Skip to main content
PLOS One logoLink to PLOS One
. 2024 Jun 27;19(6):e0306194. doi: 10.1371/journal.pone.0306194

Molecular characterization of HAMP rs10421768 gene and phenotypic expression of hepcidin; a case-control study among sickle cell anaemia patients in Ghana

Samuel Kwasi Appiah 1,2,*, Charles Nkansah 1,2, Gabriel Abbam 2, Felix Osei-Boakye 3, Kofi Mensah 1,2, Simon Bannison Bani 4, Solomon Chemogo 5, Lydia Sarpong 4, Takyi Godfred Addae 4, Daniel Boamah Sefa 4, Richard Adu Croffien 4, Larry Adom 4, Rekhiatu Oboirien Abdul Rauf 4, Farrid Boadu 6, Godfred Appiah Amoah 4, Ejike Felix Chukwurah 1
Editor: Kostas Pantopoulos7
PMCID: PMC11210777  PMID: 38935685

Abstract

Background

The sporadic nature of blood transfusion therapy coupled with the alteration of HAMP genes may exacerbate the risk of iron burden in sickle cell anaemia (SCA) patients. The study determined the polymorphic distribution of the HAMP promoter gene rs10421768 and hepcidin levels in SCA patients.

Method

Sixty participants aged ≥12years [45 SCA patients and 15 controls (HbA)] were recruited from 15th March, 2023 to 20th July, 2023 for a case-control study at Methodist Hospital Wenchi, Ghana. Complete blood count and hepcidin levels assessment were done using haematology analyzer and ELISA, respectively. Genomic DNA was extracted using the Qiagen Kit, and HAMP gene rs10421768 (c.-582 A>G) was sequenced using the MassARRAY method. Data were analysed using SPSS version 26.0.

Results

The frequencies of the HAMP promoter rs10421768 genotypes AA, AG, and GG were 64.4%, 33.3%, and 2.2% in SCA patients, and 86.7%, 13.3%, and 0% in the controls, respectively. Serum hepcidin levels were significantly higher among controls than cases [204.0 (154.1–219.3) vs 150.2 (108.1–195.6)μg/L, p<0.010]. Participants with HAMP rs10421768 homozygous A genotype had higher serum levels of hepcidin compared with those in the wild genotypes (AG/GG) group [(188.7 (130.9–226.9) vs 136.8 (109.7–157.8)μg/L, p<0.016]. Disease severity and blood cell parameters were not associated with the HAMP variants (p>0.05).

Conclusion

The HAMP promoter rs10421768 AA genotype has the highest frequency of distribution and the GG genotype with the least distribution. Participants with HAMP rs10421768 G allele (c.-582A>G) had reduced levels of hepcidin. HAMP rs10421768 genotypes had no association with blood cell parameters and disease severity. The HAMP rs10421768 genotypes may influence serum levels of hepcidin. Further study is required to elucidate the potential effect of the G allele on hepcidin transcription.

Introduction

Sickle cell anaemia (SCA) is a genetic condition involving the homozygous inheritance of haemoglobin S (HbS) with a wide spectrum of disorders [1]. It occurs as a result of a transversion mutation in the second nucleotide at the sixth position (GAG to GTG) of the beta-globin gene resulting in abnormal HbS, which has poor solubility when deoxygenated [2]. Under hypoxic conditions, haemoglobin S polymerises to form tactoids with increased red blood cell adherence to the vascular endothelium [3]. Polymerised haemoglobin S is known to be central to vaso-occlusive crisis in SCA patients and leads to secondary processes such as inflammation, haemolysis, anaemia, vasculopathy and oxidative stress affecting many organs [4,5].

The burden in sub-Saharan Africa is predicted to be 64% of the global 400,000 children born with sickle cell disease (SCD) annually with an increased death rate [6]. In Ghana, almost 2% of newborn babies have SCD, with approximately 56% having sickle cell anaemia [7].

Hydroxyurea, penicillin V and folic acid therapy have been used as the primary management protocols for SCA [8]. Blood transfusion plays a significant role in the management of patients with SCA by reducing the proportion of HbS, to limit haemolysis and endothelial damage that results from high proportions of sickle polymer-containing red cells. The blood transfusion is usually used as supportive care for patients who experience severe form of the condition and are unresponsive to the first line of medication [9,10]. Although, transfusion may treat symptoms of anaemia or prevent complications of SCD-related vaso-occlusion such as stroke and severe acute chest syndrome, it is not without drawbacks. An average healthy person’s body has 4 g of iron, whereas people who receive multiple and frequent transfusions can accumulate 5 to 10 g annually. Long-term transfusion can lead to iron overload which may result in further complications including heart failure, growth retardation, endocrine problems and splenomegaly [11,12].

The body has no definite mechanism for eliminating excess iron; therefore, iron metabolism, storage and transport are tightly regulated through the hepcidin-ferroportin axis to avoid accumulation [13]. Hepcidin (major iron regulator) is a small antimicrobial peptide encoded by the hepcidin antimicrobial peptide (HAMP) gene located on chromosome 19q13. The gene is composed of three exons and has a length of 2637 bp. [14]. Research has shown that hepcidin mostly expressed by the hepatocytes is stimulated by iron overload (mediated through the bone morphogenetic protein (BMP) signalling pathway) and inflammation (by interleukin 6 (IL-6) and other cytokines through the Janus kinase/signal transducer and activator of transcription (JAK/STAT) signalling pathway), whereas erythropoietic activity, anaemia or hypoxia suppress its synthesis [15,16]. Hepcidin and ferroportin form a complex, which is absorbed by these cells, where it causes ferroportin to degrade, inhibiting iron outflow and, as a result, reducing intestinal iron absorption and bioavailability [17]. Similar to other genes, various mutations in the HAMP gene have been reported.

