Skip to main content
NCBI home page
RSC Medicinal Chemistry logoLink to RSC Medicinal Chemistry
. 2024 Apr 23;15(6):2114–2126. doi: 10.1039/d4md00053f

Discovery of dibenzylbutane lignan LCA derivatives as potent anti-inflammatory agents†

Zhen Wang b,‡, Juan Zhang b,‡, Conghao Gai a, Jing Wang a, Xiaobin Zhuo a, Yan Song c, Yan Zou a, Peichao Zhang a, Guige Hou d, Qingguo Meng b,✉, Qingjie Zhao a,✉, Xiaoyun Chai a,✉
PMCID: PMC11187555  PMID: 38911165

Abstract

Inflammation is the body's response to defence against infection or injury, and is associated with the progression of many diseases, such as inflammatory bowel disease (IBD) and rheumatoid arthritis (RA). LCA, a dibenzylbutane lignan extracted from the roots of traditional medicinal plant Litsea cubeba (Lour.) Pers., has demonstrated promising anti-inflammatory activity. In this study, a series of novel LCA derivatives were designed, synthesized, and evaluated for anti-inflammatory activity. Lipopolysaccharide (LPS)-induced RAW 264.7 cell model experiments showed that compound 10h (at 20 μM of concentration) had the strongest inhibitory effect on NO release, and inhibited the secretion and gene expression levels of interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α in vitro. In addition, western blot, immunofluorescence, and molecular docking showed that the anti-inflammatory mechanism of compound 10h may be related to the nuclear factor (NF)-κB signalling pathway. In vivo studies based on a carrageenan-induced mouse paw edema model have shown significant anti-inflammatory activity of compound 10h at 20 mg kg−1. Preliminary in vitro and in vivo studies indicate that compound 10h has the potential to be developed as a novel anti-inflammatory agent.

Compound 10h, a novel dibenzylbutane lignan LCA derivative, has potential anti-inflammatory activity by inhibiting NF-κB activation.graphic file with name d4md00053f-ga.jpg

1. Introduction

Inflammation is a biological response of the immune system to harmful stimuli.1 Inflammation can be triggered by exogenous factors, such as pathogens, irritant chemicals, and other foreign molecules, or endogenous factors, such as tissue damage, cell death/necrosis, and impaired cellular metabolism.2 Inflammation can be categorized into acute and chronic inflammation. Acute inflammation is characterized by transient clinical symptoms, such as redness, swelling, heat, pain, and loss of function.3 Acute inflammation is usually protective and subsides spontaneously in a healthy state. In contrast, chronic inflammation lasts longer and leads to tissue damage or necrosis.4,5 Chronic inflammation is an important component of many prevalent diseases, such as obesity which has become a truly global problem, with an estimated 500 million adults worldwide obese and 1.5 billion people overweight or obese.6 The incidence of cancer and inflammatory bowel disease (IBD) is also gradually increasing and has become a global disease affecting more and more people.7,8 Rheumatoid arthritis (RA) is an autoimmune disease characterized by inflammation of the joints, affecting approximately 1% of the population in Europe and North America. There is growing evidence that inflammatory responses play an important role in the pathogenesis of these diseases.9

Non-steroidal anti-inflammatory drugs (NSAIDs) and glucocorticoids mitigate or limit the deleterious effects of inflammation.10 However, glucocorticoids have significant side effects and long-term use can lead to osteoporosis, diabetes, hypertension, cardiovascular disease, and drug resistance.11,12 NSAIDs can cause gastrointestinal, cardiovascular, hepatic, renal, cerebral, and pulmonary damage.13,14 Therefore, the search for effective anti-inflammatory drugs of natural origin with low toxicity is a hot research topic.

Natural products play an important role in drug discovery and are an important source of drug candidates. Natural products provide researchers with a continuous supply of lead compounds that form the basis of most early-stage drugs.15Litsea cubeba (Lour.) Pers, a traditional medicinal plant, contains alkaloids, flavonoids, lignans, and other bioactive compounds with a variety of pharmacological effects such as anticancer, antibacterial, and anti-inflammatory.16 Lin et al.17 demonstrated that Litsea cubeba root extract significantly ameliorated paw edema in arthritic rats induced by Freund's complete adjuvant. The root extract of Litsea cubeba also significantly reduced tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 levels in the serum of rats and down-regulated the levels of COX-2 and 5-LOX. A compound isolated from the root extract of Litsea cubeba (LCA; 9,9′-O-di-(E)-feruloyl-meso-5,5′-dimethoxysecoisolariciresinol) exhibited significant anti-inflammatory activity in lipopolysaccharide (LPS)-induced RAW 264.7 macrophages.18,19

In search of compounds with better anti-inflammatory activity, a series of novel derivatives were synthesized in this study by modifying the structure of LCA. We retained the intermediate backbone of LCA and replaced the unstable ester group in LCA with an inverted amide group. At the same time, we carried out a simplification of the structure by removing the methylene and double bonds attached to the ester bond and shortening the side chain. The target compounds 10a–10n were synthesized by the introduction of substituted benzylamines, and the target compounds 12a–12i were synthesised by the introduction of substituted pyridine methylamines (Fig. 1).

Fig. 1. Design of target compounds.

Fig. 1

Open in a new tab

Nuclear factor (NF)-κB is an important transcription factor, a trans-activator of inflammation-related genes, which plays a key role in controlling the inflammatory cascade response.20 When RAW 264.7 cells were subjected to LPS stimulation, the NF-κB pathway was activated to generate large amounts of inducible nitric oxide synthase (iNOS) to generate nitric oxide (NO) for immune response.21 NO is a neurotransmitter that mediates the activation and inhibition of inflammatory cascade responses.15 NO exhibits anti-inflammatory effects under normal physiological conditions. However, overproduction of NO during inflammatory responses causes tissue damage.16 Therefore, inhibition of NO production is a direct indicator of the anti-inflammatory activity of a compound. In addition, pro-inflammatory factors, such as TNF-α, IL-1β, and IL-6, are produced in large quantities during the activation of the NF-κB pathway. In this study, we used this model to evaluate the in vitro anti-inflammatory activity of target compounds. During NF-κB activation, IκB degradation releases the NF-κB p65 subunit from isolation, allowing it to translocate to the nucleus, bind to target promoters, and turn on the transcription of inflammatory genes.22 Western blot, immunofluorescence, and molecular docking revealed possible anti-inflammatory mechanisms of the target compounds.

The carrageenan-induced paw edema model is currently the most commonly used acute inflammation model to evaluate the activity of anti-inflammatory drugs. The inflammatory process of carrageenan-induced paw edema can be divided into two phases: in the early phase, the inflamed local tissue releases histamine, 5-hydroxytryptamine, bradykinin, and small amounts of prostaglandins, and in the later stages, neutrophil infiltration and high levels of prostaglandin production occur. Neutrophils release inflammatory factors, such as TNF-α, IL-1β, and IL-6.23 Therefore, in this study, we used indicators such as determination of paw thickness and inflammatory factors in mouse tissues to detect the pre- and post-progression of paw edema in mice to evaluate the in vivo anti-inflammatory activity of the target compound.

2. Results and discussion

2.1. Chemistry

The synthesis of the LCA derivatives is shown in Scheme 1. Sinapic acid (1) was esterified and reduced to produce intermediate 3.24,25 Intermediate 3 was reacted with benzyl bromide to produce intermediate 4.26 Intermediate 4 was hydrolyzed to produce intermediate 5.27 The chiral group, (S)-4-benzyl-2-azolidinone, was introduced into intermediate 5via acylation to obtain intermediate 6.28 Intermediate 6 was hydrogen-extracted using LDA and coupled to itself to give intermediate 7.29 Intermediate 7 was oxidized to remove the substituent, exposing two carboxyl groups, which were amidated with differently substituted benzylamines and methylaminopyridines to produce intermediates 9a–9n and 11a–11i.30,31 The final reduction to remove the benzyl-protecting group produced the target derivatives 10a–10n and 12a–12i.32 All derivatives were synthesized for the first time and structurally characterized using 1H NMR, 13C NMR and HRMS (ESI†).

Scheme 1. Synthesis of target compounds. Reagents and conditions: (a) sulfuric acid, MeOH, reflux, 5 h; (b) H2, Pd/C, MeOH, rt, 10 h; (c) benzyl bromide, K2CO3, acetone, reflux, 5 h; (d) NaOH, MeOH, reflux, 3 h; (e) (S)-4-benzyloxazolidin-2-one, N,N-dicyclohexylcarbodiimide, 4-dimethylaminopyridine, CH2Cl2, rt, 12 h. (f) Lithium diisopropylamide, iodobenzene diacetate, tetrahydrofuran, −78 °C, 2 h; (g) lithium hydroxide monohydrate, H2O2, tetrahydrofuran, H2O, 0 °C, 15 min, then rt, 12 h; (h) O-benzotriazole-N,N,N′,N′-tetramethyl-uronium-hexafluoro-phosphate, N,N-diisopropylethylamine, N,N-dimethylformamide, rt, 4 h; (i) H2, Pd/C, MeOH, rt, 3 h.

Scheme 1

Open in a new tab

2.2. Cytotoxicity assay

The cytotoxic effects of the synthesized derivatives on RAW 264.7 macrophages were determined using CCK-8 assays. As shown in Table 1, LCA and derivatives 10m, 12c, 12d, 12e, 12g, and 12i significantly reduced the cell viability of RAW 264.7 cells (p < 0.05). Most of the target derivatives were not significantly cytotoxic to RAW 264.7 macrophages at 20 μM. Thus, this concentration was used to investigate the anti-inflammatory activity of the derivatives.

