Abstract
Aim: To evaluate the behavior of oral keratinocytes in the presence of Vitamin C (Vit C) and its anti-inflammatory potential. Materials & methods: Oral keratinocytes were initially exposed to 0.1–2.5 mM of Vit C and the metabolic activity and cell migration were evaluated using MTS assay and Ibidi culture inserts, respectively. After, the cells were challenged with Candida albicans and inflammatory markers were analyzed by qPCR. Results: The treatment was not cytotoxic, and the highest concentrations increased the metabolic activity at 24 h. Vit C delayed the cell migration at 48 and 72 h. Interestingly, it downregulated the genes IL-8 and IL-1β. Conclusion: Vit C could be an interesting adjuvant to anti-fungal treatment due to its anti-inflammatory potential.
Keywords: : anti-inflammatory, ascorbic acid, candidiasis, infection model, vitamin C
Plain language summary
Vitamin C, also known as ascorbic acid, is a vitamin commonly found in fruits and vegetables. It is popular for supporting our immune system, so is commonly taken as a supplement. We looked at the action of vitamin C on cells from the mouth and its potential to reduce inflammation in a fungal disease of the mouth – oral candidiasis. We showed that vitamin C is not toxic to cells of the mouth and may reduce inflammation in cells infected by the fungus. This suggests that vitamin C could be used as a complementary therapy for oral candidiasis.
Graphical abstract
Plain language summary
Summary points.
Vitamin C is an antioxidant agent that has been investigated for the treatment of different microbial and inflammatory conditions.
Previous studies demonstrated that this compound may present modulatory effects on C. albicans virulence factors.
Alternative methods to reduce the use of antifungals agents are desired.
This study evaluated for the first time the effects of Vit C on in vitro model of oral candidiasis.
Vit C increased the metabolic activity of the cells at 24 h and delayed the cell migration at 48 and 72 h.
Vit C downregulated the pro-inflammatory genes IL-8 and IL-1β.
The data indicated that Vit C could be in interesting adjunct for the treatment of oral candidiasis.
Oral candidiasis (OC) is an oral disease caused by Candida spp. Candida albicans is the most prevalent species, which is responsible for more than 95% of OC cases. This fungus is a commensal microorganism that inhabits the mouth, gastrointestinal and reproductive tracts in more than 80% of the population [1]. However, C. albicans is an opportunistic pathogen that can proliferate and cause disease in the presence of local and/or systemic predisposing factors [1,2].
The adherence to oral epithelial cells, ability to form biofilms, evasion from host's immune defenses and the capacity to invade and destroy host tissues are considered important virulence factors of C. albicans [1]. Polyenes and azoles have been considered the main antifungal agents to treat OC, however, the use of polyenes usually is limited to topical delivery due to the poor absorption through the GI tract. The topical use also presents limitations because of difficulty in maintaining adequate levels of the drug in the oral environment. In contrast, azoles, such as fluconazole and itraconazole, may be administered systemically as they are well absorbed by the GI tract. Despite this, these agents may present drug interactions with warfarin (anticoagulant agent) and statins (HMG-CoA reductase inhibitors) [3]. Moreover, the prevalence of antifungal resistance has increased significantly in recent years [3,4].
Different mechanisms of resistance have been described for C. albicans according to the antifungal class. Against azoles, C. albicans may act decreasing drug concentration, changing target enzyme, decreasing affinity to the binding site, upregulating the target enzyme and promoting the overexpression of cell membrane efflux pumps [4]. In attempt to solve these problems, alternative treatments have been investigated to treat antifungal infections in the last decade, including the combination of therapies [5].
Vit C is a powerful antioxidant agent [6] and has been evaluated for many conditions, such as infectious diseases [7,8]. The effect of Vit C on C. albicans was previously investigated [8]. The authors observed that Vit C decreased the virulence and pathogenicity of C. albicans interfering with yeast-to-hypha transition. Van Hauwenhuyse et al. showed that Vit C may act in Hsp90-dependent C. albicans concerning transcriptional regulator Upc2. Vit C blocked GdA-dependent elongated growth by restoring normal ergosterol levels in a Upc2-dependent manner [7]. Interestingly, another study demonstrated that the concentration of 90 mM of Vit C can kill C. albicans. This effectiveness was dependent on temperature, oxygenation, availability of energy sources, growth media and growth phase [9].