It has been postulated that, the presence of G allele (c.-582A>G) may downregulate hepcidin transcription, which promotes iron absorption [16]. Previous studies reported an association between the hepcidin promoter c.-582 A>G (rs10421768) polymorphism and iron overload in patients with β-thalassaemia major [18,19]. The different transcriptional activation that happens through E-boxes inside the gene’s promoter region may be the cause of the association between the HAMP gene variation and iron metabolism [19]. Another study found reduced levels of hepcidin in severely anaemic children with SCD, independent of inflammation or markers of erythropoiesis [20]. Again, a previousstudy reported that SCA patients with history of multiple blood transfusions had elevated serum hepcidin levels compared to the control groups, and the anaemia of chronic inflammation was found to be a contributing factor to the anaemia of SCD patients [21].

There is paucity of data regarding on the distribution of hepcidin (rs10421768) promoter gene polymorphisms and its expression among SCA patients in Ghana, hence, the need for this study. Findings from this study would provide the possible relationship between the HAMP polymorphic variants and hepcidin protein expression in SCA patients.

Materials and methods

Study site/design

This was a hospital-based case-control study conducted at Methodist Hospital, Wenchi, a Christian faith-based hospital in the Bono Region of Ghana. This study was carried out from 15th March, 2023 to 20th July, 2023. The hospital, which has 250 beds, serves as a referral hub for 20 public and private healthcare facilities in the Wenchi municipality and some parts of the Savannah region. The hospital offers specialist surgical services, including orthopaedic, urology, and general surgery. The digital address of the hospital is BW-0005-0306. The population of the municipality according to the 2021 population and housing census stands at 124,758, with 60,960 males and 63,798 females with majority of the inhabitants been farmers [22].

Ethical consideration

All procedures were carried out in accordance with the ethical standards of the Institutional Review Board (IRB) of the University for Development Studies, Ghana (UDS/RB/006/23).

Permission was sought from the management of Methodist Hospital, Wenchi. Participants 18years and above provided written informed consent. The consents of the study participants below 18 years were obtained from guardians or parents.

Study population

The study included 45 SCA patients, and 15 healthy (HbA) controls aged ≥12 years. The control participants were people without sickle cell disease who reside in the same geographical area and of similar ethic group as the cases. Participants below the age of 12 years with haemoglobin variants other than HbS and co-morbidities such as diabetes mellitus, hypertension, human immunodeficiency virus (HIV), and hepatitis were excluded from the study. Pregnant women, lactating mothers, and those who refused to provide consent were also excluded.

Sample size determination

The necessary sample size was obtained by employing the Kelsey’s formula:

NcasesKelsey=[r+1r]P(1P)(Zα2+Zβ)2(p1p2)2,andP=[p1+(rXp2)r+1]

NcasesKelsey is the required sample size for the sickle cell anaemia group.

r is the ratio of sickle cell anaemia group to the group without SCA, which is 2:1 in this study.

Zα2 represents the critical value of the normal dispersion at α/2 (for this study at confidence level of 95%, α is 0.05 and the critical value is 1.96).

Zβ represents the critical value of the normal distribution at β (this study used a power of 80%, β is 0.2 and the critical value is 0.84.

p1 represents the proportion of HAMP mutant allele in SCA group, 8.5% [23].

p2 is the proportion of HAMP mutant allele in the control group, 6.7% [23]

p1-p2 is the smallest difference in proportions that is clinically important.

The minimum number of participants with SCA patients required for this study was 30 with corresponding participants without SCA at 15.

However, this study employed 60 participants: 45 SCA patients and 15 controls (age-matched HbA healthy group).

Data collection techniques and tools

Demographic characteristics such as age and sex were obtained from the participants. The severity of the sickle cell disease was determined using a modified method as proposed by Hedo eta al. [24], based on the clinical presentation of the patients which included the number of blood transfusions received per year, number of vaso-occlusive crises per year, number of hospitalisations per year due to relapse or crisis that require medical attention, use of hydroxyurea, iron chelation therapy, presence of acute chest syndrome, osteomyelitis, renal failure, heart failure, avascular necrosis of the femoral hand, pneumonia, dehydration, anaemia, pigment gallstones and jaundice obtained from the clinical records. The total severity score was classified as mild SCA (Score <3), moderate SCA (Score >3 and ≤ 7) and severe SCA (Score > 7) with detailed description in previous study by Hedo et al. [24].

Categorization of blood cell transfusion was done as follows: multiple red cell transfusion (regular) when the subject received ≥ 3 units/year, rare transfusion when a client received <3 unit/year and nil transfusion when a patient received no transfusion per year.

Sample collection and processing

Five millilitres of venous blood samples from each patient were aseptically collected and divided into two tubes: 3 mL into ethylenediamintetraacetic acid (EDTA) and 2 mL into a gel tube. The EDTA sample was used for complete blood count estimation, sickling and Hb electrophoresis tests. Genomic DNA was extracted from whole blood using the spin protocol with commercial DNA extraction kit (Qiagen, Germany), and segments of DNA encompassing the HAMP rs10421768 (c.-582 A>G) promoter gene were sequenced (Inqaba BiotecTM West Africa Ltd, Ghana). The gel tube sample was allowed to clot and spun at 3500 rpm for five minutes. The resulting serum was transferred into Eppendorf tubes and stored at -20°C for hepcidin estimation using the enzyme-linked immunosorbent assay (ELISA) at University for Development Studies Laboratory.

Haematological and biochemical determinations

The EDTA whole blood samples were used for analysis of the complete blood count using an automated five-part haematology analyser (Sysmex XN-550, Japan).