Cytotoxicity evaluation (% survival at 20 μM concentration) of target compounds on RAW 264.7 macrophages.

Compd % Survivala Compd % Survivala
CON 100.0 ± 0.0 10k 97.8 ± 4.2
DEXb 94.8 ± 2.4 10l 99.1 ± 3.8
LCA 82.2 ± 4.0c 10m 70.0 ± 5.7c
10a 103.3 ± 3.4 10n 96.6 ± 1.5
10b 105.0 ± 2.0 12a 92.2 ± 1.7
10c 99.4 ± 4.1 12b 93.3 ± 9.2
10d 102.9 ± 1.5 12c 81.3 ± 5.7c
10e 95.6 ± 4.2 12d 85.1 ± 2.7c
10f 100.4 ± 1.7 12e 83.0 ± 6.8c
10g 99.9 ± 4.2 12f 95.9 ± 3.3
10h 99.1 ± 5.1 12g 69.5 ± 3.7c
10i 97.5 ± 2.9 12h 90.7 ± 4.0
10j 98.4 ± 4.6 12i 69.9 ± 3.4c
Open in a new tab
a

Survival rate values are calculated from the average of three experiments (mean ± SD).

b

Dexamethasone.

c

p < 0.05 compared to CON.

2.3. Inhibition of the target compounds on NO release in vitro and structure–activity studies

NO is an enzymatic product of nitric oxide synthase.33 iNOS produces large amounts of NO in LPS, cytokine and other agent induced macrophages. Excessive NO can trigger inflammatory signalling and cytotoxicity through reactive nitrogen species-induced oxidative stress. In most inflammatory and autoimmune injuries, large numbers of activated macrophages and neutrophils secrete large amounts of NO, leading to damage in the surrounding tissues.21,34

The effects of the LCA derivatives on LPS-induced NO release from RAW 264.7 cells were determined. Dexamethasone served as a positive control. All the derivatives inhibited NO release from LPS-induced RAW 264.7 macrophages at a concentration of 20 μM (Table 2). It also shows that compound 10h exhibited the strongest inhibitory effects on NO release in RAW 264.7 cells.

Effects of compounds 10a–10n and 12a–12i on LPS-induced NO release in RAW 264.7 macrophages.

Compd NO%a Compd NO%a
CON 11.5 ± 1.2 10k 43.9 ± 1.7d
LPS 100.0 ± 0.0c 10l 49.3 ± 1.2d
DEXb 45.9 ± 3.5d 10m 63.1 ± 6.8d,e
LCA 29.5 ± 0.6d,e 10n 49.0 ± 3.1d
10a 42.6 ± 7.4d 12a 48.1 ± 4.9d
10b 47.3 ± 1.3d 12b 44.7 ± 5.7d
10c 41.9 ± 0.9d 12c 47.1 ± 4.0d
10d 43.1 ± 0.9d 12d 66.3 ± 9.9d,e
10e 47.0 ± 2.8d 12e 71.5 ± 3.1d,e
10f 44.2 ± 1.3d 12f 67.9 ± 8.1d,e
10g 45.9 ± 1.5d 12g 46.5 ± 6.4d
10h 31.1 ± 0.7d,e 12h 55.1 ± 11.1d
10i 46.5 ± 1.7d 12i 51.1 ± 10.0d
10j 47.6 ± 2.3d
Open in a new tab
a

Relative amount of NO (compared to LPS%), the NO concentration values are calculated from the average of three experiments (mean ± SD).

b

Dexamethasone.

c

p < 0.05 compared to CON.

d

p < 0.05 compared to LPS.

e

p < 0.05 compared to DEX.

The degree of inhibitory effects on NO release differed among the derivatives, indicating that the introduction of different substitutions affected the anti-inflammatory activity of the target derivatives. Derivative 10a with the benzylamine R group and derivatives 10c and 10f with the substituted benzylamine (3-F, 3-OCH3) R groups inhibited NO release more than the other derivatives. The derivative with the highest inhibitory effect on LPS-induced NO release was compound 10h, which had a strong electron-withdrawing group (CF3) at the 4-position of the benzene ring. Compound 10k also showed excellent NO inhibitory activity, with the electron-withdrawing group F at both the 3-position and 5-position of the benzene ring. Compared with derivatives of class 10, class 12 derivatives exhibited lower NO inhibitory effects. Thus, the activities of derivatives with a benzylamine group as the R group were superior to the derivatives with pyridine methylamine groups.

The dose responses for compound 10h and LCA against LPS-induced NO release from RAW 264.7 macrophages were assessed. Both compound 10h and the positive control LCA inhibited NO release in a dose-dependent manner (Fig. 2).

Fig. 2. Compound 10h Inhibited LPS-induced NO production in RAW 264.7 macrophages. ns = not significant. (****p < 0.0001 compared to LPS; ####p < 0.0001 compared to CON).

Fig. 2

Open in a new tab

2.4. Compound 10h suppressed the production of pro-inflammatory mediators in LPS-induced RAW 264.7 cells

Cytokines are key regulators of inflammation and play different roles in the development and resolution of inflammation. Up-regulation of pro-inflammatory cytokines, such as IL-1β, IL-6, and TNF-α, occurs in many chronic inflammatory conditions.35,36

A previous study found that LCA inhibited LPS-induced TNF-α release in RAW 264.7 cells.18 As compound 10h inhibited NO release the most, we further assessed the dose-dependent inhibitory effects of compound 10h and LCA on LPS-induced secretion of IL-1β, IL-6, and TNF-α. We pretreated RAW 264.7 cells with 2.5, 5, 10, or 20 μM LCA or compound 10h for 1 h, then treated the cells with LPS (1 μg mL−1) for 24 h before measuring IL-6, IL-1β, and TNF-α in the media. Compound 10h inhibited LPS-stimulated IL-1β, IL-6, and TNF-α secretion to a degree no less than that of LCA, highlighting the potent anti-inflammatory activity of compound 10h (Fig. 3). The inhibition effect of 20 μM compound 10h on LPS-induced IL-1β release was significantly stronger than that of LCA at this concentration.

Fig. 3. The dose-dependent inhibition of LPS-induced IL-1β, IL-6, and TNF-α secretion by RAW 264.7 macrophages after treatment with compound 10h. The levels of IL-1β (A), IL-6 (B), and TNF-α (C) were determined by ELISA. (**p < 0.01, ***p < 0.001, ****p < 0.0001 compared to LPS; ####p < 0.0001 compared to CON).

Fig. 3

Open in a new tab

2.5. Compound 10h inhibits LPS-induced pro-inflammatory gene expression

To confirm the anti-inflammatory effects of compound 10h, we measured the effects of compound 10h and LCA on IL-1β, IL-6, and TNF-α mRNA levels in RAW 264.7 cells. As shown in Fig. 4, LPS stimulation increased IL-1β, IL-6, and TNF-α mRNA levels, and compound 10h attenuated LPS-induced upregulation of cytokine mRNA levels in a dose-dependent manner. Similarly, Yu37 found that other LCA derivatives also exerted anti-inflammatory effects by decreasing the mRNA expression of the inflammatory factors IL-1β, IL-6, and TNF-α.

Fig. 4. Compound 10h and LCA attenuated the up-regulation of IL-1β (A), IL-6 (B), and TNF-α (C) mRNA levels induced by LPS in RAW264.7 cells. The mRNA levels were assessed by quantitative RT-qPCR. (*p < 0.1, **p < 0.01, ***p < 0.001, ****p < 0.0001 compared to LPS; ####p < 0.0001 compared to CON).

Fig. 4

Open in a new tab

2.6. Compound 10h inhibits LPS-induced NF-κB activation in RAW 264.7 cells

NF-κB consists of two subunits, p50 and p65, and is usually inactivated by binding to IκB. When cells are exposed to stimulatory signals, IκB is phosphorylated and degraded, releasing the NF-κB complex to move to the nucleus. In the nucleus, NF-κB binds specific sequences in the promoter or enhancer regions of genes to drive transcription of pro-inflammatory mediator genes, such as TNF-α, IL-1β, and IL-6.38,39 Lin et al.18 found that LCA significantly inhibited the phosphorylation of IκBα and had no significant effect on the phosphorylation of p38 and Akt.

To determine the inhibitory effects of compound 10h on NF-κB signalling, NF-κB p65 and IκBα levels were measured by western blot analysis. Cells were pretreated with compound 10h (10 and 20 μM) or LCA (20 μM) for 1 h. Then, cells were stimulated with LPS for 1 h. As shown in Fig. 5A–D, LPS stimulation significantly increased p65 phosphorylation and IκBα degradation. Compound 10h prevented LPS-induced IκBα degradation and p65 phosphorylation in a concentration-dependent manner. Nuclear translocation of NF-κB p65 in LPS-stimulated RAW 264.7 cells was examined by immunofluorescence. As shown in Fig. 5E, compound 10h significantly inhibited the nuclear translocation of NF-κB p65 from the cytoplasm to the nucleus. These results indicate that the anti-inflammatory effects of compound 10h may be mediated by inhibition of NF-κB signaling via suppression of p65 phosphorylation, IκBα degradation, and NF-κB p65 nuclear translocation.

Fig. 5. Compound 10h attenuated the activation of LPS-induced NF-κB signalling in RAW 264.7 cells. (A and C) Inhibition of p65 phosphorylation and IκBα degradation. (B and D) Relative expression of p-p65/p65 and IκBα. (E) Translocation of NF-κB p65. The distribution of NF-κB p65 in the nucleus and cytoplasm was measured by immunofluorescent staining and colocalization with DAPI nuclear staining (p65, red, Cy3-conjugated secondary antibody; DAPI, blue). (ns = not significant; *p < 0.1, **p < 0.01, ***p < 0.001 compared to LPS).

