Abstract
Transcription-coupled repair (TCR) and global genomic repair (GGR) are two subpathways of nucleotide excision repair (NER). The TFIIH subunit Tfb1 contains a Pleckstrin homology domain (PHD), which was shown to interact with one PHD-binding segment (PB) of Rad4 and two PHD-binding segments (PB1 and PB2) of Rad2 in vitro. Whether and how the different Rad2 and Rad4 PBs interact with the same Tfb1 PHD, and whether and how they affect TCR and GGR within the cell remain mysterious. We found that Rad4 PB constitutively interacts with Tfb1 PHD, and the two proteins may function within one module for damage recognition in TCR and GGR. Rad2 PB1 protects Tfb1 from degradation and interacts with Tfb1 PHD at a basal level, presumably within transcription preinitiation complexes when NER is inactive. During a late step of NER, the interaction between Rad2 PB1 and Tfb1 PHD augments, enabling efficient TCR and GGR. Rather than interacting with Tfb1 PHD, Rad2 PB2 constrains the basal interaction between Rad2 PB1 and Tfb1 PHD, thereby weakening the protection of Tfb1 from degradation and enabling rapid augmentation of their interactions within TCR and GGR complexes. Our results shed new light on NER mechanisms.
Graphical Abstract
Graphical Abstract.
Introduction
Nucleotide excision repair (NER) is a conserved DNA repair process that eliminates bulky or helix-distorting DNA lesions, such as UV-induced cyclobutane pyrimidine dimers (CPDs) (1–3). NER involves steps of damage recognition and verification, incision and excision of the DNA fragment containing damage, repair synthesis, and ligation. Global genomic repair (GGR) is a NER subpathway responsible for removing lesions throughout the genome, including the nontranscribed strand (NTS) of actively transcribed genes. In the yeast Saccharomyces cerevisiae, GGR is dependent on Rad7 and Rad16 (4,5), and to a lesser extent, Elc1 (6). Transcription coupled repair (TCR) is another NER subpathway that is dedicated to rapid removal of lesions in the transcribed strand (TS) of actively transcribed genes (7). TCR is triggered by the stalling of RNA polymerase II (RNAPII) and has been found to be facilitated by Rad26, the yeast homolog of human CSB (8), Rpb9, a nonessential subunit of RNAPII (9), Sen1, an ATPase-helicase (10), and Elf1, a transcription elongation factor (11,12). GGR and TCR differ in damage recognition but converge in the later steps.
TFIIH is a conserved protein complex required for transcription initiation and NER (13–15). The core TFIIH contains 7 subunits (Figure 1A) and is required for both transcription initiation and NER. The cyclin-activating kinase subcomplex of TFIIH, consisting of CDK7, cyclin H and MAT1, is required for transcription initiation but not for NER (16), and is actively displaced from TFIIH during NER (17). TFIIH is recruited to damaged DNA, where it kinetically proofreads the presence of DNA damage via its translocase and helicase subunits, XPB and XPD (homologues of yeast Ssl2 and Rad3, respectively) and recruits downstream NER factors. Yeast Tfb1, or its human ortholog p62, is a subunit of the core TFIIH. A region of ∼120 amino acids at the N-terminal of Tfb1/p62 forms a typical Pleckstrin homology domain (PHD) (Figure 1A and B), a structure present in multiple proteins that is involved in protein-protein interactions (18). However, the precise function of the Tfb1 PHD in NER remains poorly understood.
Figure 1.
Tfb1 PHD and its interactions with Rad2 and Rad4 in vitro. (A) Co-structure of yeast 7-subunit core TFIIH with Rad4 PB (from PDB 7k04). (B) Co-structures of Rad2 PB2 (PDB 2lox) and Rad4 PB (PDB 2m14) with Tfb1 PHD. Note that Rad2 PB1 forms essentially the same co-structure with Tfb1 PHD as Rad2 PB2 (34,35). (C) Schematic of Rad2: structured catalytic N-terminal (N) and Internal (I) domains (open boxes), PB1 and PB2 (cyan boxes), conserved PHD-binding motif (F/W-E-D/E-V, blue boxes), deleted regions in the rad2-pb1 and rad2-pb2 mutants used in this study (red bars). (D) Schematic of Rad4: structured catalytic domain (open box), PB (cyan box), conserved PHD-binding motif (blue box), deleted region in the rad4-pb mutant used in this study (red bar).
The yeast Rad2 and its human ortholog XPG are specific endonucleases responsible for incising DNA on the 3′ side of the damaged bases during NER (19). Interactions between Rad2/XPG and TFIIH have been observed in both yeast and human cells (20,21), yet the co-structure of Rad2/XPG with TFIIH has remained elusive, leaving the nature of their interaction during NER perplexing. While Rad2 and XPG share high sequence similarities in their N-terminal (N) and internal (I) catalytic core domains, their unstructured spacer regions between the N and I domains show little sequence similarity (Figure 1C) (22–24). The similarity and difference in the actions of Rad2 and XPG in yeast and humans remains to be elucidated.
The yeast Rad4 and its human ortholog XPC play crucial roles in recognizing damaged DNA by binding to the undamaged strand and extruding the damaged bases from the double helix (25–28). Rad4 and XPC have been shown to interact with TFIIH (29,30). However, XPC and XPG cannot simultaneously bind to TFIIH, indicating the interactions occur sequentially (31). While XPC is specifically required for GGR in human cells, Rad4 is required for both GGR and TCR in yeast (32,33). The distinct mechanisms by which Rad4 functions in GGR and TCR remain unknown.
One PHD-binding segment (PB) in the N-terminal unstructured region of Rad4, and two PBs (PB1 and PB2) in the unstructured spacer region of Rad2 have been shown to interact with essentially the same area of Tfb1 PHD (Figure 1) in vitro (27,34,35). Similar to Rad4, XPC also contains a PB that interacts with p62 PHD (36). The interaction between XPC PB and p62 PHD has been proposed to play a significant role in recruiting the TFIIH complex to damaged DNA after the initial damage recognition (36). However, whether and how the different Rad2 and Rad4 PBs interact with the same Tfb1 PHD and whether and how they affect TCR and GGR in the cell remain unknown. Here, we provide major insights into these questions. Our results not only elucidate the intricate interplay among Tfb1, Rad4 and Rad2 during TCR and GGR but also unveil previously unexpected regulation mechanisms for TCR and GGR.
Materials and methods
Yeast plasmids and strains
All plasmids and strains used in this study are listed in Supplementary Tables S1 and S2, respectively.
Bpa-crosslinking in living cells
Yeast cells expressing Tfb1 with its PHD residues substituted by the photoreactive unnatural ammino acid p-benzoyl-L-phenylalanine (Bpa) were grown in synthetic dextrose (SD) medium containing 0.5 mM Bpa (Bachem) to late log phase (OD600 ≈ 1.0), irradiated with 120 J/m2 of UVC (254 nm) or unirradiated. Following different times of incubation in SD medium containing 0.5 mM Bpa, aliquots were taken. Cells from 15 ml of culture were washed twice with ice-cold H2O, resuspended in 20 ml of ice-cold 2% glucose, and divided into two halves. One half was kept on ice, while the other was transferred into a 10-cm diameter glass petri dish and irradiated with UVA (365 nm) for 20 minutes (total dose of 72 000 J/m2) on ice. Following UVA irradiation, cells were pelleted, resuspended in 250 μl of buffer-equilibrated phenol (pH 8.0), and broken by vortexing with 300 μl of glass beads for 15 minutes. The phenol-cell lysate mixture was transferred to a fresh tube and added with 1.25 ml of methanol containing 0.1 M ammonium acetate. Proteins from the cell lysate were pelleted by centrifugation at 16 000 × g for 15 minutes at 4°C, washed with ice-cold 80% acetone, and resuspended in 200 μl of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel loading buffer.