Other studies have also indicated that Vit C may exert local anti-inflammatory properties, reducing ROS levels and inhibiting the activation of MAPKs, NF-κB, AP-1 and IL-8 expression in human respiratory cells [10]. In a clinical study, Vit C was able to reduce various degrees of chronic gingival inflammation [11]. Additionally, it has been considered the most powerful antioxidant agent of the skin with neocollagenesis and skin-lightening properties, which give to this compound a large range of clinical applications [6].
Considering the promising findings related to anti-inflammatory properties of Vit C as well as the modulatory effects of Vit C on C. albicans virulence factors, we hypothesized that Vit C could be an interesting adjunct treatment for OC. As far as we know, the effects of Vit C on in vitro model of OC have not previously been explored. The current study evaluated the effects of Vit C on oral keratinocytes, with respect to its viability/proliferation, migration properties and anti-inflammatory potential in cells challenged with C. albicans.
Materials & methods
Cell culture
Primary gingival keratinocytes (PGKs) from the American Type Culture Collection (ATCC, PCS-200-014) were used in this study. The cells were cultured in Dermal Cell Basal Medium (ATCC, PCS-200-030) supplemented with keratinocyte growth kit (ATCC, PCS-200-040) and penicillin (100 U/ml). The cells were grown at 37 °C in a humid environment with 5% CO2. The media was changed every 2–3 days and cells up to five passages were used for all the assays.
Cell viability/proliferation assay
PGKs were cultured in 24-well plates at a density of 20 × 103 cells per well (500 μl/well) and incubated at 37 °C for 24 h, when the treatments were performed. L-ascorbic acid (Sigma-Aldrich) was initially diluted in distilled water to a concentration of 90 mM and then filtered through a syringe filter of 0.22 mm. Afterward, the Vit C was diluted in the cell culture media to a final concentration of 2.5, 1.25, 0.6, 0.3 and 0.1 mM, and immediately placed in contact with the cells. Cell viability was evaluated after 3 and 24 h of treatment using the colorimetric metabolic assay MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; Promega Corp., CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay. Absorbance was measured at a wavelength of 490 nm by SoftMax Pro 6 software after 2 h of incubation. A control group (only cells and culture medium without Vit C) was performed under the same conditions and used as a normalizer. The test was carried out in two independent experiments (n = 8). The cytotoxicity threshold was set at 70% according to previous studies [12,13].
Two-dimensional cell migration test (in vitro wound healing assay)
For this assay, high culture inserts with two chambers and a gap between them (Ibidi – μ-Dish 35 mm; Cat. no. 81176) were inserted in four-well plates. PGKs were plated in the chambers at a density of 3 × 103 cells (75 ml) per chamber. The cells were cultured until reaching approximately 70% of confluence, when the inserts were removed. Subsequently, the cells were exposed to 0.1, 0.6, 1.2 mM of Vit C and the images of cells within the gap area were captured by microscopy (Leica DMI 4000B, Leica Microsystems) using Image-Pro Plus MDA, version 7.0 software. Images of the cellular migration into the gap areas were taken at 3, 24, 48 and 72 h of the starting treatment. Quantification of the area between cells in the two chambers (in vitro wound area) was analyzed using the ImageJ/Fiji® plugin, as described by Arnedo et al. [14]. The assay was performed in two independent experiments (n = 8). The treated groups were compared with control group, in which the cells were exposed only to culture medium.