Sickle slide test was done using sodium metabisulphite and haemoglobin variants determined using cellulose acetate electrophoresis method at an alkaline pH of 8.4.

Serum hepcidin levels were assayed by the sandwich ELISA method using commercially prepared ELISA kits (Biobase, China). Microtitter plate wells were coated with purified human hepcidin antibody forming a solid phase antibody. Patients/control sera were added to the wells, incubated and upon the addition of horseradish peroxidase (HRP) labeled antibody (conjugate), antibody-antigen-enzyme-labeled antibody complex was formed. After washing using WHYM201 microplate washer and the addition of TMB substrate solution, a blue coloured product was formed. Weak sulphuric acid solution was added to terminate the reaction and the optical density of the resulting colour change was measured using ELISA reader (Powean-Medical, China) at 450 nanometers.

DNA extraction

Genomic DNA was extracted from patients’ whole blood at the Kintampo Health Research Center using the QIAGEN kits (QIAGEN, Germany), according to the manufacturer’s instructions. In a 1.5 mL microcentrifuge tube, 200 μL of blood sample and 20 μL of protease K were combined. Two hundred (200) μL AL buffer was added, vortex for 15 seconds and incubated for 10 minutes at 56°C. Brief centrifugation was done at 8000 rpm to clear the drips from the lid’s interior. The sample was mixed thoroughly for 15 seconds, 200 μL of ethanol was added before brief centrifugation. The mixture was put into a QIAamp Mini spin column, centrifuged for 1 minute at 8000 rpm, 500 μL of AW 1 buffer was added, centrifuged for 1 minute and residue discarded. A 500 μL of AW2 buffer was subsequently added, centrifuged at 14000 rpm for 3 minutes to eliminate the residue. After dry centrifugation, 200 μL of AE buffer added, incubated for 1 minute at ambient temperature and centrifuged for 1 minute at 8000 rpm. The concentration of DNA (μg/μL) (OD 260 x 50 ng/μL) yielded from the extraction was evaluated using a NanoDrop spectrophotometer. The extracted DNA was stored at −70°C until analysis [25].

Identification of the HAMP gene polymorphisms

Genotyping was performed by real-time polymerase chain reaction (PCR) using the Agena MassARRAY method with iPLEX® PCR (Inqaba BiotecTM West Africa Ltd, Ghana).The SNP Genotyping assay consisted of an initial locus-specific PCR reaction, followed by a single-base extension using mass-modified dideoxynucleotide terminators of an oligonucleotide primer (Table 1), which annealed immediately upstream of the polymorphic site of interest. Using MALDI-TOF mass spectrometry, the distinct mass of the extended primer identifies the SNP allele as detailed in the technical manual [26]. The cluster plots for rs10421768 using the Agena MassARRAY System is shown in Fig 1.

Table 1. Primers used for the study.

HAMP rs10421768                  Nucleotides
rs10421768_W1_F ACGTTGGATGGTTTGAAGCTTTGGGCTACG
rs10421768_W1_R ACGTTGGATGTGGAAACCCATGGAGTTCG
rs10421768_W1_E TGTTCGTGTTCTATGAT

Fig 1. Cluster plots for rs10421768 output.

Fig 1

Statistical analysis

Statistical Package for the Social Sciences (SPSS) software, version 26.0 (Armonk, NY, USA) was used for the statistical analysis. Shapiro-Wilk and one-sample Kolmogorov-Smirnov tests were used to assess the distribution of the continuous data. Parametric data were presented as mean±standard deviation whilst non-parametric data were presented as median (25th-75th percentiles). Categorical data were appropriately compared using Pearson Chi-square or Fisher’s exact test. Bivariate continuous data were compared using independent sample T-test (for parametric data) or Mann-Whitney test (for non-parametric data). A p< 0.05 was considered statistically significant.

Results

Demographic and allele frequency of HAMP rs10421768 gene

Table 2 shows the demographic and allele frequency of the HAMP polymorphism rs10421768 of the study participants. The 60 participants included in the study consisted of 45 (75.0%) sickle cell anaemia patients, and 15 (25.0%) healthy individuals. Of the 60 participants, 34 (56.7%) were females while 26 (43.3%) were males, with a median age of 19.0 (16.0–22.0) years. The majority (42/70.0%) of the participants had the common genotype (AA), 17 (28.3%) expressed the heterozygote genotype (AG), and 1 (1.7%) had the rare genotype (GG). Among those with SCA, the majority 29(64.4%) showed the AA genotype, 15 (33.3%) showed the AG genotype and just 1(2.2%) of the participants showed the GG genotype. In the control group, the majority 13(86.7%) expressed the common genotype (AA), with a few of them 2(13.3%) expressing the heterozygous type (AG). No significant difference was observed in the distribution of rs10421768 variants with the participants’ type (p = 0.326) and sex (p = 0.064).

Table 2. Demographic and allele frequency of HAMP rs10421768 gene.

Variable Category HAMP rs10421768 SNP Total (%) P-value
AA (%)
42 (70.0)
AG (%)
17 (28.3)
GG (%)
1 (1.7)
Participants Controls (HbA) 13 (86.7) 2 (13.3) 0(0.0) 15 (25.0) 0.326
Cases (HbS) 29 (64.4) 15 (33.3) 1(2.2) 45 (75.0)
Sex Male 22 (84.6) 4 (15.4) 0 (0.0) 26 (43.3) 0.064
Female 20 (58.8) 13 (38.2) 1(2.9) 34 (56.7)
Age 19.0 (16.0–22.0)

HAMP: Hepcidin Antimicrobial Peptide; SNP: Single Nucleotide Polymorphism; SCA: Sickle cell anaemia; A: Adenine; G: Guanine; N: Number. Categorical data presented in frequencies with corresponding percentages in parenthesis. Pearson’s Chi-square and Fisher’s exact test were used to compare the association between two categorical data. Age was presented in median (25th-75th percentiles). P<0.05 was considered statistically significant.