3 × FLAG tagged Rad2, 6 × FLAG tagged Rad4, 3 × MYC tagged Tfb1 and α-tubulin in the protein extracts were respectively detected by Western blot, using anti-FLAG (M2, Sigma), anti-MYC (A00863, Genscript), anti-tubulin (GTX76511, GeneTex) antibodies. Blots were incubated with SuperSignal West Femto maximum-sensitivity substrate (Pierce) and scanned with the ChemiDoc Imaging System (BioRad). For each blot, a sequence of images capturing the progressive accumulation of signals was collected. Blots demonstrating comparable and suitable signal intensities were selected for inclusion in each figure panel. The intensity of the bands in each figure panel was quantified using GelAnalyzer. The relative loadings across the gel lanes were normalized to lane 1 within each figure panel.
Measurement of relative Tfb1 mRNA levels in wild type and rad2-pb1 cells
Total RNA was isolated from wild type and rad2-pb1 cells using a one-step hot formamide extraction method (37). mRNA from 1 μg of total RNA was reverse transcribed using Oligo(dT)18 as primer and ProtoScript II reverse transcriptase (New England Biolabs). The resulting cDNA was mixed with iTaq Universal SYBR Green Supermix (Bio-Rad) and primers specific for the TFB1 (AAAGATGCAGATATCTACGAAGAAAAG and CCATTATTCAATTGTGGTGTATCGAG) and ACT1 (internal control) (AATACCTGGGAACATGGTGG and TGGAATCTGCCGGTATTGAC) genes, and amplified on an ABI 7300 Real-Time PCR System (Applied Biosystems). The 2−ΔΔct method (38) was used to calculate the relative levels of Tfb1 mRNA. The ACT1 mRNA levels were served as an internal control for sample normalization.
LAF-Seq for base-resolution mapping of CPD repair
Yeast cells were grown in SD medium at 30°C to late log phase (OD600 ≈ 1.0), irradiated with 120 J/m2 of UVC and incubated in complete medium in the dark at 30°C. At different timepoints of the repair incubation, aliquots were collected, and the genomic DNA was isolated. To analyze CPDs remaining in the AGP2, RPB2 and YEF3 genes, which are transcribed at low, moderate and high levels, respectively (39), we adapted the Lesion-Adjoining Fragment Sequencing (LAF-Seq) method, which was originally developed for mapping N-methylpurines in human cells (40). The genomic DNA was digested with HincII, NruI, NsiI and HhaI to release the AGP2, RPB2 and YEF3 gene fragments, incised at the CPD sites with T4 endonuclease V, and the 3′ phosphate group resulting from T4 endonuclease V incision was removed by treatment with E. coli endonuclease IV. The AGP2, RPB2 and YEF3 gene fragments were strand-specifically fished out using biotinylated oligonucleotides and streptavidin beads. The 3′ ends of the fished-out fragments were ligated with a common adapter sequence using Circligase (40). The fragments were added with barcoded Illumina sequencing adapters by 8 cycles of PCR and sequenced on an Illumina sequencing platform.
The sequencing reads were aligned to the TS and/or NTS of the AGP2, RPB2 and YEF3 genes using Bowtie 2 (41). The reads corresponding to CPD sites were counted and normalized based on Loess-regressed values of the reads corresponding to non-CPD sites along the genes by using R scripts. The net CPD counts at individual sites were obtained by subtracting the corresponding background counts (in the unirradiated samples). The values of percent CPDs remaining were calculated based on the net CPD counts. The differences of CPD repair speed between mutants and their corresponding controls was determined using paired Student's t test. To calculate the p-values, the means of percent CPDs remaining in mutants were paired with those in controls, specifically for the AGP2, RPB2 and YEF3 genes, at the corresponding repair timepoints.
UVA and UVC sensitivity assays
Yeast cells were cultured to saturation at 30°C. Sequential 10-fold dilutions of the cultures were made. Five μl of the diluted cell suspension was spotted onto plates and irradiated with varying doses of UVA or UVC. The plates were incubated in the dark at 30°C for 3–5 days before being photographed.
Results
Rad2 interacts with Tfb1 PHD at a basal level in the cell, and this interaction augments shortly after UVC irradiation
To investigate whether Rad2 interacts with Tfb1 PHD in the cell, we substituted specific Tfb1 PHD residues with the photoreactive crosslinker p-benzoyl-l-phenylalanine (Bpa) (Figure 2A–C) (42,43). When subjected to UVA (365 nm) irradiation, a Bpa-containing protein can be crosslinked to its interacting protein (within a distance of ∼ 3 Å) (44). By incorporating a Bpa into a protein of interest within living cells, the Bpa-mediated crosslinking allows for unambiguous detection of proteins that directly interact with the protein of interest. Bpa substitution at Tfb1 L48 or R61, which have been demonstrated to be critical for interactions of Tfb1 PHD with Rad2 and Rad4 in vitro (34,35), did not lead to crosslinking with Rad2 (Figure 2D, lanes 3, 4, 23 and 24) or Rad4 (Figure 3A, lanes 3, 4, 15 and 16). The absence of crosslinking was not investigated further, but it could potentially be attributed to either alterations in the Tfb1-PHD structure caused by the Bpa substitutions or differences in the interactions between in vitro and in vivo environments. In contrast, Bpa substitution at Tfb1 S109 led to crosslinking with Rad2, and the crosslinking increased within 15 min after UVC (254 nm) irradiation (Figure 2D, lanes 9 and 10). Bpa substitution at other Tfb1 PHD residues, such as E56, R86, Q105 and Q106, also led to detectable crosslinking with Rad2 (Figure 2D). The residues E56, R86, Q105, Q106 and S109 are all situated on the peripheral surface of the Tfb1 PHD structure, with their side chains facing outward (Figure 2A). Substituting these residues with Bpa is expected to result in minimal alterations to the Tfb1 PHD structure. Nonetheless, any crosslinking we observed will unequivocally indicate genuine direct interactions within the cells. Our results indicate that Rad2 interacts with Tfb1 PHD at a basal level in the cell and the interaction augments shortly after UVC irradiation.
Figure 2.
Direct interaction of Rad2 with Tfb1 PHD in living cells. (A) Tfb1 PHD structure with Bpa-substituted residues shown in blue. (B) Structure of Bpa. (C) Plasmid pair that enables substitution of Tfb1 residues with Bpa. pTFB1-TAG bears TFB1 gene with an amino acid codon mutated to the stop codon TAG. pLH157 bears Ec-TyrRS and Ec-tRNACUA genes, which enable Bpa incorporation through nonsense suppression of the TAG codon. (D) Western blot showing crosslinking of Rad2 to Bpa-substituted Tfb1 (indicated by ‘Rad2-Tfb1’) before (–) and 15 min after (+) UVC irradiation. (E) Western blot showing Bpa-substituted Tfb1 in cells before (–) and 15 min after UVC irradiation. Note that Tfb1 was C-terminal 3 × MYC tagged and probed with an anti-MYC antibody. The truncated Tfb1 fraction was calculated by dividing its level by the total (full-length + truncated) Tfb1 level. (F) Relative levels of TFB1 mRNA in wild type and rad2-pb1 cells. Error bars stand for standard deviation. (G) Western blot showing wild type and PHD-truncated Tfb1 (tfb1-phd) in cells with wild type Rad2. (H) Western blot showing crosslinking of wild type and mutant Rad2 to Bpa-substituted Tfb1 before (–) or 15 min after (+) UVC irradiation. (I) Western blot showing time-course of crosslinking between Rad2 and Bpa-substituted Tfb1 in cells with the indicated genotype after UVC irradiation. (J) Time course of percent Rad2 crosslinked to Tfb1 in cells with the indicated genotype after UVC irradiation. Error bars (standard deviation) are shown only for wild type and rad7Δ cells for clarity. (K) Western blot showing crosslinking between Rad2 and Bpa-substituted Tfb1 in cells with the indicated genotype before (–) and 15 min after (+) UVC irradiation. Note that the loadings in lanes of panels D, E, H, I and K are relative to that in lane 1 within each respective panel.