Infection model
Before the infection, PGKs were plated in 24-well plates at a density of 1 × 105 cells per well (500 μl/well) and incubated at 37 °C for 24 h. In the same day, C. albicans (SC 5314) were cultured in Sabouraud Dextrose agar plates at 37 °C for 24 h. For the infection, an inoculum of C. albicans at a density of 5 × 105 was prepared in Dermal Cell Basal Medium (ATCC, PCS-200-030) supplemented with keratinocyte growth kit (ATCC, PCS-200-040) and penicillin (100 U/ml) and inserted in the wells. After 1 h of the infection, the plates were centrifuged, the culture medium was removed and Vit C solutions at the concentrations of 0.1, 0.6 and 1.2 mM were added to the wells. Afterward, the plates were incubated for 6 h at 37 °C and the lysate was collected. To determine a suitable period of infection, the periods of 4 and 24 h of infection were also evaluated as pilot assays. For cell lysis, a lysis solution of RNAqueous™-Micro Total RNA Isolation Kit (AM1931, Thermo Fisher Scientific) was used and the samples were stored at -80 °C.
qPCR analysis
Total RNA was isolated using RNAqueous™-Micro Total RNA Isolation Kit (Thermo Fisher Scientific, AM1931). The total RNA was treated with DNase I provided with the kit to remove remnant genomic DNA in the samples. Complementary DNA (cDNA) was synthesized using High capacity cDNA reverse transcription kit (Thermo Fisher Scientific, 4368813). Quantitative real-time PCR (qPCR) was performed to quantify mRNA expression using SYBR® green PCR Master Mix (Applied Biosystems, Warringtons, UK). The oligonucleotide primer sequences for the pro-inflammatory (IL-8, GM-CSF, IL-1β, TNF-α, IL-6) and anti-inflammatory (IL-10) genes can be observed in Table 1. All samples were run in the QuantStudio 7 flex detection system. The threshold cycle (Ct) for each test gene was normalized against the 18S housekeeping gene. The housekeeping gene was unaffected by the infection or treatment with Vit C. The absolute mRNA values were calculated using the equation ΔCt = Ct (gene of interest) – Ct (housekeeping gene).
Table 1.
Oligonucleotide primer sequences.
| IL-8 | Forward | TCCTGATTTCTGCAGCTCTG |
| Reverse | GTCCACTCTCAATCACTCTCAG | |
| GM-CSF | Forward | ATGTGAATGCCATCCAGGAG |
| Reverse | CTTGTACAGCTCCAGGCG | |
| IL-1β | Forward | TCTTCGACACATGGGATAACG |
| Reverse | GAGGTGGAGAGCTTTCAGTTC | |
| IL-6 | Forward | AAAAGTCCTGATCCAGTTCCTG |
| Reverse | TGAGTTGTCATGTCCTGCAG | |
| TNF-α | Forward | CTCACCCACACCATCAGC |
| Reverse | GAAGACCCCTCCCAGATAGA | |
| IL-10 | Forward | AGGATCAGCTGGACAACTTG |
| Reverse | GATGTCTGGGTCTTGGTTCTC | |
| 18S | Forward | CGGCGACGACCCATTCGAAC |
| Reverse | GAATCGAACCCTGATTCCCCGTC |
Statistical analysis
The data were plotted and expressed as mean values and standard deviations (mean ± SD). Statistical analysis was performed using the GraphPad Prism 9 software (GraphPad Software, Inc. CA, USA). Data were first analyzed regarding sample distribution. Parametric data were analyzed using analysis of variance (one-way ANOVA, α = 0.05) and Tukey's post hoc test. The nonparametric data were compared by Kruskal-Wallis and Dunn's/Dunnett's post hoc tests (α = 0.05).
Results
Vit C increases the metabolic activity of oral keratinocytes at 24 h of treatment in a dose-dependent manner
After 3 h of treatment, the different concentrations of Vit C did not decrease the cell viability to levels lower than the cytotoxicity threshold (70%), although 0.3 mM reduced cell viability to a similar level (70.6%), with statistical difference in relation to the control group (Dunn's multiple comparisons test, p < 0.001). The other concentrations of Vit C (0.1, 0.6, 1.2 and 2.5 mM) showed more than 80% cell viability with no statistical difference in relation to the control group or among them (p > 0.05, Dunn's multiple comparisons test) (Figure 1A). After 24 h, Vit C maintained or increased the metabolic activity, depending on the concentration. The treatment with 1.2 and 2.5 mM increased the cell viability/proliferation to 135 and 145%, respectively, with statistical differences when compared to control group (Tukey's multiple comparisons test, p < 0.05) (Figure 1B).