Fig. 5

Open in a new tab

2.7. Molecular docking of compound 10h with IκBα/NF-κB complex

Previous studies have shown that LCA and derivatives exhibit strong anti-inflammatory activity by inhibiting NF-κB activation through inhibiting phosphorylation of IκBα, IKKαβ, and p65.18,37 And our western blot and immunofluorescence studies suggest that the anti-inflammatory activity of compound 10h may be achieved by regulating p65 and IκBα in the NF-κB signalling pathway.

To be better understand the binding pattern of compound 10h to the target enzyme, we used Molecular Operating Environment MOE (version 2019.01) to dock compound 10h to the active site of IκBα/NF-κB (PDB ID: 1IKN). The best orientation of compound 10h within the active binding site of IκBα/NF-κB was selected according to the scoring functions along with binding interactions formed with the surrounding amino acids, and the relative orientation of the docked compounds compared to the co-crystallized ligand.

The 3D structure of target protein complex IκBα/NF-κB comprises the NF-κB p65 subunit, the NF-κB p50 subunit and the IκBα subunit.40 As shown in Fig. 6, docking analysis of 10h with the IκBα/NF-κB complex demonstrated that compound 10h inserts squarely into the cavity formed by the NF-κB p65 subunit and the IκBα subunit. In particular, the trifluoromethylbenzyl side chain of 10h is placed in a hydrophobic pocket, thereby forming extensive interactions with the surrounding residues Leu227, Arg253, Ile192, and His184. In contrast, the dimethoxybenzyl portion is placed in a hydrophilic pocket formed by Asn182, Asn180, and Asn145. Among them, the fluorine atoms in the trifluoromethyl side chains on both sides of 10h form halogen effects with the nitrogen atom of His184 in the IκBα protein and the oxygen atom of Gly209 in the p65 protein, respectively. In addition, the oxygen atoms in the two methoxy groups of the benzene ring form hydrogen bonds with Asn145 and Asn182 of the IκBα protein, respectively. This docking pattern through multiple hydrogen bonds as well as halogen bonds suggests that compound 10h binds well to the IκBα/NF-κB protein complex.

Fig. 6. Docking structures of compound 10h and IκBα/NF-κB binding (PDB ID: 1IKN). Conformation of compound 10h docking with IκBα/NF-κB and interactions with surrounding amino acids.

Fig. 6

Open in a new tab

2.8. Compound 10h inhibited carrageenan-induced mouse paw edema

Previous studies have shown that LCA significantly inhibited xylene-induced ear edema in mice. In addition, LCA inhibited granulation tissue proliferation in rats with cotton ball-induced granuloma and alleviated joint swelling in rats with adjuvant-induced arthritis.41 Based on the strong in vitro anti-inflammatory activity of compound 10h, the anti-inflammatory effects of this derivative were investigated in a carrageenan-induced mouse paw edema model.

As shown in Fig. 7A, mouse paw edema peaked at 15 min after carrageenan injection. Compound 10h at 5 and 20 mg kg−1 and LCA at 20 mg kg−1 significantly reduced the thickness of carrageenan-induced mouse paw edema at 60 min, whereas at 120 and 240 min, the thickness of the paw edema in the experimental mice stabilized. The carrageenan-induced mouse paw edema model showed significant increase in the secretion of inflammatory cytokines IL-1β, IL-6, and TNF-α in paw tissues, whereas compound 10h decreased IL-1β, IL-6, and TNF-α levels in a dos e-dependent manner (Fig. 7B–D). At the same 20 mg kg−1 concentration, compound 10h inhibited the release of IL-1β and TNF-α more than LCA. Fig. 8 shows representative pictures of paw edema in mice at different times during the in vivo experiments. The inhibitory effect of compound 10h on paw swelling in mice is evident. In conclusion, compound 10h showed significant in vivo anti-inflammatory activity in carrageenan-induced paw edema in mice.

Fig. 7. The anti-inflammatory activity of compound 10h on carrageenan-induced paw edema in mice. (A) Effect of compound 10h on the thickness of paw edema induced by carrageenan. (B–D) IL-1β, IL-6, and TNF-α expression levels in paw tissue were measured by ELISA. (**p < 0.01, ***p < 0.001, ****p < 0.0001 compared to Carr.; ####p < 0.0001 compared to CON).

Fig. 7

Open in a new tab

Fig. 8. Compound 10h inhibited carrageenan-induced mouse paw edema in ICR mice. Representative pictures of mouse paws 15 min after injection of carrageenan in the control group (A) and in mice treated with 5 mg kg−110h (B), 20 mg kg−110h (C), and 20 mg kg−1 LCA (D) for 120 min after the injection of carrageenan.

Fig. 8

Open in a new tab

3. Conclusions

In summary, based on the structural modification of the precursor LCA, we designed, synthesized, and evaluated the anti-inflammatory effects of a series of LCA derivatives. All LCA derivatives inhibited NO release at 20 μM, and compound 10h exhibited the best inhibitory effects. Further studies confirmed that compound 10h exhibited significant dose-dependent inhibitory activity against LPS-induced expression and secretion of the pro-inflammatory cytokines IL-1β, IL-6, and TNF-α in RAW 264.7 cells. In addition, western blot and immunofluorescence assays showed that compound 10h exerted anti-inflammatory effects by inhibiting NF-κB activation through suppression of IκBα degradation, p65 phosphorylation, and nuclear translocation of NF-κB p65. Molecular docking further showed that compound 10h targets the IκBα/NF-κB structural domain through interaction with amino acid residues. In addition, in vivo studies showed that compound 10h significantly inhibited carrageenan-induced paw edema and the levels of proinflammatory cytokines in paw tissues in mice. In conclusion, compound 10h exhibits anti-inflammatory effects and is a lead candidate for a novel anti-inflammatory agent.

4. Experimental

4.1. Chemistry

General chemicals, supplied by Shanghai Titan Technology Co. Ltd., were commercially available in analytical purity and were not further purified. The melting points were measured with an SGW® X-4A microscopic melting point apparatus. The 1H nuclear magnetic resonance (NMR) and 13C NMR spectra data were determined using a Bruker AC-600P spectrometer (600 MHz for 1H, 151 MHz for 13C). High-resolution mass spectra (HRMS) were measured using an Agilent Technologies 6538 UHD accurate-Mass Q-TOF MS spectrometer with electrospray ionization.

4.1.1. General procedure for the synthesis of intermediates 2–8

Methyl (E)-3-(4-hydroxy-3,5-dimethoxyphenyl)acrylate (2)

Sulfuric acid (98% v/v, 5 mL) was added to methanol (500 mL) solution of raw material 1 (25.0 g, 111.6 mmol) and refluxed for 5 h. After completion of reaction as monitored by TLC, the solvent was removed in vacuo, ethyl acetate was added, and the precipitate was washed with saturated NaHCO3 solution, dried over Na2SO4, and concentrated in vacuo. The residue was purified by recrystallization from ethanol and water to afford the desired compound 2 (25.6 g, 96%). 1H NMR (600 MHz, CDCl3) δ 7.59 (d, J = 16.2 Hz, 1H), 6.75 (s, 2H), 6.29 (d, J = 16.2 Hz, 1H), 3.90 (s, 6H), 3.79 (s, 3H); 13C NMR (151 MHz, CDCl3) δ 167.57, 147.21, 145.12, 137.17, 125.85, 115.51, 105.06, 56.32, 51.61.

Methyl 3-(4-hydroxy-3,5-dimethoxyphenyl)propanoate (3)

To the methanol solution (500 mL) of compound 2 (25.6 g, 107.6 mmol) was added 10% palladium carbon (1.5 g) and the reaction was carried out in the presence of hydrogen for 10 h at room temperature. After the reaction was complete (monitored by TLC), the palladium carbon was filtered and the solvent was evaporated in vacuo to afford compound 3 (24.0 g, 93%). 1H NMR (600 MHz, CDCl3) δ 6.39 (s, 2H), 3.83 (s, 6H), 3.64 (s, 3H), 2.85 (t, J = 7.8 Hz, 2H), 2.58 (t, J = 7.8 Hz, 2H); 13C NMR (151 MHz, CDCl3) δ 173.40, 147.03, 133.20, 131.58, 104.96, 58.29, 56.23, 51.59, 36.11, 31.14, 18.31.

Methyl 3-(4-(benzyloxy)-3,5-dimethoxyphenyl)propanoate (4)

To the solution of compound 3 (24.0 g, 100.0 mmol) in acetone (500 mL) was added benzyl bromide (25.6 g, 150.0 mmol) and K2CO3 (27.6 g, 200.0 mmol), and the reaction was carried out at reflux for 5 h. After completion of reaction as monitored by TLC, the solid was filtered and concentrated in vacuo. The residue was purified by silica gel column chromatography to afford compound 4 (30.0 g, 91%) as a white solid. 1H NMR (600 MHz, CDCl3) δ 7.49 (d, J = 7.2 Hz, 2H), 7.34 (t, J = 7.2 Hz, 2H), 7.29 (t, J = 7.2 Hz, 1H), 6.41 (s, 2H), 4.98 (s, 2H), 3.81 (s, 6H), 3.68 (s, 3H), 2.90 (t, J = 7.8 Hz, 2H), 2.63 (t, J = 8.4 Hz, 2H); 13C NMR (151 MHz, CDCl3) δ 173.31, 153.47, 137.98, 136.37, 135.46, 128.43, 128.11, 127.74, 105.36, 75.03, 56.10, 51.64, 35.87, 31.38; HRMS (ESI): calcd. for C19H22O5, [M + H]+: 331.1540, found: 331.1525.