Figure 3.
Direct interaction of Rad4 with Tfb1 PHD in living cells. (A) Western blot showing crosslinking of Rad4 to Bpa-substituted Tfb1 (indicated by red arrows pointing to the shifted bands) before (–) and 15 min after (+) UVC irradiation. (B) Western blot showing time-course of crosslinking between Rad4 and Bpa-substituted Tfb1 in cells of indicated genotypes after UVC irradiation. (C) Time course of percent Rad4 crosslinked to Tfb1 in cells with the indicated genotype after UVC irradiation. (D) Western blot showing crosslinking between Rad4 and Tfb1 PHD in cells with the indicated genotype before (–) and 15 min after (+) UVC irradiation. (E) Western blot showing wild type and mutant Tfb1 and Rad4 in cells with the indicated genotype. (F) Western blot showing the inability of rad4-pb to crosslink with Bpa-substituted Tfb1. Note that the loadings in lanes of panels A and B are relative to that in lane 1 within each respective panel.
To determine if the UVA used to induce crosslinking of Bpa-incorporated proteins resulted in NER lesions, we examined the sensitivities of wild-type and certain NER-defective cells to both UVA and UVC. As expected, the NER-defective rad2Δ, rad4Δ, and rad14Δ cells showed extreme sensitivity to UVC, with a dose of just 3 J/m2 resulting in approximately 90% killing (Supplementary Figure S1A). However, even these NER-defective cells showed no killing at all by UVA at doses as high as 144000 J/m2—twice the dose used for inducing crosslinking of Bpa-incorporated proteins (Supplementary Figure S1B). Therefore, any NER lesions potentially induced by the UVA source we utilized should be minimal, if present at all.
Rad2 PB1 protects Tfb1 from degradation regardless of the presence of Tfb1 PHD, whereas Rad2 PB2 weakens the protection.
We created rad2 mutant strains where the Rad2 PB motif was truncated in PB1 (rad2-pb1, lacking residues 368–378), PB2 (rad2-pb2, lacking residues 667–673), or both PB1 and PB2 (rad2-pb1-2) (Figure 1C). rad2-pb1 and rad2-pb1-2 cells exhibited significantly lower levels of the full-length 73 kDa Tfb1, with an accompanying appearance of an approximately 60 kDa truncated Tfb1 (Figure 2E, lanes 7, 8, 11 and 12). As the Tfb1 protein was 3 × MYC-tagged at the C-terminal and the truncated Tfb1 could be detected by an anti-MYC antibody, the truncation likely occurred at the N-terminal and encompassed roughly the entire ∼13 kDa PHD. We replaced the native promoter of TFB1 with the CuSO4-inducible promoter of CUP1 to restore the level of Tfb1 protein in rad2-pb1 and rad2-pb1-2 cells. The CUP1 promoter can drive moderate ‘leaky’ transcription in the absence of CuSO4 and can be induced around 20-fold in the presence of CuSO4 (45). The level of full-length Tfb1 could be largely restored in the rad2-pb1 and rad2-pb1-2 cells upon induction by CuSO4 (Figure 2E, compare lanes 9 and 10 with 11 and 12, and lanes 5 and 6 with 7 and 8). However, the truncated Tfb1 still accounted for 50–60% of the total Tfb1 in the CuSO4-induced rad2-pb1 and rad2-pb1-2 cells (Figure 2E, lanes 5, 6, 9 and 10). This indicates that the overexpression of Tfb1 alleviated, but did not entirely prevent, its truncation in the absence of Rad2 PB1.
We assessed the relative levels of TFB1 mRNA in wild type and rad2-pb1 cells. The Tfb1 mRNA level in rad2-pb1 cells was approximately 6-fold that in wild-type cells (Figure 2F), suggesting that the reduction in Tfb1 observed in rad2-pb1 cells was due to Tfb1 protein degradation rather than diminished TFB1 gene transcription. The elevated Tfb1 mRNA level in rad2-pb1 cells may stem from an as-yet-undiscovered compensatory mechanism that counteracts Tfb1 protein degradation.
Contrary to rad2-pb1 and rad2-pb1-2 cells, rad2-pb2 cells exhibited an increased (∼ 1.6 fold) level of Tfb1 (Figure 2E, compare lanes 3 and 4 with 1 and 2). This indicates that Rad2 PB2 weakens the protection of Tfb1 from degradation by Rad2 PB1.
To determine whether Rad2 PB1 requires interaction with Tfb1 PHD or its presence to protect Tfb1 from degradation, we truncated the PHD from Tfb1 (tfb1-phd, lacking residues 2–115). The level of tfb1-phd was not significantly reduced in cells with wild-type Rad2 (Figure 2G, compare intensities of Tfb1 and tfb1-phd bands). This suggests that Rad2 PB1 does not require interaction with Tfb1 PHD or its presence to protect Tfb1 from degradation.
Rad2 PB1 is essential for the basal and UVC-augmented interactions with Tfb1 PHD, whereas Rad2 PB2 constrains the basal interaction
As Bpa substitution at Tfb1 S109 led to the strongest crosslinking with Rad2 (Figure 2D), we leveraged this substitution to further elucidate the interaction between Rad2 and Tfb1 PHD. No crosslinking of rad2-pb1 or rad2-pb1-2 with Tfb1 PHD could be detected in UVC irradiated or unirradiated cells, even when the level of full-length (PHD-containing) Tfb1 was restored by CuSO4 induction of Tfb1 driven by the CUP1 promoter (Figure 2E and H, lanes 5–12). This indicates that Rad2 PB1 is required for both basal and UVC-augmented interactions with Tfb1 PHD.
The level of basal interaction between rad2-pb2 and Tfb1 PHD was nearly equivalent to that observed between the native full-length Rad2 and Tfb1 PHD after UVC irradiation (Figure 2H, compare lanes 1–3). UVC irradiation did not result in significant augmentation of the interaction between rad2-pb2 and Tfb1 PHD (Figure 2H, compare lanes 3 and 4). These results indicate that, contrary to the in vitro observations (34), Rad2 PB2 does not interact with Tfb1 PHD in the cell. Instead, it constrains the basal interaction, thereby enabling the augmentation of the interaction between Rad2 and Tfb1 PHD following UVC irradiation.
The UVC-augmented interaction between Rad2 and Tfb1 PHD occurs in a late NER step
To investigate whether and how the interaction between Rad2 and Tfb1 PHD might be related to NER, we investigated the temporal dynamics of this interaction following UVC irradiation and how other NER factors operating at various steps of the repair process influence this interaction. The basal interaction between Rad2 and Tfb1 PHD occurred at a similar level in all the strains tested (Figure 2I–K, compare UVC- UVA + lanes), suggesting that the basal interaction is unrelated to NER.