Relationship between HAMP rs10421768 variants and disease severity

Table 3 displays the relationship between HAMP promoter gene variants and disease severity among the sickle cell anaemia patients. Cases with the mild form of the disease showed genotypic frequencies of AA, AG, and GG of 16 (64.0%), 8 (32.0%), and 1 (4.0%), respectively. Among cases with moderate disease, the allele frequencies of AA and AG were observed in 9 (56.2%) and 7 (43.8%) cases, respectively, while those with severe disease showed only the mutant genotype (AA) 4 (100%). There was no significant difference between HAMP promoter gene variants and disease severity.

Table 3. Relationship between HAMP rs10421768 variants and disease severity.


Disease Severity
HAMP Genotypes
Total
N (%)

P-value
AA (%) AG (%) GG (%)
Mild Disease 16 (64.0%) 8 (32.0%) 1 (4.0%) 25 (100.0%) 0.448
Moderately Disease 9 (56.2%) 7 (43.8%) 0 (0.0) 16 (100%)
Severe Disease 4 (100%) 0 (0.0) 0 (0.0) 4 (100%)
Total 29 (64.4%) 15 (33.3%) 1 (2.2%) 45(100%)

G: Guanine, A: Adenine, N: Number, Categorical information is displayed as frequencies with corresponding percentages in parentheses. Association was determined using Pearson’s Chi-square. Statistical significance was set at p<0.05.

Serum levels of hepcidin of study participants stratified by cases and controls

Fig 2 illustrates the hepcidin levels of the study participants stratified by cases and controls. The mean serum level of hepcidin among the study participants was 158.6 (127.8–214.8) μg/. Hepcidin levels were significantly higher among control subjects compared to their counterparts with SCA [204.0 (154.1–219.3) vs 150.2 (108.1–195.6)μg/L, p<0.010].

Fig 2. Serum levels of hepcidin of study participants stratified by cases and controls.

Fig 2

μg/L = microgram per litre. Data were compared using the Student T-Test. P< 0.05 was deemed statistically significant.

Serum levels of hepcidin of study participants stratified by HAMP rs10421768 variants

Fig 3 shows the serum levels of hepcidin of participants stratified by HAMP rs10421768 variants. The mean serum hepcidin levels of HAMP mutant genotype AA were significantly higher compared to the wild genotype AG/GG [(188.7 (130.9–226.9) vs 136.8 (109.7–157.8)μg/L, p<0.016].

Fig 3. Serum levels of hepcidin of study participants stratified by HAMP rs10421768 variants.

Fig 3

μg/L = microgram per litre. Data was compared using the Student T-Test. P<0.05 was deemed statistically significant.

Relationship between HAMP rs10421768 variants and blood cell parameters of the participants Table 4 shows the blood cell parameters of the study participants stratified by HAMP rs10421768 genotype variants. No statistically significant difference was observed in the blood cell parameters between the genotypes AA and AG/GG (p>0.05).

Table 4. Relationship between HAMP rs10421768 variants and blood cell parameters of the participants.

Blood cell parameters HAMP rs10421768 Genotypes P-value
AA
N = (42)
AG/GG
N = (18)
RBC×103/μL 3.3 (2.3–4.4) 3.0 (2.4–4.3) 0.859
Hb (g/dL) 9.9±3.0 9.1±1.9 0.262
HCT% 29.3±8.3 27.2 ±5.5 0.270
MCV (fL) 86.0 (80.0–91.8) 87.3 (78.6–95.1) 0.646
MCH (pg) 30.2 (27.2–32.7) 28.7 (26.3–31.8) 0.388
MCHC (g/dL) 34.7 (33.3–36.0) 34.5 (33.9–35.9) 0.840
RDW-CV% 15.5 (9.2–18.9) 16.9 (14.0–22.1) 0.217
TWBC×103/uL 7.6 (5.1–11.9) 8.8 (7.1–11.2) 0.287
PLT.×103/uL 269.0 (188.3–438.0) 270.0 (199.3–358.0) 0.834

μL = Microliter; fL = Femtolitre; g/dL = Gram per deciliter; μL = microgram per litre; pg = Picrogram; N = Number of participants; RBC = Absolute red blood cell count; Hb = Haemoglobin concentration; HCT = Haematocrit; MCV = Mean cell volume; MCH = Mean cell haemoglobin; MCHC = Mean cell haemoglobin concentration; RDW-CV = Red blood cell distribution width-coefficient of variation; TWBC = Total white blood cell count; PLT. = Platelet count; Parametric data presented as mean ± standard deviation was compared using Student T-test, and non-parametric data presented as median (25th-75thpercentiles) were compared using Mann- Whitney U-test. P<0.05 was considered statistically significant.

Discussion

Hepcidin is essential for keeping the body’s iron levels balanced, and its significance in sickle cell anaemia is vital for comprehending the intricate interplay between iron metabolism and this hereditary disease [27]. Previous studies have indicated that specific genetic variations in the HAMP promoter region can lead to diminished hepcidin expression, potentially leading to elevated serum iron levels [2830] This study aimed to determine the genotypic variants in the hepcidin gene promoter (rs10421768) and the phenotypic levels of hepcidin protein in sickle cell anaemia patients.

In the present study, the polymorphic distribution of HAMP rs10421768 genotypes AA, AG and GG among SCA patients was 64.4%, 33.3%, and 2.2% respectively, whereas in the healthy controls, the AA, AG and GG genotypic frequencies were 86.7%,13.3% and 0% respectively. This finding corroborates with an earlier study conducted among multiple sclerosis patients that reported 75.9% frequency of A allele and 24.1% of G allele [16]. It also agrees with a study by Zarghamian et al. in β-thalassemia major patients that found the frequencies of AA, AG and GG genotypes of 53.9%, 40.2% and 5.9% respectively [19].

