TABLE 2.
Egg passage during which a new sequence was inserted into the NA stalka
| Assay | Egg passage number
|
|||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | |
| PCR with: | ||||||||||
| NP primer | − | − | − | + | + | + | + | + | + | + |
| NA primer (positive control) | + | + | + | + | + | + | + | + | + | + |
| Hemagglutination of allantoic fluid | − | − | − | − | − | − | − | − | − | + |
Viral RNA was isolated from each egg passage of the 21EA strain and was used as a template for cDNA synthesis. The NP-specific reverse primer (primer NPinsert), which corresponded to the inserted NP nucleotide sequences (5′TACACGAGTGACTACGTCCC3′ [see Fig. 1A, italic boldface sequences]), was combined with a specific NA forward primer (N1W26) (5′CCATTGGGTCAATCTGTATGG3′) in PCRs with the Pfu polymerase. A specific NA reverse primer (N1R836), corresponding to the NA-coding nucleotides 836 to 817 (5′TCACTTTGCCGGTATCAGGG3′), was included instead of primer NPinsert as a positive control. After 20 cycles, PCR products were separated on 1% agarose gels. Viral hemagglutination activity for each passage was determined by using tRBCs. All passages produced a 0.8-kb band in the positive control reaction.