In wild type cells, following its initial augmentation, the interaction between Rad2 and Tfb1 PHD gradually returned to nearly the basal level within 240 min after UVC irradiation (Figure 2I, lanes 1–7; Figure 2J). Deletion of Rad26 (rad26Δ), which compromises but does not abolish TCR, did not significantly affect the temporal dynamics of the interaction (Figure 2I, compare lanes 14–19 with 2–7; Figure 2J). The UVC-augmented interaction also occurred in rad7Δ, rad7Δ rad26Δ or rad26Δ rpb9Δ cells (Figure 2I, lanes 20–40; Figure 2J). However, unlike in wild type cells, the interaction between Rad2 and Tfb1 PHD did not restore to the basal level in the cells that are completely defective for GGR (in rad7Δ or rad7Δ rad26Δ cells) or TCR (in rad26Δ rpb9Δ cells). Strikingly, the UVC-augmented interaction was essentially absent in rad4Δ, rad14Δ or rad7Δ rad26Δ rpb9Δ cells which are completely defective for both GGR and TCR (Figure 2I-K). Taken together, these results indicate that the UVC-augmented interaction can be triggered by either GGR or TCR activity, occurs in a step downstream of the actions of Rad4, Rad14, Rad7, Rad26 and Rpb9, and disappears after the UVC induced lesions are repaired by GGR and TCR.
Rad4 constitutively interacts with Tfb1 PHD in the cell
Next, we investigated whether Rad4 interacts with Tfb1 PHD in the cell. Bpa substitution of Tfb1 Q105 and S109, and to a lesser extent of K101, led to very weak but detectable crosslinking with Rad4 (Figure 3A). The positions of the bands of Rad4 crosslinked to the different Bpa-substituted Tfb1 appeared to be different, which is not particularly surprising as it has been observed previously that the sites of Bpa incorporation may affect the migration of crosslinked proteins on the gel (46). In agreement with previous studies (47), we observed bands of sumoylated Rad4, and the level of sumoylation increased after UVC irradiation, especially in rad14Δ cells (Figure 3A and B). The bands of sumoylated Rad4 were unaffected by UVA irradiation (Figure 3B, compare the bands of sumoylated Rad4 between lanes 1 and 2, and 26 and 27), whereas the band of Rad4-crosslinked to Bpa-substituted Tfb1 can only be seen upon UVA irradiation. The crosslinking levels were unchanged following UVC irradiation and were essentially unaffected by any other NER factors tested, including Rad2, Rad14, Rad26 and Rad7 (Figure 3B–D). These results indicate that the interaction between Rad4 and Tfb1 PHD is constitutive. These findings are surprising, because the interaction between Rad4 and Tfb1 in cells lacking NER activities has been undocumented, and all current models would predict that the interaction between Rad4 and Tfb1 would occur only transiently after TFIIH is recruited to damaged DNA during NER.
Rad4 PB is required for interaction with Tfb1 PHD and for rapid augmentation of the interaction of Rad2 with Tfb1 PHD after UVC irradiation
To determine if Rad4 PB is required for interaction with Tfb1 PHD, we created rad4 mutant strains where the Rad4 PB motif (residues 93–103) is truncated (rad4-pb) (Figure 1D). rad4-pb had no impact on the cellular level of Rad4, the native Tfb1 or PHD-truncated Tfb1 (Figure 3E). No crosslinking was observed between rad4-pb and Tfb1 PHD (Figure 3F, comparing lanes 1 and 2 with 3 and 4), indicating that Rad4 PB is required for interaction with Tfb1 PHD.
The interaction between Rad2 and Tfb1 PHD also augmented in rad4-pb cells after UVC irradiation (Figure 2I, lanes 8–13; Figure 2J). However, this augmented interaction peaked ∼ 30 min after UVC irradiation, which is slower than in cells with wild type Rad4, where the augmented interaction peaked within 15 min after the irradiation (Figure 2I, compare lanes 8–13 with 2–7).
Rad4 PB and, to lesser extents, Rad2 PB1 and Rad2 PB2 facilitate TCR via a mechanism involving Tfb1 PHD
The UVC sensitivities of all cell types tested were not significantly affected by rad2-pb1 or rad2-pb2 (Figure 4A–C; Table 1). Note that rad2-pb1 cells exhibited a low level of Tfb1 (Figure 2E), suggesting that neither rad2-pb1 itself nor the resulting decreased Tfb1 level significantly impacts UVC sensitivity. Supporting this notion, overexpression of Tfb1 (O-Tfb1) by CuSO4-induction of the CUP1 promoter-driven Tfb1 (Figure 2E) did not substantially affect UVC sensitivity of rad2-pb1 cells (Figure 4D).
Figure 4.
Cell UVC sensitivity. (A–E) Plates showing survival of cells with the indicated genotypes following varying doses of UVC irradiation.
Table 1.
UVC sensitivity caused by rad2-pb1, rad2-pb2, rad4-pb and tfb1-phd mutations
| Parent strain | |||||||
|---|---|---|---|---|---|---|---|
| WT | tfb1-phd | rad7Δ | rad7Δ tfb1-phd | rad7Δ rad26Δ | rad7Δ rad26Δ tfb1-phd | rad14Δ | |
| rad2-pb1 | N | N | N | N | N | N | N |
| rad2-pb2 | N | N | N | N | N | N | N |
| rad4-pb | 10 | N | 10 | N | 100 | N | N |
| tfb1-phd | 10 | - | 10 | - | 100 | - | N |
Parent strains for rad2-pb1, rad2-pb2, rad4-pb and tfb1-phd mutations are indicated at the top. The fold increases of UVC sensitivities are at 150 J/m2 (for WT and tfb1-phd backgrounds), 40 J/m2 (for rad7Δ and rad7Δ tfb1-phd backgrounds), 15 J/m2 (for rad7Δ rad26Δ and rad7Δ rad26Δ tfb1-phd backgrounds). N, no effect on UV sensitivity.
The tfb1-phd or rad4-pb mutations increased the UVC sensitivity of otherwise wild-type and rad7Δ cells ∼10 fold (Figure 4A and B; Table 1). Remarkably, these mutations increased the UVC sensitivity of rad7Δ rad26Δ cells ∼100 fold (Figure 4C; Table 1), while showing no significant impact on the UVC sensitivity of rad14Δ cells (Figure 4E; Table 1). Double tfb1-phd and rad4-pb mutations did not significantly enhance UVC sensitivity compared to single tfb1-phd or rad4-pb mutation (Figure 4A and B; Table 1), suggesting the two mutations are epistatic.
Next, we directly determined the roles of Tfb1 PHD, Rad4 PB, Rad2 PB1 and Rad2 PB2 in NER using the LAF-Seq method we developed (Supplementary Figure S2) (48). To examine TCR, we chose to use the GGR-defective rad7Δ cells to map repair of CPDs in the TS of AGP2, RPB2 and YEF3 genes, which are transcribed at low, moderate and high speeds, respectively (39). Rapid repair of CPDs was evident immediately downstream of the major transcription start site (TSS) in the TS of AGP2, RPB2 and YEF3 genes (Supplementary Figures S3-S5, panel A), indicating efficient TCR. tfb1-phd and rad4-pb cells showed dramatic slowdown of TCR (Figure 5A and B; Supplementary Figures S3–S5, compare B and C with A; Table 2), indicating Tfb1 PHD and Rad4 PB play significant roles in facilitating TCR. rad2-pb1 and rad2-pb2 cells also showed mild slowdown of TCR (Figure 5C-E; Supplementary Figures S3–S5, compare panels D-F with A; Table 2), although these Rad2 mutants are not noticeably UVC sensitive (Figure 4A–C). Overexpression of Tfb1 (O-Tfb1) via CuSO4-induction of the CUP1 promoter-driven Tfb1 did not significantly enhance TCR in rad7Δ rad2-pb1 cells (Figure 5, compare C and D), suggesting that the reduced level of Tfb1 in these cells (Figure 2E) does not have a dramatic impact on TCR. Moreover, the TCR defect in tfb1-phd cells was not aggravated by the additional rad4-pb, rad2-pb1 or rad2-pb2 mutation (Figure 5F-H; Supplementary Figures S3-S5, compare panels G-I with B; Table 2). These results suggest that Rad4 PB, and to a lesser extent Rad2 PB1 and Rad2 PB2, facilitate TCR via a mechanism involving Tfb1 PHD.