3-(4-(Benzyloxy)-3,5-dimethoxyphenyl)propanoic acid (5)

To the solution of compound 4 (30.0 g, 90.9 mmol) in methanol (500 mL) was added NaOH solution (5.5 mol L−1, 50 mL) and refluxed for 3 h. After completion of reaction as monitored by TLC, concentrated hydrochloric acid was added dropwise to adjust the pH of the reaction solution to 3–4. The solution was extracted with CH2Cl2, and the organic phase was dried over Na2SO4. After being filtered, the solvent was removed in vacuo. The residue was purified by silica gel column chromatography to afford white solid compound 5 (25.5 g, 89%). 1H NMR (600 MHz, CDCl3) δ 7.49 (d, J = 7.8 Hz, 2H), 7.35 (t, J = 7.8 Hz, 2H), 7.29 (t, J = 7.2 Hz, 1H), 6.43 (s, 2H), 4.99 (s, 2H), 3.81 (s, 6H), 2.91 (t, J = 7.8 Hz, 2H), 2.69 (t, J = 7.8 Hz, 2H); 13C NMR (151 MHz, CDCl3) δ 178.91, 153.52, 137.94, 136.01, 135.55, 128.46, 128.13, 127.78, 105.40, 75.06, 56.13, 35.76, 31.03; HRMS (ESI): calcd. for C18H20O5, [M + H]+: 317.1384, found: 317.1375.

(S)-4-Benzyl-3-(3-(4-(benzyloxy)-3,5-dimethoxyphenyl)propanoyl)-oxazolidine-2-one (6)

Compound 5 (25.2 g, 79.7 mmol), (S)-4-benzyl-2-azolidinone (15.6 g, 87.8 mmol), 4-dimethylaminopyridine (1.0 g, 7.97 mmol), and anhydrous CH2Cl2 (150 mL) were added to the reaction vial. Anhydrous CH2Cl2 solution (150 mL) of N,N-dicyclohexylcarbodiimide (16.4 g, 79.7 mmol) was added in an ice bath under argon protection, and after addition the reaction was slowly warmed up to room temperature for 12 h until the reaction was complete (monitored by TLC). The solution was extracted with CH2Cl2, and the organic phase was dried over Na2SO4. After being filtered, the solvent was removed in vacuo. The residue was purified by silica gel column chromatography to afford compound 6 (24.2 g, 64%) as a white solid. 1H NMR (600 MHz, CDCl3) δ 7.50–7.48 (m, 2H), 7.35–7.28 (m, 6H), 7.18–7.17 (m, 2H), 6.49 (s, 2H), 4.97 (s, 2H), 4.69–4.65 (m, 1H), 4.20–4.15 (m, 2H), 3.82 (s, 6H), 3.35–3.21 (m, 3H), 3.02–2.92 (m, 2H), 2.76 (dd, J = 13.2, 9.6 Hz, 1H); 13C NMR (151 MHz, CDCl3) δ 172.41, 153.43, 137.97, 136.26, 135.11, 129.40, 128.97, 128.45, 128.11, 127.74, 127.40, 105.67, 75.07, 66.21, 56.14, 55.14, 37.84, 37.18, 30.84. HRMS (ESI): calcd. for C28H29NO6, [M + H]+: 476.2068, found: 476.2077.

(2R,3S)-1,4-Bis((S)-4-benzyl-2-oxooxazolidin-3-yl)-2,3-bis(4-(benzyloxy)-3,5-dimethoxybenzyl)butane-1,4-dione (7)

Anhydrous tetrahydrofuran (500 mL) solution of compound 6 (24.2 g, 50.9 mmol) was cooled to −78 °C, lithium diisopropylamide (2.0 M, 50.9 mL, 101.8 mmol) was added, and the reaction was continued for 1 h. After 1 h, iodobenzene diacetic acid (32.8 g, 101.8 mmol) was added dropwise to the reaction solution, and the reaction was continued at −78 °C for 1 h until the reaction was complete (monitored by TLC). The reaction was then quenched with hydrochloric acid (1 M), and diluted with ethyl acetate. The organic layer was washed with dilute hydrochloric acid, 10% sodium thiosulfate solution, and saturated NaHCO3 solution, then dried over Na2SO4. After being filtered, the solvent was removed in vacuo. The residue was purified by silica gel column chromatography to afford white solid compound 7 (15.2 g, 31%). 1H NMR (600 MHz, DMSO-d6) δ 7.43 (d, J = 7.2 Hz, 2H), 7.33 (t, J = 7.2 Hz, 4H), 7.29–7.20 (m, 12H), 6.54 (s, 4H), 4.84 (s, 4H), 4.68–4.63 (m, 2H), 4.41–4.39 (m, 2H), 4.05–4.04 (m, 2H), 3.84 (t, J = 8.4 Hz, 2H), 3.76 (s, 12H), 3.14 (dd, J = 13.2, 3.6 Hz, 2H), 2.89–2.80 (m, 6H); 13C NMR (151 MHz, DMSO-d6) δ 175.67, 153.08, 152.87, 138.35, 135.70, 135.47, 133.72, 130.02, 128.89, 128.50, 128.31, 128.08, 127.33, 107.15, 74.37, 65.93, 56.32, 55.32, 45.91, 37.11, 36.80.

(2R,3S)-2,3-Bis(4-(benzyloxy)-3,5-dimethoxybenzyl)succinic acid (8)

Lithium hydroxide monohydrate (588 mL, 14.0 mmol) and 30% hydrogen peroxide solution (43.6 mL, 35 mmol) were added to a mixed solution of tetrahydrofuran (33 mL) and H2O (20 mL) of compound 7 (3.0 g, 3.2 mmol) at a temperature of 0 °C. After 15 min, the reaction solution was warmed up slowly to room temperature, and stirring was continued overnight. After the reaction was complete (monitored by TLC), the pH of the solution was adjusted to 3 with 10% hydrochloric acid, diluted with CH2Cl2, the organic layer was dried over Na2SO4. After being filtered, the solvent was removed in vacuo. The residue was purified by silica gel column chromatography to afford white solid compound 8 (1.6 g, 79%). 1H NMR (600 MHz, DMSO-d6) δ 7.44 (dd, J = 7.2 Hz, 4H), 7.37–7.34 (m, 4H), 7.31–7.29 (m, 2H), 6.46 (s, 4H), 4.85 (s, 4H), 3.72 (s, 12H), 2.95–2.89 (m, 4H), 2.81–2.77 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 175.07, 153.18, 138.51, 135.53, 135.31, 128.54, 128.26, 128.07, 106.64, 74.41, 56.26, 48.17, 36.07; HRMS (ESI): calcd. for C36H38O10, [M + H]+: 631.2538, found: 631.2540.

4.1.2. General procedure for the synthesis of target compounds 10a–10n and 12a–12i

Compound 8 (100 mg, 0.16 mmol), benzylamine (51.4 mg, 0.48 mmol), O-benzotriazole-N,N,N′,N′-tetramethyl-uronium-hexafluoro-phosphate (147.9 mg, 0.39 mmol), N,N-diisopropylethylamine (166.72 mg, 1.29 mmol) and N,N-dimethylformamide (2 mL) mixed solution was stirred under argon at room temperature for 4 h until the reaction was complete (monitored by TLC). The organic compound was extracted with CH2Cl2, washed with water and saturated brine in turn, dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel column chromatography to afford intermediate 9a (98 mg, 76%).

To the solution of intermediate 9a (98 mg, 0.12 mmol) in methanol (10 mL) was added 10% palladium carbon (10 mg) and the reaction was carried out in the presence of hydrogen for 3 h at room temperature. After the reaction was complete (monitored by TLC), the palladium carbon was filtered, the solvent was removed in vacuo, and the residue was purified by medium pressure liquid chromatography to afford white solid compound 10a (58.1 mg, 77%).

The general procedure for the synthesis of intermediates 9b–9n and 11a–11i is the same as intermediate 9a, and the general procedure for the synthesis of target products 10b–10n and 12a–12i is the same as compound 10a.

(2R,3S)-N1,N4-dibenzyl-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)-succinamide (10a)

Yield: 77%; white solid; m.p. 224.0–226.2 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.17 (t, J = 6.0 Hz, 2H), 8.05 (s, 2H), 7.19–7.14 (m, 6H), 6.94 (d, J = 7.2 Hz, 4H), 6.41 (s, 4H), 4.22–4.18 (m, 2H), 4.09–4.05 (m, 2H), 3.67 (s, 12H), 2.95 (dd, J = 13.2, 0.6 Hz, 2H), 2.88–2.84 (m, 2H), 2.79–2.75 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.28, 148.17, 139.85, 134.31, 130.12, 128.41, 127.22, 126.80, 106.89, 56.32, 50.63, 42.27, 35.82; HRMS (ESI): calcd. for C36H40N2O8, [M + H]+: 629.2858, found: 629.2859.

(2R,3S)-N1,N4-Bis(2-fluorobenzyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (10b)

Yield: 78%; white solid; m.p. 221.9–222.8 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.18 (t, J = 6.0 Hz, 2H), 7.22–7.19 (m, 2H), 7.09–7.05 (m, 2H), 6.94–6.92 (m, 2H), 6.70–6.667 (m, 2H), 6.41 (s, 4H), 4.22–4.18 (m, 2H), 4.08–4.04 (m, 2H), 3.68 (s, 12H), 2.97 (dd, J = 13.8, 2.4 Hz, 2H), 2.89–2.87 (m, 2H), 2.76–2.72 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.51, 160.94, 159.33, 148.20, 134.34, 129.96, 129.28, 128.76, 128.71, 126.48, 126.38, 124.41, 115.07, 114.93, 106.90, 56.31, 50.59, 35.93; HRMS (ESI): calcd. For C36H38F2N2O8, [M + H]+: 665.2669, found: 665.2674.