Conversely, a previous study conducted in northern Saudi Arabia reported frequencies of HAMP promoter rs10421768 genotypes AA, AG and GG to be 3.5%, 96.5% and 0% in the iron-deficient women and 12%, 88% and 0% in the healthy women, respectively [31]. The difference in the findings may be due to the variations in the study participants and geographical locations. Whiles the current study was conducted among SCA patients in Northern Ghana, the Al-amer & Alshari study was conducted among iron deficient women in northern part of Saudi Arabia.

Additionally, the A allele was more common among males (84.6%) compared to females (58.8%), whereas the heterozygous (AG) allele was more prevalent in females (38.2%) than in males (15.4%). The homozygous G allele was rare in both sexes with only (2.9%) in females. The data obtained from the study showed an increase in A allele homozygosity of the HAMP promoter (C-582 A>G) polymorphism in those without SCA (86.7%) compared with patients with SCA (64.4%) although not statistically significant. The slight difference in genotype distribution between sexes, as indicated, may warrant further investigation to explore the potential gender-specific effects of this polymorphism on blood cell parameters and SCA susceptibility. This is highlighted by an earlier study on the genetic variation within the HAMP gene and its potential role in the context of SCA [31].

This study explored the potential link between genetic variants of HAMP rs10421768 and the disease severity in individuals with sickle cell anaemia. Even though, previous studies postulated that genetic, environmental, or clinical factors could exert considerable influence over the clinical progression and disease susceptibility [31,32], the current study did not find any association between the 582 A/G gene polymorphisms and disease severity. Notably, the majority of SCA patients, regardless of their genotype, 62.5% had mild disease, 33.3% had moderate and 8.9% had the severe form of the disease. Severe disease was uncommon in individuals with the G allele. Findings from this study corroborate a study by Parajes et al. [33] that found no association between serum iron, serum transferrin, transferrin saturation or ferritin levels and the c.-582A > G HAMP promoter variant in a healthy population [33]. The study however contradicts previous studies on potential iron overload in β-thalassaemic patients [15,18]. The variation in the findings may be attributed to demographics and differences of the study subjects. This study recruited SCA patients whereas the earlier studies recruited β-thalassaemic patients.

This study found significantly lower hepcidin levels in SCA patients than the healthy controls. Previous studies have reported similar findings and this could be explained by the overriding effect of intense erythropoiesis or hypoxia that downregulates hepcidin synthesis as against the stimulatory effect of inflammatory cytokines (IL-6) on hepcidin experienced by SCA patients [17,26]. This contradicts an earlier study in Egypt that reported elevated serum hepcidin levels in sickle cell disease subjects with multiple blood transfusions [21]. The difference in the findings may be due to the variations in the study participants. Ismail et al. [21] recruited β-thalassaemia major patients who are transfusion dependent whilst the current study recruited SCA patients.

Additionally, this study found significantly reduced serum hepcidin levels in study participants with the G allele compared to those with the A allele. This finding corroborates with previous studies [18,19,30]. The reason for the finding could be attributed to the inhibitory effect of the G allele on hepcidin transcription. The HAMP c.-582 A>G variants located in the E-box 1 acts as a responsive element for upstream stimulatory factors 1 and 2 (USF 1&2) necessary for promoting adequate transcription and synthesis of hepcidin. The presence of G variants affects the binding of the transcription factor to the E-box which down-regulates the transcription of the HAMP gene and its expression [16].

The relationship between blood cell parameters and the HAMP rs10472168 (c.-582 A>G) were assessed. The study did not find any relationship between blood cell parameters and HAMP gene variants, which corroborates findings from earlier studies [31,34,35].

This study could not assess the iron status of the study participants.

Conclusion

The HAMP promoter rs10421768 AA genotype has the highest frequency of distribution and the GG genotype with the least distribution. Participants with HAMP rs10421768 G allele (c.-582A>G) had reduced levels of hepcidin. HAMP rs10421768 genotypes had no association with blood cell parameters and disease severity. The HAMP rs10421768 genotypes may influence serum levels of hepcidin. Further study with large sample size is required to elucidate the potential effect of the G allele on hepcidin transcription.

Supporting information

S1 Data

(SAV)

pone.0306194.s001.sav (21.7KB, sav)

Acknowledgments

Authors appreciate the enormous contributions of management and staff of Kintampo Health Research Center for providing us with necessary resources for the DNA extraction. We also appreciate the immense support of University for Development Studies and the management of Methodist Hospital Wenchi, Ghana. Lastly, we thank all participants in the study.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

The author(s) received no specific funding for this work.