Figure 5.
Effects of tfb1-phd, rad2-pb1, rad2-pb2 and rad4-pb mutations on overall TCR. (A-H) Means of percent CPDs remaining at all CPD sites downstream of the major TSS in the TS of AGP2, RPB2 and YEF3 genes in rad7Δ cells with or without the indicated additional mutations. ** and * indicate P values <0.01 and 0.05, respectively (paired Student's t-test).
Table 2.
Percent TCR slowdown caused by rad2-pb1, rad2-pb2, rad4-pb and tfb1-phd mutations
| Parent strain | ||||
|---|---|---|---|---|
| rad7Δ | rad7Δ tfb1-phd | rad7Δ rad26Δ | rad7Δ rad26Δ tfb1-phd | |
| rad2-pb1 | 14 ± 4 | 3 ± 2 | 20 ± 6 | 1 ± 3 |
| rad2-pb2 | 19 ± 7 | 3 ± 0 | 29 ± 11 | 0 ± 4 |
| rad4-pb | 50 ± 6 | -1 ± 2 | 37 ± 6 | 1 ± 2 |
| tfb1-phd | 54 ± 5 | - | 42 ± 2 | - |
Parent strains for rad2-pb1, rad2-pb2, rad4-pb and tfb1-phd mutations are indicated at the top. The percent TCR slowdowns (mean ± standard deviation) were determined by averaging the differences in percent CPDs remaining between the mutant and its parent strain in the TS of AGP2, RPB2 and YEF3 genes after 1 h of repair.
To determine the roles of Tfb1 PHD, Rad4 PB, Rad2 PB1 and Rad2 PB2 in Rad26-independent TCR, we utilized rad7Δ rad26Δ cells. TCR significantly slowed down in the gene regions over 50 nucleotides downstream of the TSS in these cells (Supplementary Figures S6–S8, panel A; Table 2). This was expected as it has been known that, in the absence of Rad26, TCR is largely repressed in the region over 50 nucleotides downstream of the TSS (49). TCR in the YEF3 gene was not as slow as that in the AGP2 or RPB2 genes in rad7Δ rad26Δ cells (Figure 6A, compare blue symbols), agreeing with previous findings that TCR is less repressed in the absence Rad26 in rapidly transcribed genes (9,50).
Figure 6.
Effects of tfb1-phd, rad2-pb1, rad2-pb2 and rad4-pb mutations on Rad26-independent TCR. (A-F) Means of percent CPDs remaining at all CPD sites 50 nucleotides downstream of the major TSS in the TS of AGP2, RPB2 and YEF3 genes in rad7Δ rad26Δ cells with or without the indicated additional mutations. ** and * indicate P values <0.01 and 0.05, respectively (paired Student's t-test).
tfb1-phd and rad4-pb cells showed significant slowdown of Rad26-independent TCR (Figure 6A and B; Supplementary Figures S6–S8, compare B and C with A; Table 2). Rad2-pb1 and rad2-pb2 cells also exhibited this slowdown, albeit to a lesser extent (Figure 6C–E; Supplementary Figures S6-S8, compare D–F with A; Table 2). Notably, the effects of the rad2-pb1 and rad2-pb2 mutation on the slowdown of TCR in rad7Δ rad26Δ cells were somewhat more significant compared to their effects on the overall TCR in rad7Δ cells (compare Figure 6C–E with Figure 5C–E; Table 2), indicating that Rad2 PB1 and Rad2 PB2 play more significant roles in promoting Rad26-independent TCR. Also, the overexpression of Tfb1 (O-Tfb1) via CuSO4-induction of the CUP1 promoter-driven Tfb1 did not significantly enhance TCR in rad7Δ rad26Δ rad2-pb1 cells (Figure 6, compare C and D; Supplementary Figures S6-S8, compare D and E). This indicates that the decreased level of Tfb1 in the absence of Rad2-PB1 (Figure 2E) has no significant effect on Rad26-independent TCR.
Taken together, our results indicate that Tfb1 PHD, Rad4 PB and, to lesser extents, Rad2 PB1 and Rad2 PB2 play significant roles in TCR. While Rad4 PB and Rad2 PB1 may facilitate TCR via interactions with Tfb1 PHD, Rad2 PB2 may facilitate TCR by restraining the basal interaction between Rad2 PB1 and Tfb1 PHD.
Rad4 PB and, to lesser extents, Rad2 PB1 and Rad2 PB2 facilitate GGR via a mechanism involving Tfb1 PHD
Next, we investigated the roles of Tfb1 PHD, Rad4 PB, Rad2 PB1 and Rad2 PB2 in GGR. We chose to analyze the repair of CPDs in the NTS of AGP2, RPB2 and YEF3 genes. Consistent with previous findings (e.g. (51,52)), GGR in wild type cells was affected by nucleosome positioning, being slow in the nucleosome core regions and fast in the nucleosome linker regions (Supplementary Figures S9–S11, panel A).
tfb1-phd and rad4-pb cells showed significant slowdown of GGR (Figure 7A and B; Supplementary Figures S9-S11, compare B and C with A; Table 3). Rad2-pb1 and rad2-pb2 cells also exhibited slowdown of GGR, albeit to a lesser extent (Figure 7C–E; Supplementary Figures S9–S11, compare D–F with A; Table 3). Overexpressing Tfb1 (O-Tfb1) via CuSO4-induction of the CUP1 promoter-driven Tfb1 did not significantly enhance GGR in rad2-pb1 cells (Figure 7, compare C and D; Supplementary Figures S9-S11, compare D and E), suggesting that the reduced level of Tfb1 resulting from rad2-pb1 (Figure 2E) does not have a substantial impact on GGR. The GGR defect in tfb1-phd cells was not exacerbated by additional rad4-pb, rad2-pb1 or rad2-pb2 mutation (Figure 7F–H; Supplementary Figures S9-S11, compare G–I with B; Table 3), suggesting that Rad4 PB, Rad2 PB1 and Rad2 PB2 facilitate GGR via a mechanism involving Tfb1 PHD.
Figure 7.
Effects of tfb1-phd, rad2-pb1, rad2-pb2 and rad4-pb mutations on GGR. (A–H) Means of percent CPDs remaining at all CPD sites in the NTS of AGP2, RPB2 and YEF3 genes in cells with or without the indicated additional mutations. ** and * indicate P values <0.01 and 0.05, respectively (paired Student's t-test).
Table 3.
Percent GGR slowdown caused by rad2-pb1, rad2-pb2, rad4-pb and tfb1-phd mutations
| Parent strain | ||
|---|---|---|
| WT | tfb1-phd | |
| rad2-pb1 | 37 ± 3 | –4 ± 1 |
| rad2-pb2 | 28 ± 4 | –2 ± 1 |
| rad4-pb | 56 ± 7 | 1 ± 2 |
| tfb1-phd | 63 ± 7 | - |
Parent strains for rad2-pb1, rad2-pb2, rad4-pb and tfb1-phd mutations are indicated at the top. The percent GGR slowdowns (mean ± standard deviation) were determined by averaging the differences in percent CPDs remaining between the mutant and its parent strain in the NTS of AGP2, RPB2 and YEF3 genes after 4 hours of repair incubation.
Taken together, our results indicate that Tfb1 PHD, Rad4 PB and, to lesser extents, Rad2 PB1 and Rad2 PB2 also play significant roles in GGR. While Rad4 PB and Rad2 PB1 may facilitate GGR via interactions with Tfb1 PHD, Rad2 PB2 may facilitate GGR by restraining the basal interaction between Rad2 PB1 and Tfb1 PHD.