(2R,3S)-N1,N4-bis(3-fluorobenzyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (10c)

Yield: 76%; white solid; m.p. 221.2–223.1 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.46 (t, J = 6.0 Hz, 2H), 7.20–7.16 (m, 2H), 6.99–6.95 (m, 2H), 6.89–6.87 (m, 2H), 6.60 (d, J = 7.8 Hz, 2H), 6.30 (s, 4H), 4.32–4.28 (m, 2H), 4.14–4.10 (m, 2H), 3.67 (s, 12H), 2.83–2.81 (m, 2H), 2.71–2.67 (m, 2H), 2.52–2.51 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.39, 163.31, 161.69, 148.18, 142.81, 142.76, 134.47, 130.41, 130.36, 129.65, 123.14, 114.12, 113.97, 113.76, 113.62, 106.61, 56.32, 51.30, 41.91, 37.28; HRMS (ESI): calcd. for C36H38F2N2O8, [M + H]+: 665.2669, found: 665.2656.

(2R,3S)-N1,N4-Bis(4-fluorobenzyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (10d)

Yield: 75%; white solid; m.p. 218.1–220.0 °C; 1H NMR (600 MHz, MeOD) δ 6.90 (t, J = 9.0 Hz, 4H), 6.80–6.78 (m, 4H), 6.49 (s, 4H), 4.29–4.27 (m, 2H), 3.92–3.90 (m, 2H), 3.77 (s, 12H), 3.12 (dd, J = 12.6, 2.4 Hz, 2H), 2.86–2.83 (m, 2H), 2.80–2.76 (m, 2H); 13C NMR (151 MHz, MeOD) δ 172.64, 161.17, 146.32, 132.65, 132.43, 128.09, 126.97, 126.92, 113.08, 112.94, 104.76, 53.82, 50.29, 40.07, 34.62; HRMS (ESI): calcd. for C36H38F2N2O8, [M + H]+: 665.2669, found: 665.2687.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(4-methylbenzyl)succinamide (10e)

Yield: 75%; white solid; m.p. 215.4–217.2 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.32 (t, J = 6.0 Hz, 2H), 8.08 (s, 2H), 6.97 (d, J = 7.8 Hz, 4H), 6.76 (d, J = 7.8 Hz, 4H), 6.30 (s, 4H), 4.28–4.25 (m, 2H), 4.04–4.01 (m, 2H), 3.67 (s, 12H), 2.81–2.78 (m, 2H), 2.69–2.65 (m, 2H), 2.53–2.51 (m, 2H), 2.22 (s, 6H); 13C NMR (151 MHz, DMSO-d6) δ 173.19, 148.17, 136.66, 135.82, 134.42, 129.82, 129.02, 127.22, 106.70, 56.32, 51.36, 42.05, 37.33, 21.12; HRMS (ESI): calcd. for C38H44N2O8, [M + H]+: 657.3171, found: 657.3170.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(3-methoxybenzyl)succinamide (10f)

Yield: 78%; white solid; m.p. 212.3–214.7 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.40 (t, J = 6.0 Hz, 2H), 8.07 (s, 2H), 7.09–7.06 (m, 2H), 6.72–6.71 (m, 4H), 6.41 (d, J = 7.8 Hz, 2H), 6.29 (s, 4H), 6.17 (d, J = 6.0 Hz, 4H), 3.67 (s, 12H), 3.65 (s, 6H), 2.82–2.80 (m, 2H), 2.72–2.68 (m, 2H), 2.53–2.51 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.33, 159.58, 148.14, 141.38, 134.35, 129.81, 129.59, 119.53, 112.83, 112.69, 106.56, 56.30, 55.30, 51.30, 42.40, 37.30; HRMS (ESI): calcd. for C38H44N2O10, [M + H]+: 689.3069, found: 689.3084.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(4-methoxybenzyl)succinamide (10g)

Yield: 77%; white solid; m.p. 210.9–212.6 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.11 (t, J = 6.0 Hz, 2H), 6.86–6.84 (m, 4H), 6.75–6.72 (m, 4H), 6.39 (s, 4H), 4.14–4.10 (m, 2H), 4.01–3.98 (m, 2H), 3.69 (s, 6H), 3.67 (s, 12H), 2.91 (dd, J = 12.6, 1.2 Hz, 2H), 2.83–2.80 (m, 2H), 2.78–2.74 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.13, 158.38, 148.14, 134.27, 131.77, 130.17, 128.49, 113.83, 106.84, 56.29, 55.44, 50.61, 41.71, 35.68; HRMS (ESI): calcd. for C38H44N2O10, [M + H]+: 689.3069, found: 689.3063.

(2R,3S)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(4-(trifluoromethyl)benzyl)succinamide (10h)

Yield: 74%; white solid; m.p. 240.5–241.2 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.27 (t, J = 6.0 Hz, 2H), 8.13 (s, 2H), 7.48 (d, J = 12.0 Hz, 4H), 7.05 (d, J = 6.0 Hz, 4H), 6.43 (s, 4H), 4.25–4.21 (m, 2H), 4.13–4.09 (m, 2H), 3.68 (s, 12H), 3.02 (d, J = 12.0 Hz, 2H), 2.89–2.87 (m, 2H), 2.75–2.71 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.51, 148.20, 144.86, 134.39, 129.89, 127.69, 125.10, 107.00, 56.31, 50.68, 41.85, 36.35; 19F NMR (376 MHz, DMSO-d6) δ −60.76; HRMS (ESI): calcd. for C38H38F6N2O8, [M + H]+: 765.2606, found: 765.2614.

(2R,3S)-N1,N4-Bis(2,4-difluorobenzyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (10i)

Yield: 76%; white solid; m.p. 224.6–225.9 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.17 (t, J = 6.0 Hz, 2H), 8.11 (s, 2H), 7.11–7.07 (m, 2H), 6.75–6.72 (m, 2H), 6.63–6.59 (m, 2H), 6.40 (s, 4H), 4.13–4.10 (m, 2H), 3.99–3.95 (m, 2H), 3.68 (s, 12H), 2.98 (dd, J = 12.6, 1.8 Hz, 2H), 2.86–2.85 (m, 2H), 2.72–2.68 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.46, 160.79, 160.70, 160.62, 159.15, 148.20, 134.33, 130.29, 129.88, 122.84, 122.74, 111.17, 111.02, 106.93, 103.75, 103.58, 103.41, 56.30, 50.62, 36.14, 35.41; HRMS (ESI): calcd. for C36H36F4N2O8, [M + H]+: 701.2481, found: 701.2482.

(2R,3S)-N1,N4-Bis(2,4-dimethoxybenzyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (10j)

Yield: 79%; white solid; m.p. 183.1–185.2 °C; 1H NMR (600 MHz, DMSO-d6) δ 7.97 (t, J = 6.6 Hz, 2H), 6.52 (d, J = 8.4 Hz, 2H), 6.46 (d, J = 2.4 Hz, 2H), 6.39 (s, 4H), 6.27 (dd, J = 8.4, 2.4 Hz, 2H), 4.11–4.07 (m, 2H), 3.97–3.94 (m, 2H), 3.73 (s, 6H), 3.71 (s, 6H), 3.68 (s, 12H), 2.91 (dd, J = 13.2, 1.8 Hz, 2H), 2.88–2.83 (m, 2H), 2.77–2.73 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.31, 159.72, 157.62, 148.15, 134.29, 130.20, 128.41, 119.41, 106.88, 104.54, 98.27, 56.30, 55.71, 55.54, 50.66, 37.07, 35.67; HRMS (ESI): calcd. for C40H48N2O12, [M + H]+: 749.3281, found: 749.3290.

(2R,3S)-N1,N4-Bis(3,5-difluorobenzyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (10k)

Yield: 77%; white solid; m.p. 189.6–191.1 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.54 (t, J = 6.6 Hz, 2H), 8.04 (s, 2H), 7.03–6.99 (m, 2H), 6.75–6.71 (m, 4H), 6.27 (s, 4H), 4.21 (d, J = 5.4 Hz, 4H), 3.66 (s, 12H), 2.82–2.78 (m, 2H), 2.72–2.68 (m, 2H), 2.47 (dd, J = 13.2, 1.8 Hz, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.59, 163.54, 163.45, 161.91, 161.82, 148.09, 144.69, 134.49, 129.45, 110.47, 110.30, 106.38, 102.60, 102.43, 56.26, 51.16, 41.84, 37.13. HRMS (ESI): calcd. for C36H36N2O8, [M + H]+: 701.2481, found: 701.2495.

