACCTAC	AGA	XXXXXXXXX||||||W||WW_XXXXXXXXXXX||||||W||WW	|||||MW|M||||||W||WW_|||||MW|M||||||W||WW	-1.04	9	TCP1
chr16:78184267-78184288:+	AATCAGGATTAAGGATATCCAC	TGA	|||||W||MM|||||||WWW_XX|||||W||MM|||||||WWW	|||||W||MM|||||||WWW_|||||W||MM|||||||WWW	-0.67	2	WWOX
Variant-based pOTs for TRAC spacer TCAGGGTTCTGGATATCTGT on-target ΔG_B= -21.58, specificity score CRISPRspec = 5.20 (medium specificity)
chr15:44284054-44284075:-	GGGCCTCGCCGCAGACACCTGC	AGG	XXXXXXXXXXW||W|W|||W_XXXXXXXXXXXXW||W|W|||W	M|MMM|WWMWW||W|W|||W_M|MMM|WWMWW||W|W|||W	-1.66	10	GOLM2

The table reports properties of the gRNAs used for editing and their top pOTs found by our CRISPRroots RNA-seq analysis pipeline. The first column reports the location of the pOTs in the variant-aware genome, which is a modified version of the reference genome in which variants (including indels) discovered in the non-edited cells are introduced. Positions are 1-based and include both ends. The coordinates include two nucleotides of PAM-distal context. The columns “off-target + context” and “PAM” report, respectively, the pOT sequence in 5’-3’ direction, including context, and the PAM. The column “binding struct (Q-T)” displays the most favorable, i.e. lowest free energy, potential binding pattern between the gRNA (query, Q) and the pOT site (target, T). The binding pattern is encoded as follows: X=Base not used (possible only placed at left-end); |, Base pair; W, wobble base pair; B, bulge. The binding pattern of the gRNA and of the pOT are separated by an underscore; in the absence of bulges, the pattens are identical except that the pOTs have two additional X on the left side, representing unbound context nucleotides. The pOTs and gRNA spacer are in many cases predicted to bind only partially from the PAM. Compared to the “binding struct (Q-T)” column, the column “full match-mismatch pattern” shows how the unbound nucleotides (X) would bind if the binding energy was disregarded and all nucleotides, excluding the unbound context, were used in the binding. ΔG_B represents the gRNA-target binding energy obtained as in the model described in (Alkan et al., 2018), in which ΔG_B = δ_PAM(ΔG_H − ΔG_O − ΔG_U), with ΔG_H the RNA-DNA hybridization energy, weighted using positional weights measuring Cas9 influence, ΔG_O the DNA-DNA binding energy, ΔG_U the spacer RNA self-folding energy (minimum free energy), and δ_PAM is a PAM correcting factor. The column “n. mismatch/unused” reports the number of nucleotides in the targets that represent a mismatch or that are not used to form the most favorable energetic binding. Last, the column “genes interested” summarizes the content of the CRISPRroots output column “genomic features” and shows the name of the genes downregulated for the expression-based pOTs or possibly affected by a somatic variant for the variant-based pOTs. For each gRNA, we report the on-target ΔG_B for comparison with the pOTs and the CRISPRspec gRNA specificity score from (Alkan et al., 2018), which evaluates the specificity of the gRNA to its on-target site while considering all the pOTs as alternative binding sites.