Discussion
Rad4 and Tfb1 may function within one stable module for damage recognition
Structural studies have demonstrated that Rad4/XPC, in complex with Rad23 and Rad33/CETN2, recognizes damaged DNA by binding to the undamaged strand and flips the damaged bases out of the double helix (25–28). In the structures containing Rad4/XPC-Rad23-Rad33/CETN2, TFIIH and damaged DNA, Rad4/XPC binds TFIIH through two interfaces: one between Rad4/XPC PB and Tfb1/p62 PHD and the other between the C-terminus of Rad4/XPC and SSL2/XPB (27,28). These structures are in line with a model where damaged DNA is handed off from Rad4/XPC to TFIIH. The handoff model would predict a transient interaction between Rad4 PB and Tfb1 PHD. The association between Rad4 and Tfb1 in cells lacking NER activities was undocumented until our finding that Rad4 PB constitutively interacts with Tfb1 PHD. Importantly, the interaction is unaffected by any other NER factors tested and is not diminished following UVC-augmented interaction between Rad2 and Tfb1 PHD. Our findings support the scenario where Rad4 and Tfb1 function within one stable module, which may not contain all other core TFIIH subunits. In this stable module, Rad4 and Tfb1 may jointly recognize damaged DNA and then dissociate together after handing it off to downstream NER factors. During GGR, the damage recognition by Rad4-Tfb1 may be facilitated by GGR-specific proteins, such as Rad7, Rad16 and Elc1 (Figure 8A). During TCR, the damage recognition by Rad4-Tfb1 may be facilitated by RNAPII and TCR-specific proteins, such as Rad26, Sen1 and Elf1 (Figure 8B). The Tfb1 molecule in this stable module is likely different from the one in TFIIH recruited later in the NER process. Subcomplexes of TFIIH, such as XPB-p52 and XPD-p44, can function independently and distinctively in damaged DNA opening during NER (53). Strikingly, it was demonstrated recently that a complex comprising just 2 TFIIH subunits, p44 (ortholog of yeast Ssl1) and p62, can bind DNA and diffuse along it to sense damage in single-stranded regions (54). In principle, the damaged bases flipped out by Rad4/XPC could be more efficiently sensed by p44-p62 (or Ssl1-Tfb1 in yeast) (Figure 8C). As Rad4 constitutively interacts with Tfb1 PHD, it is likely a damage recognition module containing Rad4/XPC, Tfb1/p62 and Ssl1/p44 exist in the cell. It would be very interesting to test this hypothesis.
Figure 8.
A model of how Rad2 and Rad4 interplay with Tfb1 in GGR and TCR. (A) Facilitated by GGR factors (e.g. Rad7, Rad16 and Elc1), the Rad4-Tfb1 complex, potentially including a subset of TFIIH subunits (e.g. Ssl1), scans the genome to detect damage. (B) Facilitated by RNAPII and TCR factors (e.g. Rad26, Sen1 and Elf1), the Rad4-Tfb1 complex detects damage in the TS of transcribed genes. (C) Upon detection of damage, Rad4 flips the damaged base out of the double helix, setting the stage for more efficient sensing of the damage by Tfb1 (potentially along with Ssl1), and for the recruitment of the core TFIIH complex and other NER factors. (D) When NER is inactive, Rad2 sub-stoichiometrically complexes with TFIIH engaged in transcription preinitiation, where Rad2 PB1 protects Tfb1 from degradation and interacts with Tfb1 PHD at a basal level. Through its PB2, Rad2 also forms a complex with an as-yet-unknown factor (indicated with ‘?’), which sequesters Rad2 away from TFIIH engaged in transcription preinitiation, thereby weakening the protection of Tfb1 from degradation by Rad2 PB1 and enabling rapid relocation of Rad2 and TFIIH to the sites of damage upon NER activation. (E) Assembly of the NER complex, where Rad2 stoichiometrically interacts with TFIIH, at least in part through the interaction between Rad2 PB1 and Tfb1 PHD.
The interaction between Rad2 PB1 and Tfb1 PHD during NER
Rad2 is known to form a sub-stoichiometric complex with TFIIH in yeast cells unexposed to DNA-damaging agents (20). Both TFIIH and Rad2 have significant roles in transcription initiation, in addition to their essential functions in NER (55). The basal interaction between Rad2 and Tfb1 PHD, observed in cells unexposed to UVC (Figure 2), likely occurs within Rad2-TFIIH complexes engaged in transcription preinitiation (Figure 8D). This is supported by our observations that the basal interaction occurs in cells lacking NER activities and is unaffected by any other NER factors we tested. Conversely, the augmented interaction between Rad2 and Tfb1 PHD following UVC irradiation likely reflects ongoing NER (Figure 8E), as the interaction is abolished by eliminating the upstream NER factors and it disappears after NER is completed. Rad2 is likely recruited to the NER complex by TFIIH, or a subcomplex of TFIIH. The interaction between Rad2 PB1 and Tfb1 PHD may be important for the recruitment and/or for stabilizing the incision complex.
Similar to its yeast ortholog Rad2, mammalian XPG forms a complex with TFIIH (56,57). Strikingly, it was demonstrated recently that XPG binding to the 7-subunit core TFIIH dramatically stimulates unwinding of double stranded DNA by the core TFIIH and 3′ incision of damaged DNA by XPG (58). The domains in XPG essential for its interaction with TFIIH have been found to be in the unstructured spacer region between the N and I domains (56) and in the C-terminal region (residues 926–1185) (57). Interestingly, XPG also interacts with the p62 PHD (59), although the exact segment(s) of XPG involved in this interaction remains unknown. Notably, the spacer region is not conserved between the yeast Rad2 and human XPG (Figure 1C). The PHD-binding motif, F/W-E-D/E-V, present in Rad2 PB1, Rad2 PB2, Rad4 PB and XPC PB (34–36), does not exist in mammalian XPG. It would be of interest to determine whether human XPG possesses segments similar to Rad2 PB1 and/or Rad2 PB2 and, if so, whether these segments facilitate TCR and/or GGR through interacting with p62 PHD in human cells.
The role of Rad2 PB2 in NER
How Rad2 PB2 weakens the protection of Tfb1 from degradation by Rad2 PB1 and constrains the basal interaction between Rad2 PB1 and Tfb1 PHD remains to be elucidated. Also, how this constraint facilitates TCR and GGR remains to be uncovered. Rad2 PB1 and Rad2 PB2 are situated within the intrinsically unstructured spacer region located between the structured N and I domains of Rad2 (Figure 1C). Intrinsically unstructured regions in proteins typically participate in binding with various partners, facilitating rapid transitions between different functions (60). As Rad2 PB2 does not directly interact with Tfb1 PHD in the cell (Figure 2H), it may constrain the basal interaction between Rad2 PB1 and Tfb1 PHD indirectly. In addition to being present in TFIIH complexes engaged in transcription preinitiation, Rad2 may also form a complex with an as-yet-unknown factor through its PB2. This unknown factor could sequester Rad2 away from TFIIH engaged in transcription preinitiation, thereby weakening the protection of Tfb1 from degradation by Rad2 PB1 and enabling rapid relocation of Rad2 and TFIIH to the sites of damage upon NER activation (Figure 8D and E).
In summary, we demonstrated the direct interaction between Rad2 PB1 and Rad4 PB with Tfb1 PHD in the cell, elucidating their pivotal role in TCR and GGR. Remarkably, our study unveiled the existence of a constitutive Rad4-Tfb1 complex and an unconventional mechanism of NER regulation by Rad2 PB2. These findings deepen our understanding of the molecular mechanisms of NER, and open new avenues for further exploration in this area.
Supplementary Material
Contributor Information
Wenzhi Gong, Department of Comparative Biomedical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803, USA.
Hannah Holmberg, Department of Comparative Biomedical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803, USA.
Cheng Lu, Department of Comparative Biomedical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803, USA.
