Table 1.
Test type, primer sequence and criteria for positive results for the three evaluated Coxiella burnetii PCR tests targeting the IS1111 transposase elements in the C. burnetii genome, using DNA from ticks collected from wildlife and cattle in Kenya between May 2011 and 2019.
| Test | Primer name | Primer sequence (5′-3′) | Amplicon length (bp) | Positive result | References |
|---|---|---|---|---|---|
| Conventional PCR | Trans 1 | TATGTATCCACCGTAGCCAGTC | 687 | Samples that have a clear band at the expected amplicon size of 687 bp | Hoover et al. (39) |
| Trans 2 | CCCAACAACACCTCCTTATTC | ||||
| Biomeme qPCR | Proprietary | Proprietary C. burnetii qPCR Go-strips test (Biomeme, Philadelphia, Pennsylvania, United States) | 290 | Samples that had a Cq* value ≤40 | N/A |
| PCR-HRM | C_burnetii_HRM-F | GGAACTTGTCAGAGATGATTTGGT | 150 | Samples whose melt profiles’ peaks and shape was similar to the positive control | This study |
| C_burnetii_HRM-R | AGAGTTCCCGACTTGACTCG |
*Cq, quantification cycle value.