References

  • 1.Pinto VM, Balocco M, Quintino S, Forni GL. Sickle cell disease: a review for the internist Sickle cell disease: a review for the internist. 2019;(August). [DOI] [PubMed] [Google Scholar]
  • 2.Onimoe G, Rotz S. Sickle cell disease: A primary care update. Vol. 87, Cleveland Clinic Journal of Medicine. Cleveland Clinic Educational Foundation; 2020. p. 19–27. [DOI] [PubMed] [Google Scholar]
  • 3.Amanor et al. Iron stores in steady‐state sickle cell disease children accessing care at a sickle cell disease clinic in Kumasi, Ghana: A cross‐sectional study. 2022;5(August):6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Houwing ME, Pagter D, Beers V, Draat V. Sickle cell disease Blood reviews Publisher’s PDF, also known as Version of record Publication date: Blood Reviews Sickle cell disease: Clinical presentation and management of a global health challenge. Blood Rev [Internet]. 2023;37:100580. Available from: 10.1016/j.blre.2019.05.004 [DOI] [PubMed] [Google Scholar]
  • 5.Steinberg M, Steinberg MH. Treating Sickle Cell Anemia: A New Era Dawns Treating sickle cell anemia: A new era dawns. 2020;(January). [Google Scholar]
  • 6.Asare E V., Wilson I, Benneh-Akwasi Kuma AA, Dei-Adomakoh Y, Sey F, Olayemi E. Burden of Sickle Cell Disease in Ghana: The Korle-Bu Experience. Adv Hematol. 2018. Dec;2018:1–5. doi: 10.1155/2018/6161270 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Oppong M, Lamptey H, Kyei-Baafour E, Aculley B, Ofori EA, Tornyigah B, et al. Prevalence of sickle cell disorders and malaria infection in children aged 1–12 years in the Volta Region, Ghana: a community-based study. Malar J [Internet]. 2020;19(1):1–11. Available from: 10.1186/s12936-020-03500-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Neumayr LD, Hoppe CC, Brown C. Sickle Cell Disease: Current Treatment and Emerging Therapies. 2022;(March). [PubMed] [Google Scholar]
  • 9.Ware RE, de Montalembert M, Tshilolo L, Abboud MR. Sickle cell disease. Lancet [Internet]. 2017;390(10091):311–23. Available from: doi: 10.1016/S0140-6736(17)30193-9 [DOI] [PubMed] [Google Scholar]
  • 10.Tanhehco YC, Shi PA, Schwartz J. Transfusion therapy in sickle cell disease. 2022;(4):1–13. [Google Scholar]
  • 11.Soliman AT, Corporation HM, Sanctis V De Hospital QP, Yassin MA, Alshurafa A, et al. Blood transfusion and iron overload in patients with Sickle Cell Disease (SCD): Personal experience and a short update of diabetes mellitus occurrence. 2022;(September). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Alkindi S, Panjwani V, Al-Rahbi S, Al-Saidi K, Pathare A V. Iron Overload in Patients With Heavily Transfused Sickle Cell Disease—Correlation of Serum Ferritin With Cardiac T2* MRI (CMRTools), Liver T2* MRI, and R2-MRI (Ferriscan®). Front Med. 2021;8(October):1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Andolfo I, Russo R. Novel Insights and Future Perspective in Iron Metabolism and Anemia. Metabolites. 2022;12(2):14–6. doi: 10.3390/metabo12020138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Faraj and Al-Abedy. Serum Hepcidin Hormone Level and Its Genes Polymorphism. Genetic Variation. 2021. [Google Scholar]
  • 15.Zarghamian P, Azarkeivan A, Arabkhazaeli A, Mardani A, Shahabi M. Hepcidin gene polymorphisms and iron overload in β-thalassemia major patients refractory to iron chelating therapy. BMC Med Genet. 2020;21(1):1–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Stachowska L, Dorota Koziarska BK, Artur Kotwas, Anna Knyszy ´nska MF, Karolina Dec ES 1, Viktoria Hawryłkowicz 1, Monika Kulaszy ´nska 6 JSP 7 and ˙Zydecka KS. Transferrin Receptor 2 (rs7385804) Gene Polymorphism Might Be Associated with the Origin of Multiple Sclerosis. 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Reichert CO, Marafon F, Levy D, Maselli LMF, Bagatini MD, Blatt SL, et al. Influence of Hepcidin in the Development of Anemia. Curr Top Anemia. 2018. [Google Scholar]
  • 18.Andreani M, Radio FC, Testi M, De Bernardo C, Troiano M, Majore S, et al. Association of hepcidin promoter c.-582 A>G variant and iron overload in thalassemia major. Haematologica. 2009;94(9):1293–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zarghamian P, Azarkeivan A, Arabkhazaeli A, Mardani A, Shahabi M. Hepcidin gene polymorphisms and iron overload in β-thalassemia major patients refractory to iron chelating therapy. BMC Med Genet. 2020. Apr;21(1):75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Lee N, Makani J, Tluway F, Makubi A, Armitage AE, Pasricha S rayn, et al. EBioMedicine Decreased Hepcidin Levels Are Associated with Low Steady-state Hemoglobin in Children With Sickle Cell Disease in Tanzania. EBioMedicine [Internet]. 2019;34(2018):158–64. Available from: 10.1016/j.ebiom.2018.07.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ismail et al. The Relation between Serum Hepcidin, Ferritin, Hepcidin: Ferritin Ratio, Hydroxyurea and Splenectomy in Children with β—Thalassemia. 2019;1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.GSS. Ghana 2021 population and housing census General report 3A. 2021. [Google Scholar]
  • 23.Rahman HAA, Abou-elew HH, El-shorbagy RM, Fawzy R, Youssry I. Influence of Iron Regulating Genes Mutations on Iron Status in Egyptian Patients with Sickle Cell Disease. 2014;44(3):304–9. [PubMed] [Google Scholar]
  • 24.Hedo CC, Aken’ova YA, Okpala IE, Durojaiye AO, Salimonu LS. Acute phase reactants and severity of homozygous sickle cell disease. J Intern Med. 1993. Jun;233(6):467–70. doi: 10.1111/j.1365-2796.1993.tb01000.x [DOI] [PubMed] [Google Scholar]
  • 25.QIAamp DNA Mini Handbook. Blood Mini Handbook QIAGEN Sample and Assay Technologies. 2016;(May). [Google Scholar]
  • 26.Chanté & Abera. Title: MassARRAY Single Nucleotide Polymorphism Genotyping Title: MassARRAY Single Nucleotide Polymorphism Genotyping. Vol. 2017. 2021. [Google Scholar]
  • 27.Wood and Coates JC. HHS Public Access. 2018;177(5):703–16. [Google Scholar]
  • 28.Piperno A, Pelucchi S, Mariani R. Inherited iron overload disorders. 2020;1–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Camaschella C, Nai A, Silvestri L. Iron metabolism and iron disorders revisited in the hepcidin era Correspondence: 2020;105(2). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Island ML, Jouanolle AM, Mosser A, Deugnier Y, David V, Brissot P, et al. A new mutation in the hepcidin promoter impairs its BMP response and contributes to a severe phenotype in HFE related hemochromatosis. Haematologica. 2009;94(5):720–4. doi: 10.3324/haematol.2008.001784 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Al-amer O, Alsharif KF. Frequency of the HAMP (c. -582 A > G) Polymorphism in Iron Deficiency in Saudi Arabia. 2021. [DOI] [PubMed] [Google Scholar]
  • 32.Liang et al. 2017. Association of Single-Nucleotide Polymorphism in the Hepcidin Promoter Gene with Susceptibility to Extrapulmonary Tuberculosis _ Genetic Testing and Molecular Biomarkers. 2017. [DOI] [PubMed] [Google Scholar]
  • 33.Parajes S, González-quintela A, Campos J, Quinteiro C, Domínguez F. Genetic study of the hepcidin gene (HAMP) promoter and functional analysis of the c. -582A > G variant. 2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hatem NL, Kamal MY, Younan DN, Ayad AM. Study of Association of Hepcidin Promotor C-582 A > G Variant and Iron Over Load in B-Thalassemia Major. 2023;6(7). [Google Scholar]
  • 35.Abdelrhman AH, Abdelgadir EA, Khalid KM. Journal of DNA AND RNA research ISSN NO: 2575–7881 Sample Preparation and PCR Detection of HAMP DNA Polymorphisms. 2020;(2):23–30. [Google Scholar]