Figure 1.

Cell viability of oral keratinocytes after Vit C exposure.
For 3 h (A) and 24 h (B). Bars represent mean and SD values after the treatments. The dotted line (red) corresponds to the toxicity threshold (ISO 10993-5). Different letters indicate statistical differences between groups (A) Kruskal-Wallis and Dunn's post hoc tests, p < 0.05; (B) one-way ANOVA and Tukey's post hoc test, p < 0.05).
Vit C changes the migration properties of oral keratinocytes at 48 & 72 h
The analysis of the in vitro gap closure showed no statistical difference between treated and control groups at 3 and 24 h (p > 0.05, one-way ANOVA test). However, statistical differences were observed at 48 and 72 h (p < 0.05, one-way ANOVA and Kruskal-Wallis tests, respectively). A delayed gap closure kinetic (migration property) was detected in the group treated with 1.2 mM of Vit C that showed statistical differences in relation to control group at 48 h (p < 0.05, Dunnett's multiple comparisons test) and 72 h (p < 0.05, Dunn's multiple comparisons test). The concentrations of 0.1 and 0.6 mM of Vit C were also statistically different from control group at 48 h (p < 0.05, Dunnett's multiple comparisons test) and 72 h (p < 0.05, Dunn's multiple comparisons test), respectively (Figure 2).
Figure 2.

Analysis of cell migration or in vitro wound closure using oral keratinocytes.
(A) Mean data and SD error bars of the remaining scratch/gap area at 3, 24, 48 and 72 h. (B) Illustrations of the in vitro wound closure for each group at all the periods. The images were captured in an inverted microscope at 250× magnification. The asterisks (*) indicate statistical differences between control group and 0.1/1.2 mM of Vit C at 48 h and 0.6/1.2 mM of Vit C at 72 h (3, 24, 48 h; one-way ANOVA and Dunnett's post hoc test, p < 0.05), (72 h; Kruskal-Wallis and Dunn's post hoc tests, p < 0.05).
Vit C modulates the inflammatory response of oral keratinocytes against C. albicans
A range of different conditions were evaluated to find a suitable period of infection in which the control and infection groups were statistically different indicating a pro-inflammatory scenario. The period of 4 h was not sufficient to induce a pro-inflammatory response, as no statistical differences could be observed between control (only culture medium – non-infected cells) and infection groups. On the other hand, a period of 24 h of infection was very long, as most of the cells had died (data not shown).
An infection period of 7 h showed optimal conditions of infection, as can be observed in Figure 3. Statistical differences between control and infection group were observed for the genes IL-8, GM-CSF and IL-1β (p < 0.05, Tukey's multiple comparisons test). Vit C showed an anti-inflammatory effect with downregulation of genes IL-8 after treatment with 0.1 and 1.2 mM of Vit C and IL-1β after treatment with 1.2 mM of Vit C. These treatments showed statistical differences for infection group (p < 0.05, Tukey's multiple comparisons test). The analysis of the gene GM-CSF showed no statistical differences between infection and Vit C groups (p > 0.05, Tukey's multiple comparisons test), although lower means of absolute mRNA have been observed in the treated groups, mostly at concentration of 0.1 mM of Vit C, which also was not statistically different from negative control group (Figure 3A–C).
Figure 3.

Effect of infection with Candida albicans for 7 h and treatment with Vit C for 6 h.
On IL-8 (A), GM-CSF (B), IL-1β (C), IL-6 (D) and TNF-α (E) gene expression by oral keratinocytes. Bars represent mean and SD values after the different treatments. 18S was used as housekeeping gene. Different letters indicate statistical differences between groups (one-way ANOVA and Tukey's post hoc test, p < 0.05).
No statistical differences were observed between groups for IL-6 and TNF-α genes, although the infection group showed a tendency of upregulation while the treated groups demonstrated a tendency of downregulation (p > 0.05, Tukey's multiple comparisons test) (Figure 3D & E). The anti-inflammatory gene IL-10 was not expressed at a detectable level by the cells (data not shown).