Michelle Huang, Department of Comparative Biomedical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803, USA.
Shisheng Li, Department of Comparative Biomedical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803, USA.
Data availability
The raw data have been deposited in the Sequence Read Archive (SRA) of the National Center for Biotechnology Information (NCBI) under accession number PRJNA1026133.
Supplementary data
Supplementary Data are available at NAR Online.
Funding
National Science Foundation [MCB-2102072 to S.L.]; National Institute of Health [ES033789 to S.L.]. Funding for open access charge: National Science Foundation.
Conflict of interest statement. None declared.
References
- 1. D'Souza A., Blee A.M., Chazin W.J. Mechanism of action of nucleotide excision repair machinery. Biochem. Soc. Trans. 2022; 50:375–386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Kuper J., Kisker C. At the core of nucleotide excision repair. Curr. Opin. Struct. Biol. 2023; 80:102605. [DOI] [PubMed] [Google Scholar]
- 3. Vaughn C.M., Sancar A. DNA Damage, DNA Repair and Disease. 2020; 2:The Royal Society of Chemistry. [Google Scholar]
- 4. Guzder S.N., Sung P., Prakash L., Prakash S. Yeast Rad7-Rad16 complex, specific for the nucleotide excision repair of the nontranscribed DNA strand, is an ATP-dependent DNA damage sensor. J. Biol. Chem. 1997; 272:21665–21668. [DOI] [PubMed] [Google Scholar]
- 5. Verhage R., Zeeman A.M., de Groot N., Gleig F., Bang D.D., van de Putte P., Brouwer J. The RAD7 and RAD16 genes, which are essential for pyrimidine dimer removal from the silent mating type loci, are also required for repair of the nontranscribed strand of an active gene in Saccharomyces cerevisiae. Mol. Cell. Biol. 1994; 14:6135–6142. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Lejeune D., Chen X., Ruggiero C., Berryhill S., Ding B., Li S. Yeast Elc1 plays an important role in global genomic repair but not in transcription coupled repair. DNA Repair (Amst.). 2009; 8:40–50. [DOI] [PubMed] [Google Scholar]
- 7. Selby C.P., Lindsey-Boltz L.A., Li W., Sancar A. Molecular mechanisms of transcription-coupled repair. Annu. Rev. Biochem. 2023; 92:115–144. [DOI] [PubMed] [Google Scholar]
- 8. van Gool A.J., Verhage R., Swagemakers S.M., van de Putte P., Brouwer J., Troelstra C., Bootsma D., Hoeijmakers J.H. RAD26, the functional S. cerevisiae homolog of the Cockayne syndrome B gene ERCC6. EMBO J. 1994; 13:5361–5369. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Li S., Smerdon M.J. Rpb4 and Rpb9 mediate subpathways of transcription-coupled DNA repair in Saccharomyces cerevisiae. EMBO J. 2002; 21:5921–5929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Li W., Selvam K., Rahman S.A., Li S. Sen1, the yeast homolog of human senataxin, plays a more direct role than Rad26 in transcription coupled DNA repair. Nucleic Acids Res. 2016; 44:6794–6802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Geijer M.E., Zhou D., Selvam K., Steurer B., Mukherjee C., Evers B., Cugusi S., van Toorn M., van der Woude M., Janssens R.C. et al. Elongation factor ELOF1 drives transcription-coupled repair and prevents genome instability. Nat. Cell Biol. 2021; 23:608–619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. van der Weegen Y., de Lint K., van den Heuvel D., Nakazawa Y., Mevissen T.E.T., van Schie J.J.M., San Martin Alonso M., Boer D.E.C., Gonzalez-Prieto R., Narayanan I.V. et al. ELOF1 is a transcription-coupled DNA repair factor that directs RNA polymerase II ubiquitylation. Nat. Cell Biol. 2021; 23:595–607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Hoag A., Duan M., Mao P. The role of Transcription Factor IIH complex in nucleotide excision repair. Environ. Mol. Mutagen. 2023; 10.1002/em.22568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Rimel J.K., Taatjes D.J. The essential and multifunctional TFIIH complex. Protein Sci. 2018; 27:1018–1037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Theil A.F., Hackes D., Lans H. TFIIH central activity in nucleotide excision repair to prevent disease. DNA Repair (Amst.). 2023; 132:103568. [DOI] [PubMed] [Google Scholar]
- 16. Guzder S.N., Habraken Y., Sung P., Prakash L., Prakash S. Reconstitution of yeast nucleotide excision repair with purified rad proteins, replication protein A, and transcription factor TFIIH. J. Biol. Chem. 1995; 270:12973–12976. [DOI] [PubMed] [Google Scholar]
- 17. Coin F., Oksenych V., Mocquet V., Groh S., Blattner C., Egly J.M. Nucleotide excision repair driven by the dissociation of CAK from TFIIH. Mol. Cell. 2008; 31:9–20. [DOI] [PubMed] [Google Scholar]
- 18. Scheffzek K., Welti S. Pleckstrin homology (PH) like domains - versatile modules in protein-protein interaction platforms. FEBS Lett. 2012; 586:2662–2673. [DOI] [PubMed] [Google Scholar]
- 19. Muniesa-Vargas A., Theil A.F., Ribeiro-Silva C., Vermeulen W., Lans H. XPG: a multitasking genome caretaker. Cell. Mol. Life Sci. 2022; 79:166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Habraken Y., Sung P., Prakash S., Prakash L. Transcription factor TFIIH and DNA endonuclease Rad2 constitute yeast nucleotide excision repair factor 3: implications for nucleotide excision repair and Cockayne syndrome. Proc. Natl. Acad. Sci. U.S.A. 1996; 93:10718–10722. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Mu D., Park C.H., Matsunaga T., Hsu D.S., Reardon J.T., Sancar A. Reconstitution of human DNA repair excision nuclease in a highly defined system. J. Biol. Chem. 1995; 270:2415–2418. [DOI] [PubMed] [Google Scholar]
- 22. Mietus M., Nowak E., Jaciuk M., Kustosz P., Studnicka J., Nowotny M. Crystal structure of the catalytic core of Rad2: insights into the mechanism of substrate binding. Nucleic Acids Res. 2014; 42:10762–10775. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Scherly D., Nouspikel T., Corlet J., Ucla C., Bairoch A., Clarkson S.G. Complementation of the DNA repair defect in xeroderma pigmentosum group G cells by a human cDNA related to yeast RAD2. Nature. 1993; 363:182–185. [DOI] [PubMed] [Google Scholar]
- 24. Tsutakawa S.E., Sarker A.H., Ng C., Arvai A.S., Shin D.S., Shih B., Jiang S., Thwin A.C., Tsai M.S., Willcox A. et al. Human XPG nuclease structure, assembly, and activities with insights for neurodegeneration and cancer from pathogenic mutations. Proc. Natl. Acad. Sci. U.S.A. 2020; 117:14127–14138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Min J.H., Pavletich N.P. Recognition of DNA damage by the Rad4 nucleotide excision repair protein. Nature. 2007; 449:570–575. [DOI] [PubMed] [Google Scholar]