(2R,3S)-N1,N4-Bis(3,5-dimethoxybenzyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (10l)

Yield: 74%; white solid; m.p. 187.3–188.2 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.20 (t, J = 6.6 Hz, 2H), 8.00 (s, 2H), 6.37–3.65 (m, 8H), 6.29 (t, J = 2.4 Hz, 2H), 4.23–4.19 (m, 2H), 4.02–3.98 (m, 2H), 3.666 (s, 12H), 3.64 (s, 12H), 2.85–2.81 (m, 6H); 13C NMR (151 MHz, DMSO-d6) δ 173.44, 160.82, 148.09, 142.39, 134.21, 130.17, 106.67, 105.46, 99.02, 56.24, 55.45, 50.31, 42.60, 35.78; HRMS (ESI): calcd. for C40H48N2O12, [M + H]+: 749.3281, found: 749.3291.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(4-(methylsulfonyl)benzyl)succinamide (10m)

Yield: 68%; white solid; m.p. 212.4–214.1 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.34 (t, J = 6.6 Hz, 2H), 8.13 (s, 2H), 7.69 (d, J = 8.4 Hz, 4H), 7.12 (d, J = 8.4 Hz, 4H), 6.40 (s, 4H), 4.26 (dd, J = 16.8, 6.6 Hz, 2H), 4.10 (dd, J = 16.2, 5.4 Hz, 2H), 3.66 (s, 12H), 3.15 (s, 6H), 3.00 (dd, J = 13.2, 1.8 Hz, 2H), 2.89–2.87 (m, 2H), 2.74–2.70 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.47, 148.17, 146.13, 139.35, 134.34, 129.86, 127.85, 126.99, 106.95, 56.34, 50.66, 44.04, 41.89, 36.25; HRMS (ESI): calcd. for C38H44N2O12S2, [M + H]+: 785.2409, found: 785.2410.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(4-hydroxy-3-methoxybenzyl)succinamide (10n)

Yield: 82%; white solid; m.p. 161.2–162.7 °C; 1H NMR (500 MHz, DMSO-d6) δ 8.16 (t, J = 6.0 Hz, 2H), 6.73 (d, J = 1.8 Hz, 2H), 6.61 (d, J = 8.0 Hz, 2H), 6.44 (dd, J = 8.0, 1.7 Hz, 2H), 6.36 (s, 4H), 4.10 (dd, J = 15.0, 6.0 Hz, 2H), 4.0 (dd, J = 15.0, 5.6 Hz, 2H), 3.66 (s, 12H), 3.65 (s, 6H), 2.89–2.73 (m, 6H); 13C NMR (126 MHz, DMSO-d6) δ 173.16, 158.86, 158.57, 148.10, 147.80, 145.69, 134.17, 130.63, 130.36, 119.95, 115.50, 112.00, 106.70, 56.27, 55.87, 50.46, 42.30, 35.40; HRMS (ESI): calcd. for C38H44N2O12, [M + H]+: 721.2967, found: 721.2941.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(pyridin-2-ylmethyl)succinamide (12a)

Yield: 74%; white solid; m.p. 157.3–159.1 °C; 1H NMR (600 MHz, MeOD) δ 8.57 (d, J = 4.8 Hz, 2H), 8.12–8.09 (m, 2H), 7.66 (t, J = 6.6 Hz, 2H), 6.91 (d, J = 7.8 Hz, 2H), 6.47 (s, 4H), 4.59 (d, J = 16.8 Hz, 2H), 4.31 (d, J = 16.8 Hz, 2H), 3.77 (s, 12H), 3.16 (dd, J = 13.2, 3.0 Hz, 2H), 2.99–2.97 (m, 2H), 2.81–2.77 (m, 2H); 13C NMR (151 MHz, MeOD) δ 175.07, 154.93, 147.81, 143.61, 142.95, 133.90, 129.29, 124.32, 123.64, 106.24, 55.34, 51.42, 41.01, 36.54; HRMS (ESI): calcd. for C34H38N4O8, [M + H]+: 631.2763, found: 631.2762.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis((6-methylpyridin-2-yl)methyl)succinamide (12b)

Yield: 81%; white solid; m.p. 143.2–145.1 °C; 1H NMR (600 MHz, MeOD) δ 7.93 (t, J = 7.8 Hz, 2H), 7.47 (d, J = 7.8 Hz, 2H), 6.65 (d, J = 7.8 Hz, 2H), 6.47 (s, 4H), 4.56 (d, J = 16.8 Hz, 2H), 4.23 (d, J = 16.8 Hz, 2H) 3.77 (s, 12H), 3.17 (dd, J = 13.2, 3.0 Hz, 2H), 2.98–2.96 (m 2H), 2.80–2.76 (m 2H), 2.64 (s, 6H); 13C NMR (151 MHz, MeOD) δ 174.88, 154.80, 154.36, 147.80, 143.19, 133.86, 129.29, 124.39, 120.38, 106.22, 55.32, 51.51, 40.88, 36.49, 19.48; HRMS (ESI): calcd. for C36H42N4O8, [M + H]+: 659.3076, found: 659.3089.

(2R,3S)-N1,N4-Bis((5-fluoropyridin-2-yl)methyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (12c)

Yield: 72%; white solid; m.p. 207.9–209.4 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.38 (d, J = 3.0 Hz, 2H), 8.34 (t, J = 6.0 Hz, 2H), 7.33–7.29 (m, 2H), 6.42 (s, 4H), 4.23 (dd, J = 16.2. 6.0 Hz, 2H), 4.09 (dd, J = 16.2, 6.0 Hz, 2H), 3.68 (s, 12H), 3.00 (d, J = 11.4 Hz, 2H), 2.89–2.88 (m, 2H), 2.74–2.70 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.58, 159.21, 157.54, 155.64, 148.23, 136.72, 136.56, 134.31, 129.94, 123.44, 123.32, 122.06, 107.00, 56.32, 50.64, 43.80, 36.27, 29.44; HRMS (ESI): calcd. for C34H36F2N4O8, [M + H]+: 667.2574, found: 667.2570.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis((3-methylpyridin-2-yl)methyl)succinamide (12d)

Yield: 76%; white solid; m.p. 186.2–187.9 °C; 1H NMR (600 MHz, MeOD) δ 8.45 (d, J = 4.8 Hz, 2H), 8.09 (d, J = 7.8 Hz, 2H), 7.69–7.67 (m, 2H), 6.30 (s, 4H), 4.49 (d, J = 15.6 Hz, 2H), 4.31 (d, J = 15.6 Hz, 2H), 3.72 (s, 12H), 3.03 (dd, J = 13.2, 3.6 Hz, 2H), 2.91–2.89 (m, 2H), 2.71–2.67 (m, 2H), 3.24 (s, 4H); 13C NMR (151 MHz, MeOD) δ 175.19, 151.30, 147.53, 145.37, 139.52, 135.95, 133.63, 129.07, 124.81, 105.82, 55.22, 50.94, 40.01, 36.56, 16.14; HRMS (ESI): calcd. for C36H42N4O8, [M + H]+: 659.3076, found: 659.3073.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis((4-methylpyridin-2-yl)methyl)succinamide (12e)

Yield: 81%; white solid; m.p. 107.2–108.6 °C; 1H NMR (600 MHz, MeOD) δ 8.37 (d, J = 6.0 Hz, 2H), 7.47 (d, J = 5.4 Hz, 2H), 7.18 (s, 2H), 6.45 (s, 4H), 4.47–4.39 (m, 4H), 3.79 (s, 12H), 3.10 (dd, J = 13.2, 3.0 Hz, 2H), 2.97–2.95 (m, 2H), 2.85–2.81 (m, 2H), 2.42 (s, 6H); 13C NMR (151 MHz, MeOD) δ 175.39, 157.75, 153.88, 147.67, 141.96, 133.82, 129.15, 125.20, 124.44, 106.05, 55.37, 51.19, 40.74, 36.83, 20.60; HRMS (ESI): calcd. for C36H42N4O8, [M + H]+: 659.3076, found: 659.3085.

(2R,3S)-N1,N4-Bis((3-fluoropyridin-4-yl)methyl)-2,3-bis(4-hydroxy-3,5-dimethoxybenzyl)succinamide (12f)

Yield: 78%; white solid; m.p. 222.1–224.6 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.39 (s, 2H), 8.32 (t, J = 5.4 Hz, 2H), 8.07 (d, J = 4.8 Hz, 2H), 6.46 (t, J = 5.4 Hz, 2H), 6.43 (s, 4H), 4.23 (dd, J = 16.8, 6.0 Hz, 2H), 4.06 (dd, J = 16.8, 5.4 Hz, 2H), 3.68 (s, 12H), 3.03 (d, J = 12.6 Hz, 2H), 2.92–2.90 (m, 2H), 2.72–2.68 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.81, 158.26, 156.58, 148.27, 145.81, 137.14, 136.98, 135.58, 135.49, 134.47, 129.72, 123.25, 107.06, 56.37, 50.67, 36.38, 35.29; HRMS (ESI): calcd. for C34H36F2N4O8, [M + H]+: 667.2574, found: 667.2584.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis(pyridin-4-ylmethyl)succinamide (12g)

Yield: 76%; white solid; m.p. 162.1–163.4 °C; 1H NMR (600 MHz, MeOD) δ 8.54 (d, J = 6 Hz, 4H), 7.29 (d, J = 6.6 Hz, 4H), 6.51 (s,4H), 4.67–4.60 (m, 2H), 4.23–4.18 (m, 2H), 3.78 (s, 12H), 3.23–3.21 (m, 2H), 3.00–2.94 (m, 2H), 2.78–2.74 (m, 2H); 13C NMR (151 MHz, MeOD) δ 174.65, 159.76, 147.87, 147.71, 141.25, 133.81, 129.56, 124.58, 106.43, 55.37, 54.18, 51.73, 43.58, 41.59, 36.34, 33.88, 26.19, 26.04; HRMS (ESI): calcd. for C34H38N4O8, [M + H]+: 631.2763, found: 631.2757.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis((2-(trifluoromethyl)pyridin-3-yl)methyl)succinamide (12h)

Yield: 83%; white solid; m.p. 235.1–236.2 °C; 1H NMR (600 MHz, DMSO-d6) δ 8.49 (d, J = 4.2 Hz, 2H), 8.37 (t, J = 5.4 Hz, 2H), 7.27–7.25 (m, 2H), 7.05 (d, J = 7.8 Hz, 2H), 6.44 (s, 4H), 4.33 (dd, J = 16.8, 5.4 Hz, 2H), 4.18 (dd, J = 16.2, 4.2 Hz, 2H), 3.69 (s, 12H), 3.06 (d, J = 13.2 Hz, 2H), 2.94–2.92 (m, 2H), 2.72–2.68 (m, 2H); 13C NMR (151 MHz, DMSO-d6) δ 173.97, 148.29, 147.32, 143.36, 143.14, 137.06, 134.44, 134.38, 129.69, 127.02, 125.44, 123.61, 121.79, 119.96, 107.06, 56.34, 50.81, 37.54, 36.65; HRMS (ESI): calcd. for C36H36F6N4O8, [M + H]+: 767.2511, found: 767.2522.