Discussion
The search for new anti-fungal treatments has emerged in the last decades, including the combination of therapies [5,15]. Vit C has currently been evaluated for multiple purposes [16,17], including its action as an anti-inflammatory agent [18]. The aim of the current study was to evaluate Vit C as a possible modulator of treatment for oral candidiasis. For this, the potential effects of Vit C on the metabolic activity and migration of oral keratinocytes were first evaluated. After, an in vitro infection model in which the cells were challenged with C. albicans and treated with Vit C was performed to evaluate the anti-inflammatory potential of Vit C. Oral keratinocytes were chosen for this study because they are the first line of defense against candidal infection working as a physical barrier in the oral cavity [19].
The MTS assays indicated that Vit C did not reduce the cell viability below the acceptable cytotoxicity threshold (70%) after the first hours of exposure. Additionally, the higher concentrations stimulated the cells after 24 h, as indicated by the marked increase in metabolic activity, an indicator of cell viability/proliferation. It is well known that keratinocytes can express two different transporters, which are responsible for Vit C uptake, SVCT-1 and SVCT-2 [20,21]. A previous study proposed a biphasic role of Vit C according to SVCT-2 expression in intestinal cancer cells. High SVCT-2 expression is probably related with a pro-oxidant effect culminating in cell death while low SVCT-2 expression may be related with an antioxidant effect and high cell viability/proliferation. The authors observed that the decrease in cell viability is inversely proportional to SVCT-2 expression [22]. In the current study with PGKs cells, the higher metabolic activity observed after 24 h of exposure could indicate an antioxidant effect and low SVCT-2 expression.
Candidal infection often induces non-ulcerative lesions. However, in critically ill patients, this infection is commonly responsible for chronic oral ulcers [19], in which the properties of proliferation and migration of the cells are crucial for tissue repair. Keratinocytes are able to undergo an epithelial-to-mesenchymal transition, which gives them an ability to migrate toward each other by reformulating cell-cell and cell-extracellular binding. Thus, it is possible to measure the re-epithelialization stage of wound healing [23]. Therefore, we performed an in vitro migration/wound closure assay to analyze the in vitro role of Vit C in the migration of the oral keratinocytes. Our measurements indicate that Vit C delayed the wound healing kinetic after 48 h and 72 h, although Vit C did not significantly interfere with wound healing process at 3 h and 24 h. A previous study that evaluated primary epidermal keratinocytes wound healing for 24 h observed that 4.4 μg/ml of Vit C did not change the cellular gap closure after this period [24], similarly to our study after 24 h. Other studies using two-dimensional monolayer models of cells have indicated good ability of Vit C to promote in vitro wound healing, however these studies focused on different cell types [25,26]. The reasons by which vitamin C delayed the cell migration at 48 and 72 h in our hands is still unclear and need to be investigated. It is noteworthy that this assay was not performed in the presence of infection, due to the high pathogenicity of C. albicans strain after 24 h of infection, which represents a limiting factor of this in vitro study.
According to previous findings, Vit C can regulate epidermal differentiation via activation of PKC. Additionally, it has been shown to protect keratinocytes against oxidative stress, particularly during the inflammatory phase of wound repair, by the improvement of the hydrophilic antioxidant status inside the cells [27]. In our study, the anti-inflammatory potential of Vit C on PGK cells challenged with C. albicans was investigated through the analysis of genes related to the inflammatory response. The model of infection was validated after 7 h of PGK-fungi contact via the upregulation of IL-8, GM-CSF, and IL-1β genes. These are pro-inflammatory markers that usually become upregulated when oral epithelial cells are infected with C. albicans, especially during direct physical contact and the germination of yeast into hyphae [28-31]. Vit C showed an anti-inflammatory potential in the conditions of this study, as observed by the statistical downregulation of IL-8 and IL-1β, and a dose-dependent downregulation tendency of the pro-inflammatory genes GM-CSF, TNF-α and IL-6.