- 26. Paul D., Mu H., Zhao H., Ouerfelli O., Jeffrey P.D., Broyde S., Min J.H. Structure and mechanism of pyrimidine-pyrimidone (6-4) photoproduct recognition by the Rad4/XPC nucleotide excision repair complex. Nucleic Acids Res. 2019; 47:6015–6028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. van Eeuwen T., Shim Y., Kim H.J., Zhao T., Basu S., Garcia B.A., Kaplan C.D., Min J.H., Murakami K. Cryo-EM structure of TFIIH/Rad4-Rad23-Rad33 in damaged DNA opening in nucleotide excision repair. Nat. Commun. 2021; 12:3338. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Kim J., Li C.L., Chen X., Cui Y., Golebiowski F.M., Wang H., Hanaoka F., Sugasawa K., Yang W. Lesion recognition by XPC, TFIIH and XPA in DNA excision repair. Nature. 2023; 617:170–175. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Bardwell A.J., Bardwell L., Iyer N., Svejstrup J.Q., Feaver W.J., Kornberg R.D., Friedberg E.C. Yeast nucleotide excision repair proteins Rad2 and Rad4 interact with RNA polymerase II basal transcription factor b (TFIIH). Mol. Cell. Biol. 1994; 14:3569–3576. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Drapkin R., Reardon J.T., Ansari A., Huang J.C., Zawel L., Ahn K., Sancar A., Reinberg D Dual role of TFIIH in DNA excision repair and in transcription by RNA polymerase II. Nature. 1994; 368:769–772. [DOI] [PubMed] [Google Scholar]
- 31. Wakasugi M., Sancar A. Order of assembly of human DNA repair excision nuclease. J. Biol. Chem. 1999; 274:18759–18768. [DOI] [PubMed] [Google Scholar]
- 32. Prakash S., Prakash L. Nucleotide excision repair in yeast. Mutat. Res. 2000; 451:13–24. [DOI] [PubMed] [Google Scholar]
- 33. Tatum D., Li S.. Storici F. DNA Repair - On the Pathways to Fixing DNA Damage and Errors. 2011; Rijeka, Croatia: InTech Open Access Publisher; 97–122. [Google Scholar]
- 34. Lafrance-Vanasse J., Arseneault G., Cappadocia L., Chen H.T., Legault P., Omichinski J.G. Structural and functional characterization of interactions involving the Tfb1 subunit of TFIIH and the NER factor Rad2. Nucleic Acids Res. 2012; 40:5739–5750. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Lafrance-Vanasse J., Arseneault G., Cappadocia L., Legault P., Omichinski J.G. Structural and functional evidence that Rad4 competes with Rad2 for binding to the Tfb1 subunit of TFIIH in NER. Nucleic Acids Res. 2013; 41:2736–2745. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Okuda M., Kinoshita M., Kakumu E., Sugasawa K., Nishimura Y. Structural insight into the mechanism of TFIIH recognition by the acidic string of the nucleotide excision repair factor XPC. Structure. 2015; 23:1827–1837. [DOI] [PubMed] [Google Scholar]
- 37. Shedlovskiy D., Shcherbik N., Pestov D.G. One-step hot formamide extraction of RNA from Saccharomyces cerevisiae. RNA Biol. 2017; 14:1722–1726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001; 25:402–408. [DOI] [PubMed] [Google Scholar]
- 39. Pelechano V., Chavez S., Perez-Ortin J.E. A complete set of nascent transcription rates for yeast genes. PLoS One. 2010; 5:e15442. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Li M., Ko T., Li S. High-resolution digital mapping of N-methylpurines in human cells reveals modulation of their induction and repair by nearest-neighbor nucleotides. J. Biol. Chem. 2015; 290:23148–23161. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Li H., Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009; 25:1754–1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Chen H.T., Warfield L., Hahn S. The positions of TFIIF and TFIIE in the RNA polymerase II transcription preinitiation complex. Nat. Struct. Mol. Biol. 2007; 14:696–703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Chin J.W., Cropp T.A., Anderson J.C., Mukherji M., Zhang Z., Schultz P.G. An expanded eukaryotic genetic code. Science. 2003; 301:964–967. [DOI] [PubMed] [Google Scholar]
- 44. Dorman G., Prestwich G.D. Benzophenone photophores in biochemistry. Biochemistry. 1994; 33:5661–5673. [DOI] [PubMed] [Google Scholar]
- 45. Etcheverry T. Induced expression using yeast copper metallothionein promoter. Methods Enzymol. 1990; 185:319–329. [DOI] [PubMed] [Google Scholar]
- 46. Li W., Giles C., Li S. Insights into how Spt5 functions in transcription elongation and repressing transcription coupled DNA repair. Nucleic Acids Res. 2014; 42:7069–7083. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Silver H.R., Nissley J.A., Reed S.H., Hou Y.M., Johnson E.S. A role for SUMO in nucleotide excision repair. DNA Repair (Amst.). 2011; 10:1243–1251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Gong W., Li S. Rpb7 represses transcription-coupled nucleotide excision repair. J. Biol. Chem. 2023; 299:104969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Li S. Transcription coupled nucleotide excision repair in the yeast saccharomyces cerevisiae: the ambiguous role of Rad26. DNA Repair (Amst.). 2015; 36:43–48. [DOI] [PubMed] [Google Scholar]
- 50. Duan M., Selvam K., Wyrick J.J., Mao P. Genome-wide role of Rad26 in promoting transcription-coupled nucleotide excision repair in yeast chromatin. Proc. Natl. Acad. Sci. U.S.A. 2020; 117:18608–18616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Li S., Smerdon M.J. Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes. J. Biol. Chem. 2004; 279:14418–14426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Mao P., Smerdon M.J., Roberts S.A., Wyrick J.J. Asymmetric repair of UV damage in nucleosomes imposes a DNA strand polarity on somatic mutations in skin cancer. Genome Res. 2020; 30:12–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Coin F., Oksenych V., Egly J.M. Distinct roles for the XPB/p52 and XPD/p44 subcomplexes of TFIIH in damaged DNA opening during nucleotide excision repair. Mol. Cell. 2007; 26:245–256. [DOI] [PubMed] [Google Scholar]
- 54. Barnett J.T., Kuper J., Koelmel W., Kisker C., Kad N.M. The TFIIH subunits p44/p62 act as a damage sensor during nucleotide excision repair. Nucleic Acids Res. 2020; 48:12689–12696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Lee S.K., Yu S.L., Prakash L., Prakash S. Requirement of yeast RAD2, a homolog of human XPG gene, for efficient RNA polymerase II transcription. Implications for Cockayne syndrome. Cell. 2002; 109:823–834. [DOI] [PubMed] [Google Scholar]
- 56. Dunand-Sauthier I., Hohl M., Thorel F., Jaquier-Gubler P., Clarkson S.G., Scharer O.D. The spacer region of XPG mediates recruitment to nucleotide excision repair complexes and determines substrate specificity. J. Biol. Chem. 2005; 280:7030–7037. [DOI] [PubMed] [Google Scholar]
- 57. Ito S., Kuraoka I., Chymkowitch P., Compe E., Takedachi A., Ishigami C., Coin F., Egly J.M., Tanaka K. XPG stabilizes TFIIH, allowing transactivation of nuclear receptors: implications for Cockayne syndrome in XP-G/CS patients. Mol. Cell. 2007; 26:231–243. [DOI] [PubMed] [Google Scholar]
- 58. Bralic A., Tehseen M., Sobhy M.A., Tsai C.L., Alhudhali L., Yi G., Yu J., Yan C., Ivanov I., Tsutakawa S.E. et al. A scanning-to-incision switch in TFIIH-XPG induced by DNA damage licenses nucleotide excision repair. Nucleic Acids Res. 2023; 51:1019–1033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Gervais V., Lamour V., Jawhari A., Frindel F., Wasielewski E., Dubaele S., Egly J.M., Thierry J.C., Kieffer B., Poterszman A. TFIIH contains a PH domain involved in DNA nucleotide excision repair. Nat. Struct. Mol. Biol. 2004; 11:616–622. [DOI] [PubMed] [Google Scholar]
- 60. Dyson H.J., Wright P.E. Intrinsically unstructured proteins and their functions. Nat. Rev. Mol. Cell Biol. 2005; 6:197–208. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The raw data have been deposited in the Sequence Read Archive (SRA) of the National Center for Biotechnology Information (NCBI) under accession number PRJNA1026133.