(2R,3S)-2,3-Bis(4-hydroxy-3,5-dimethoxybenzyl)-N1,N4-bis((2-methoxypyridin-3-yl)methyl)succinamide (12i)

Yield: 74%; white solid; m.p. 221.2–223.5 °C; 1H NMR (600 MHz, MeOD) δ 7.92 (dd, J = 4.8, 1.8 Hz, 2H), 6.75–6.73 (m, 2H), 6.71–6.70 (m, 2H), 6.49 (s, 4H), 4.21 (d, J = 16.8 Hz, 2H), 3.93–3.90 (m, 8H), 3.77 (s, 12H), 3.14 (dd, J = 13.2, 3.0 Hz, 2H), 2.90–2.87 (m 2H), 2.79–2.75 (m, 2H); 13C NMR (151 MHz, MeOD) δ 174.52, 160.99, 147.83, 144.10, 135.96, 133.85, 129.56, 120.95, 116.59, 106.19, 55.30, 52.56, 51.86, 37.04, 36.14; HRMS (ESI): calcd. for C36H42N4O10, [M + H]+: 691.2974, found: 691.2972.

4.2. Cells and reagents

DMSO and LPS were obtained from Sigma (LPS from Escherichia coli O55:B5, L2880, Sigma, St. Louis, MO, USA,). Mouse IL-6 (EMC004.96), IL-1β (EMC001b.96), and TNF-α (EMC102a.96) ELISA kits were purchased from Neobioscience (Neobioscience, Shenzhen, China). Gene primers were obtained from Sangon Biotech (Sangon Biotech, Shanghai, China). BeyoMag™ Animal RNA Isolation Kits with magnetic beads were purchased from Beyotime Biotechnology (R0077M, Beyotime Biotech, Nantong, China). Mouse monocyte macrophage leukemia cells (RAW 264.7) were obtained from Shanghai Cell Bank, Chinese Academy of Sciences (Shanghai, China). RAW 264.7 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (10-013-CVRC, Corning, NY, USA) supplemented with 10% fetal bovine serum (FBS) at 37 °C with 5% CO2. The final concentration of DMSO, which was used as a vehicle, did not exceed 0.1% in any assay.

4.3. Cell viability assay

Cell cytotoxicity was measured using Cell Counting Kit-8 (CCK-8; C0038, Beyotime Biotech, Nantong, China). RAW 264.7 cells (5 × 104 per well) were seeded into 96-well plates. The RAW cells were treated with the derivatives dissolved in DMSO (<1%) for 24 h. The medium was replaced with CCK-8 diluted 10-fold in medium, and cells were incubated for 1 h. The absorption values at 450 nm were measured on a microplate reader (SpectraMax M5). Cell viability was expressed as a percentage of the control culture value.

4.4. Measurement of NO production

The production of NO in living cells was measured using a NO assay kit (S0021S, Beyotime Biotech, Nantong, China). RAW 264.7 cells (5 × 104 per well) were seeded into 96-well plates. All derivatives were dissolved in DMSO (<1%) and diluted to the appropriate concentration. After 4 h of incubation with the derivatives, the cells were treated with LPS (1 μg mL−1) for another 24 h. The supernatants were collected and mixed with Griess reagents I and II and absorbance at 540 nm was measured using a microplate reader (SpectraMax M5). NaNO2 was used to generate a standard curve.

4.5. Cytokine production assays

RAW 264.7 cells (8 × 105 per well) were seeded into 24-well plates. The cells were treated with the indicated derivatives for 1 h followed by LPS (1 μg mL−1) treatment for 24 h. IL-6, IL-1β, and TNF-α levels were measured in the medium using ELISA kits according to the manufacturer's instructions.

4.6. Real-time quantitative PCR

RNA was extracted from RAW 264.7 cells using BeyoMag™ Animal RNA Isolation Kit with magnetic beads. The RNA was reverse transcribed into cDNA using the PrimeScript™ RT Kit (RR037A, Takara Bio, Inc.). Quantitative PCR (RT-qPCR) was performed using Hieff® qPCR SYBR Green Master Mix on a QuantStudio 3 instrument. Primers were obtained from Sangon Biotech. The 2−ΔΔCq method was used to determine the relative expression levels of mRNA. The primer sequences are shown in Table 3.

Primer sequences for quantitative PCR.

Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
IL-1β GAAATGCCACCTTTTGACAGTG TGGATGCTCTCATCAGGACAG
IL-6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG
TNF-α CAGGCGGTGCCTATGTCTC CGATCACCCCGAAGTTCAGTAG
GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA
Open in a new tab

4.7. Western blotting

RAW 264.7 cells (2.5 × 106 per well) were seeded into 6-well plates and pre-incubated with compound 10h for 1 h followed by treatment with 1 μg mL−1 of LPS for 1 h. After washing the cells twice with pre-cooled PBS, 1% protease inhibitor and 1% phosphatase inhibitor were added and cells were lysed on ice for 15 min. After centrifuging at 12 000 rpm min−1 for 5 min at 4 °C, the supernatant, i.e., the total cell proteins, was collected. Protein concentrations were determined using the BCA method. Protein lysates were denatured at 100 °C for 10 min after diluting with 5× protein loading buffer. The proteins were separated by SDS-PAGE electrophoresis and transferred to nitrocellulose (NC) membranes. After blocking the NC membranes with 5% skim milk for 1 h, the NC membranes were incubated overnight at 4 °C with primary antibodies including GAPDH (5174, Cell Signaling Technology), p-p65 (3033, Cell Signaling Technology), p65 (8242, Cell Signaling Technology), and IκBα (4812, Cell Signaling Technology). After washing with PBST, the NC membranes were incubated with the secondary antibody (1 : 4000) for 1 h. Secondary antibody binding was detected using chemiluminescence.

4.8. Immunofluorescence assay

RAW 264.7 cells were seeded (3 × 105 per well) into glass-bottomed dishes and pretreated with the derivatives for 1 h, followed by incubation with LPS for another 4 h. Cells were fixed and permeabilized with 4% paraformaldehyde and saponin, respectively. After washing three times with PBS, the cells were incubated with primary p65 antibodies (1 : 500) at 4 °C overnight. Samples were subsequently incubated with Cy3-conjugated secondary antibodies (1 : 500) for 1 h and counterstained with DAPI. Stained cells were viewed with a Leica fluorescence microscope.

4.9. Molecular docking

The molecular modelling studies of compound 10h were carried out using Molecular Operating Environment MOE version 2019.01. The crystal structure of the human IκBα/NF-κB (PDB ID: 1IKN) complex was chosen for the docking study, which was downloaded from the protein data bank website (http://www.rcsb.org). The protein structures were prepared after downloading using MOE quick preparation tool. The compound data was prepared by minimizing energy, adding hydrogen atoms, and calculating partial charges and potential energy. GBVI/WSA ΔG is a force field-based scoring function that estimates the free energy of binding of the ligand from a given pose. Ligand poses were ranked according their binding free energy. Figures were prepared using CCP4MG suite.

4.10. Animals

All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Naval Military Medical University, and approved by the Animal Ethics Committee of Naval Military Medical University (EC11-055). Specific pathogen-free ICR male mice (4–6 weeks, 18–22 g) were obtained from Leagene Biotechnology (Shanghai, China). They were maintained at a temperature (22 ± 1 °C) and humidity (55 ± 10%) controlled room with a 12 h light/dark cycle. The mice were given free access to standard diet and water. The laboratory mouse feed was purchased from Medicience, Ltd. and the ingredients included corn, wheat, bran, soybean meal, vegetable oil, vitamins, minerals and so on. Mice were acclimated for 3 days before treatment. Mice were randomly divided into five groups (n = 8/group). Saline, LCA (20 mg kg−1, i.p.), or compound 10h (5 or 20 mg kg−1, i.p.) was injected intraperitoneally 30 min before induction of inflammation. Paw edema was induced by injecting 100 μL of freshly prepared 1% carrageenan solution into the right hind paw of mice. Paw thickness was measured using vernier calipers at 0, 15, 30, 60, 120, and 240 min after carrageenan injection. Animals were euthanized 4 hours after carrageenan injection, and paw tissues were harvested, snap-frozen in liquid nitrogen, and stored at −80 °C. IL-1β, IL-6, and TNF-α levels were measured in the paw tissue homogenates using ELISA kits.

Abbreviations

IBD

Inflammatory bowel disease

RA

Rheumatoid arthritis

LPS

Lipopolysaccharide

NO

Nitric oxide

IL-1β

Interleukin-1β

TNF-α

Tumor necrosis factor-α

NF-κB

Nuclear factor-κB

NSAIDs

Non-steroidal anti-inflammatory drugs

iNOS

Inducible nitric oxide synthase

NMR

Nuclear magnetic resonance

HRMS

High-resolution mass spectra

NC membranes

Nitrocellulose membranes

Author contributions

Xiaoyun Chai, Qingjie Zhao and Qingguo Meng designed the project. Zhen Wang and Jing Wang performed the chemical synthesis as well as the manuscript preparation. Xiaobin Zhuo and Peichao Zhang participated in the structural characterisation of compounds. Zhen Wang, Juan Zhang and Yan Song performed the biological assays. Conghao Gai performed the docking study. Yan Zou and Guige Hou reviewed the manuscript. All authors have given their approval to the final version of the manuscript.