Decision Letter 0

Tanja Grubić Kezele

6 Mar 2024

PONE-D-24-00585Molecular characterization of HAMP rs10421768 gene and phenotypic expression of hepcidin; a case-control study among sickle cell anaemia patients in GhanaPLOS ONE

Dear Dr. Appiah,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Based on the reviewers suggestions, the paper needs major revision. The reviewers comments can be found below. Please submit your revised manuscript by Apr 20 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Tanja Grubić Kezele, Ph.D., M.D.

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. 

Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://aje.com/go/plos) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.

Upon resubmission, please provide the following:

The name of the colleague or the details of the professional service that edited your manuscript

A copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)

A clean copy of the edited manuscript (uploaded as the new *manuscript* file)

3. We are unable to open your Supporting Information file HAMP DATA.sav. Please kindly revise as necessary and re-upload.

4. We note that your Data Availability Statement is currently as follows: All relevant data are within the manuscript and its Supporting Information files.

Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission. PLOS defines the minimal data set to consist of the data required to replicate all study findings reported in the article, as well as related metadata and methods (https://journals.plos.org/plosone/s/data-availability#loc-minimal-data-set-definition).

For example, authors should submit the following data:

- The values behind the means, standard deviations and other measures reported;

- The values used to build graphs;

- The points extracted from images for analysis.

Authors do not need to submit their entire data set if only a portion of the data was used in the reported study.

If your submission does not contain these data, please either upload them as Supporting Information files or deposit them to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories.

If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If data are owned by a third party, please indicate how others may request data access.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The sample size is very limited, and the control cases are not enough for a comparable controlled study .

More cases are required for proper statistical analysis . Not using real-time PCR for SNP analysis (which the most common method in most of the similar researches ) are not justified. the discussion part could be enriched with other researches of similar population for better comparability.

The consent for the patients methodology is not clear

Reviewer #2: The study determined the polymorphic distribution of the HAMP promoter gene rs10421768 and hepcidin levels in SCA patients.

The article is presented in an intelligible fashion.

The study presents the results of primary scientific research.

Experiments, statistics, and other analyses are described in sufficient detail.

The research seems to meet all applicable standards for the ethics of experimentation and research integrity.

Conclusions are not entirely supported by the data.

The relevance of the study lies in determining whether this polymorphism implies a higher risk of developing iron overload due to decreased hepcidin synthesis. Therefore, it would be very enriching if the authors conducted a measure of iron overload, such as measuring serum ferritin concentrations, for instance.

It is important to divide the participants according to the different polymorphisms and compare the serum hepcidin concentrations to verify whether the polymorphism is indeed determining the hepcidin levels.

Considering that the study did not establish any relationship between ferritin concentrations and the mapped polymorphisms, and that the objective was to evaluate the distribution of the polymorphisms, in this case, it is essential to present a sample size calculation.

Lines 102-105: It doesn't seem appropriate to claim that the data from this study can provide appropriate guidance in managing heavily transfused individuals. I think it's important to downplay the significance. I believe the data can support future investigations. However, based on the applied methods and investigated variables, it's unclear whether the polymorphism would pose a higher risk of iron overload.

Line 139: It is important to describe the criteria used to determine the severity of the disease.

Table 2: The ethnic-racial information of the participants was not provided. Please, provide it.

Considering that the study's objective is to present the distribution of polymorphisms, it is important to have a more detailed description of the control group. Who are these participants? Are they from the same geographical region? Do they have similar socio-economic conditions? Why is the polymorphism distribution different in the control group? Please provide this information and discuss it.

Table 4: Please, you should exclude the written representation of microliter, etc

Lines 315-316: This comparison doesn't make much sense because the physiopathologies of the two diseases are completely different.