Conflicts of interest

There are no conflicts to declare.

Supplementary Material

MD-015-D4MD00053F-s001

Acknowledgments

This work was supported by the National Natural Science Foundation of China (No. 21602250, 82204347), the Naval Medical University Research Project (No. 20SWAQX29-2-7), the Naval Medical University Young Research Fellowship Grant (2021QN12), and the Naval Medical University Undergraduates' Innovation and Practice Training Programs (MS2021047, FH2021097). RAW 264.7 cells were kindly provided by Stem Cell Bank, Chinese Academy of Sciences.

†

Electronic supplementary information (ESI) available: 1H NMR, 13C NMR, and HRMS of all target compounds. See DOI: https://doi.org/10.1039/d4md00053f

References

  1. Kiss A. L. Pathol. Oncol. Res. 2022;27:1610136. doi: 10.3389/pore.2021.1610136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Nasef N. A. Mehta S. Ferguson L. R. Arch. Toxicol. 2017;91:1131–1141. doi: 10.1007/s00204-016-1914-5. [DOI] [PubMed] [Google Scholar]
  3. Arulselvan P. Fard M. T. Tan W. S. Gothai S. Fakurazi S. Norhaizan M. E. Kumar S. S. Oxid. Med. Cell. Longevity. 2016;2016:1–15. doi: 10.1155/2016/5276130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Serhan C. N. Levy B. D. J. Clin. Invest. 2018;128:2657–2669. doi: 10.1172/JCI97943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Nathan C. Ding A. Cell. 2010;140:871–882. doi: 10.1016/j.cell.2010.02.029. [DOI] [PubMed] [Google Scholar]
  6. Rodríguez-Hernández H. Simental-Mendía L. E. Rodríguez-Ramírez G. Reyes-Romero M. A. Int. J. Endocrinol. 2013;2013:1–11. doi: 10.1155/2013/678159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Michels N. Van Aart C. Morisse J. Mullee A. Huybrechts I. Crit. Rev. Oncol. Hematol. 2021;157:103177. doi: 10.1016/j.critrevonc.2020.103177. [DOI] [PubMed] [Google Scholar]
  8. Mak W. Y. Zhao M. Ng S. C. Burisch J. J. Gastroenterol. Hepatol. 2020;35:380–389. doi: 10.1111/jgh.14872. [DOI] [PubMed] [Google Scholar]
  9. Van Der Woude D. Van Der Helm-van Mil A. H. M. Best Pract. Res., Clin. Rheumatol. 2018;32:174–187. doi: 10.1016/j.berh.2018.10.005. [DOI] [PubMed] [Google Scholar]
  10. Calhelha R. C. Haddad H. Ribeiro L. Heleno S. A. Carocho M. Barros L. Appl. Sci. 2023;13:2312. doi: 10.3390/app13042312. [DOI] [Google Scholar]
  11. Sinniah A. Yazid S. Flower R. J. Cell. 2021;10:3524. doi: 10.3390/cells10123524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Roubille C. Martel-Pelletier J. Davy J.-M. Haraoui B. Pelletier J.-P. Anti-Inflammatory Anti-Allergy Agents Med. Chem. 2013;12:55–67. doi: 10.2174/1871523011312010008. [DOI] [PubMed] [Google Scholar]
  13. Bindu S. Mazumder S. Bandyopadhyay U. Biochem. Pharmacol. 2020;180:114147. doi: 10.1016/j.bcp.2020.114147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cabassi A. Tedeschi S. Perlini S. Verzicco I. Volpi R. Gonzi G. Canale S. D. Eur. J. Prev. Cardiol. 2020;27:850–867. doi: 10.1177/2047487319848105. [DOI] [PubMed] [Google Scholar]
  15. Chopra B. Dhingra A. K. Phytother. Res. 2021;35:4660–4702. doi: 10.1002/ptr.7099. [DOI] [PubMed] [Google Scholar]
  16. Tasneem S. Liu B. Li B. Choudhary M. I. Wang W. Pharmacol. Res. 2019;139:126–140. doi: 10.1016/j.phrs.2018.11.001. [DOI] [PubMed] [Google Scholar]
  17. Lin B. Zhang H. Zhao X.-X. Rahman K. Wang Y. Ma X.-Q. Zheng C.-J. Zhang Q.-Y. Han T. Qin L.-P. J. Ethnopharmacol. 2013;147:327–334. doi: 10.1016/j.jep.2013.03.011. [DOI] [PubMed] [Google Scholar]
  18. Lin B. Sun L.-N. Xin H.-L. Nian H. Song H.-T. Jiang Y.-P. Wei Z.-Q. Qin L.-P. Han T. Pharm. Biol. 2016;54:1741–1747. doi: 10.3109/13880209.2015.1126619. [DOI] [PubMed] [Google Scholar]
  19. Yu L. Jia D. Feng K. Sun X. Xu W. Ding L. Xin H. Qin L. Han T. J. Ethnopharmacol. 2020;257:112873. doi: 10.1016/j.jep.2020.112873. [DOI] [PubMed] [Google Scholar]
  20. Liu T. Zhang L. Joo D. Sun S.-C. Signal Transduction Targeted Ther. 2017;2:17023. doi: 10.1038/sigtrans.2017.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Forstermann U. Sessa W. C. Eur. Heart J. 2012;33:829–837. doi: 10.1093/eurheartj/ehr304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hayden M. S. Ghosh S. Genes Dev. 2004;18:2195–2224. doi: 10.1101/gad.1228704. [DOI] [PubMed] [Google Scholar]
  23. Sun T. Wang C. Li D. Zhao Y. Zeng T. Chongqing Yike Daxue Xuebao. 2016;41:175–178. [Google Scholar]
  24. Jia L. Wang Y. Wang Y. Qin Y. Hu C. Sheng J. Ma S. Bioorg. Med. Chem. Lett. 2018;28:2471–2476. doi: 10.1016/j.bmcl.2018.06.006. [DOI] [PubMed] [Google Scholar]
  25. Morita K. Ohta R. Aoyama H. Yahata K. Arisawa M. Fujioka H. Chem. Commun. 2017;53:6605–6608. doi: 10.1039/C7CC03287K. [DOI] [PubMed] [Google Scholar]
  26. Martín M. J. Rodríguez-Acebes R. García-Ramos Y. Martínez V. Murcia C. Digón I. Marco I. Pelay-Gimeno M. Fernández R. Reyes F. Francesch A. M. Munt S. Tulla-Puche J. Albericio F. Cuevas C. J. Am. Chem. Soc. 2014;136:6754–6762. doi: 10.1021/ja502744a. [DOI] [PubMed] [Google Scholar]
  27. Davidson S. J. Pilkington L. I. Dempsey-Hibbert N. C. El-Mohtadi M. Tang S. Wainwright T. Whitehead K. A. Barker D. Molecules. 2018;23:3057. doi: 10.3390/molecules23123057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Medici F. Puglisi A. Rossi S. Raimondi L. Benaglia M. Org. Biomol. Chem. 2023;21:2899–2904. doi: 10.1039/D3OB00232B. [DOI] [PubMed] [Google Scholar]
  29. Do H.-Q. Tran-Vu H. Daugulis O. Organometallics. 2012;31:7816–7818. doi: 10.1021/om300393m. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Berger M. Chauhan R. Rodrigues C. A. B. Maulide N. Chem. – Eur. J. 2016;22:16805–16808. doi: 10.1002/chem.201604344. [DOI] [PubMed] [Google Scholar]
  31. Li C. Key J. A. Jia F. Dandapat A. Hur S. Cairo C. W. Photochem. Photobiol. 2014;90:686–695. doi: 10.1111/php.12234. [DOI] [PubMed] [Google Scholar]
  32. Martínez-Cabot A. Messeguer A. Chem. Res. Toxicol. 2007;20:1556–1562. doi: 10.1021/tx700256v. [DOI] [PubMed] [Google Scholar]
  33. Subedi L. Gaire B. P. Kim S.-Y. Parveen A. Int. J. Mol. Sci. 2021;22:4771. doi: 10.3390/ijms22094771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zamora R. Vodovotz Y. Billiar T. R. Mol. Med. 2000;6:347–373. [PMC free article] [PubMed] [Google Scholar]
  35. Turner M. D. Nedjai B. Hurst T. Pennington D. J. Biochim. Biophys. Acta, Mol. Cell Res. 2014;1843:2563–2582. doi: 10.1016/j.bbamcr.2014.05.014. [DOI] [PubMed] [Google Scholar]
  36. Kushner I. Cytokine Growth Factor Rev. 1998;9:191–196. doi: 10.1016/S1359-6101(98)00016-1. [DOI] [PubMed] [Google Scholar]
  37. Yu L., MPhil., Shanghai Normal University, Shanghai, 2020 [Google Scholar]
  38. Abraham E. Crit. Care Med. 2000;28:N100–N104. doi: 10.1097/00003246-200004001-00012. [DOI] [PubMed] [Google Scholar]
  39. Sherwood E. R. Toliver-Kinsky T. Best Pract. Res., Clin. Anaesthesiol. 2004;18:385–405. doi: 10.1016/j.bpa.2003.12.002. [DOI] [PubMed] [Google Scholar]
  40. Huxford T. Huang D.-B. Malek S. Ghosh G. Cell. 1998;95:759–770. doi: 10.1016/S0092-8674(00)81699-2. [DOI] [PubMed] [Google Scholar]
  41. Shen H., MPhil., Naval Medical University, 2018 [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

MD-015-D4MD00053F-s001
MD-015-D4MD00053F-s001.pdf (4.3MB, pdf)

Articles from RSC Medicinal Chemistry are provided here courtesy of Royal Society of Chemistry

RESOURCES