Lines 327-328: Iron overload increases hepcidin. It is not possible to compare with studies that do not separate individuals based on the presence or absence of iron overload. Or at least, a consideration should be made regarding this aspect.

Lines 337-339: please revise this sentence “…and the possible iron overload”.

The discussion should address the limitations of the study.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2024 Jun 27;19(6):e0306194. doi: 10.1371/journal.pone.0306194.r002

Author response to Decision Letter 0


20 Mar 2024

Dear Editor,

Thank you for your email. I am pleased to resubmit manuscript titled “Molecular characterization of HAMP rs10421768 gene and phenotypic expression of hepcidin; a case-control study among sickle cell anaemia patients in Ghana” for your consideration.

Authors do appreciate your endless efforts and rich comments to ensure improvement in the manuscript.

The concerns raised by the editorial team have been addressed and highlighted below and marked in the respective sections in the manuscript. I look forward to your favourable response.

Thank you.

Reviewers' Comments:

Reviewer #1:

i. The sample size is very limited, and the control cases are not enough for a comparable controlled study. More cases are required for proper statistical analysis.

Response: This was part of student academic thesis without any external financial support making it difficult to recruit larger sample size. This has been duly acknowledged as limitation

ii. Not using real-time PCR for SNP analysis (which the most common method in most of the similar researches) are not justified.

Response: Genotyping was performed by real-time polymerase chain reaction (PCR) using the Agena MassARRAY method with iPLEX® PCR (Inqaba BiotecTM West Africa Ltd, Ghana) as stated in trhe methodology (line 187-192)

iii. The consent for the patients methodology is not clear.

Response: This has been revised for clarity and it reads “Participants 18years and above provided written informed consent. The consents of the study participants below 18years were obtained from guardians or parents“

Reviewer #2:

i. Conclusions are not entirely supported by the data.

The relevance of the study lies in determining whether this polymorphism implies a higher risk of developing iron overload due to decreased hepcidin synthesis. Therefore, it would be very enriching if the authors conducted a measure of iron overload, such as measuring serum ferritin concentrations, for instance.

Response: The authors acknowledge your concerns. However, the study could not assess the iron status/profile of the participants, and this has been acknowledged as a limitation of the study

ii. It is important to divide the participants according to the different polymorphisms and compare the serum hepcidin concentrations to verify whether the polymorphism is indeed determining the hepcidin levels.

Response: This information is presented in figure 3. Only one participant had homozygous GG variant making it statistically inappropriate to separate it.

iii. Considering that the study did not establish any relationship between ferritin concentrations and the mapped polymorphisms, and that the objective was to evaluate the distribution of the polymorphisms, in this case, it is essential to present a sample size calculation.

Response: Determination of sample size is well presented in the methodology (Line 132-148)

iv. Lines 102-105: It doesn't seem appropriate to claim that the data from this study can provide appropriate guidance in managing heavily transfused individuals. I think it's important to downplay the significance. I believe the data can support future investigations. However, based on the applied methods and investigated variables, it's unclear whether the polymorphism would pose a higher risk of iron overload.

Response: this section has been revised “findings from this study would provide the possible relationship between the HAMP polymorphic variants and hepcidin protein expression in SCA patients”

v. Line 139: It is important to describe the criteria used to determine the severity of the disease.

Response: The detailed description of the severity score has been described in previous study by Hedo et al., 1993, and this has been referenced accordingly in the manuscript.

vi. Table 2: The ethnic-racial information of the participants was not provided. Please, provide it.

Response: Data regarding ethnicity were not captured. However, the study was conducted in Akan dominated population in Ghana

vii. Considering that the study's objective is to present the distribution of polymorphisms, it is important to have a more detailed description of the control group. Who are these participants? Are they from the same geographical region? Do they have similar socio-economic conditions? Why is the polymorphism distribution different in the control group? Please provide this information and discuss it.

Response: The control participants were people without sickle cell disease who reside in the same geographical area and of similar ethic group as the cases.

viii. Table 4: Please, you should exclude the written representation of microliter, etc

Response: this has been revised accordingly

ix. Lines 315-316: This comparison doesn't make much sense because the physiopathologies of the two diseases are completely different.

Response: This comparison has been expunged from the discussion

x. Lines 327-328: Iron overload increases hepcidin. It is not possible to compare with studies that do not separate individuals based on the presence or absence of iron overload. Or at least, a consideration should be made regarding this aspect.

Response: the comparison is on hepcidin levels and not iron. It is true iron overload increases hepcidin levels. It expression can also be inhibited by intense erythropoietic stress or hypoxia.

xi. Lines 337-339: please revise this sentence “…and the possible iron overload”.

The discussion should address the limitations of the study.

Response: The phrase “…and the possible iro

Attachment

Submitted filename: Response to Reviewers.docx

pone.0306194.s002.docx (21.9KB, docx)

Decision Letter 1

Kostas Pantopoulos

13 Jun 2024

Molecular characterization of HAMP rs10421768 gene and phenotypic expression of hepcidin: a case-control study among sickle cell anaemia patients in Ghana

PONE-D-24-00585R1

Dear Dr. Appiah,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Kostas Pantopoulos, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The authors made an effort to address all the suggestions made. I consider that the changes were sufficient, even though it was not possible to present the data on serum ferritin, which undoubtedly would bring greater relevance to the study.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

**********

Acceptance letter

Kostas Pantopoulos

18 Jun 2024

PONE-D-24-00585R1

PLOS ONE

Dear Dr. Appiah,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Kostas Pantopoulos

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Data

    (SAV)

    pone.0306194.s001.sav (21.7KB, sav)
    Attachment

    Submitted filename: Response to Reviewers.docx

    pone.0306194.s002.docx (21.9KB, docx)

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLOS ONE are provided here courtesy of PLOS

    RESOURCES