Consistent with our findings, Vit C showed an anti-inflammatory property in UBV-damaged keratinocytes suppressing the inflammatory response via the downregulation of IL-8 and MCP-1 [32]. Respiratory epithelial cells (H292) challenged with house dust-mites (HDM) and treated with 100 or 200 mM Vit C were reported. The challenge enhanced ROS levels, increased IL-8 expression and activated the signaling pathways MAPKs, NF-κB and AP-1. Interestingly, the treatment with Vit C decreased ROS levels. Additionally, it inhibited activation of MAPKs, NF-κB and AP-1 and downregulated the expression of IL-8 [10]. Other studies that have investigated different doses of Vit C also indicated that this vitamin could inhibit multiple pathways related to the activation of NF-κB transcription factor [33-35]. Cárcamo et al., pointed out the importance of the ROS in the GM-CSF signaling response and showed that the treatment with Vit C can downmodulate GM-CSF signaling responses in human monocytic (U937), kidney (293T) and human myeloid cells (HL-60) at intracellular concentrations of 5 mM [36]. In another study, Vit C decreased lipopolysaccharide (LPS)-induced ROS, TNF-α and IL-6 production in macrophages challenged and treated for 24 h with LPS and Vit C (100 nM), respectively [37]. In the present study, a dose-dependent downregulation tendency of the pro-inflammatory genes GM-CSF, TNF-α and IL-6 was observed after 6 h of treatment. Due to the high virulence of the strain used in our model of infection, it was not possible to evaluate if statistical significance would be obtained after 24 h of exposure to Vit C. Nevertheless, the anti-inflammatory potential of Vit C was seen after 6 h of treatment, resulting in the downregulation IL-8 and IL-1β.
Considering the activation of NF-κB transcription factor in the inflammatory response against C. albicans [38,39], Vit C may be inhibiting some signaling pathway related to NF-κB, resulting in the anti-inflammatory effects observed in this study. Corroborating our hypothesis, these findings indicate that Vit C could be in interesting adjuvant to anti-fungal treatment and highlight the importance of future in vitro and in vivo studies in this approach.
Conclusion
Vit C presents an anti-inflammatory effect on oral keratinocytes challenged with C. albicans, which suggests that it could be an interesting adjunct for the treatment of oral candidiasis. It is important to emphasize that this was an in vitro study with its limitations, and the interference of Vit C in wound repair in cases of candidiasis should be investigated in future in vivo models.
Funding Statement
This work was supported by the São Paulo State Research Foundation (FAPESP) [2022/04598-7; 2022/04723-6; 2019/05856-7] and by funds from the Indiana University School of Dentistry.
Financial disclosure
This work was supported by the São Paulo State Research Foundation (FAPESP) [2022/04598-7; 2022/04723-6; 2019/05856-7] and by funds from the Indiana University School of Dentistry. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
Competing interests disclosure
The authors have no competing interests or relevant affiliations with any organization or entity with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.
Writing disclosure
No writing assistance was utilized in the production of this manuscript.
References
Papers of special note have been highlighted as: • of interest; •• of considerable interest
- 1.Vila T, Sultan AS, Montelongo-Jauregui D, Jabra-Rizk MA. Oral candidiasis: a disease of opportunity. J. Fungi. 6(1), 1–28 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]; • Interesting review about oral candidiasis.
- 2.Singh A, Verma R, Murari A, Agrawal A. Oral candidiasis: an overview. J. Oral Maxillofac. Pathol. 18(Suppl. 1), S81–S85 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Lewis MAO, Williams DW. Diagnosis and management of oral candidosis. Br. Dent. J. 223(9), 675–681 (2017). [DOI] [PubMed] [Google Scholar]
- 4.Costa-de-oliveira S, Rodrigues AG. Candida albicans antifungal resistance and tolerance in bloodstream infections: the triad yeast-host-antifungal. Microorganisms 8(2), 154 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Fuentefria AM, Pippi B, Dalla Lana DF, Donato KK, de Andrade SF. Antifungals discovery: an insight into new strategies to combat antifungal resistance. Lett. Appl. Microbiol. 66(1), 2–13 (2018). [DOI] [PubMed] [Google Scholar]
- 6.Al-Niaimi F, Chiang NYZ. Topical Vitamin C and the Skin: Mechanisms of Action and Clinical Applications. J. Clin. Aesthet. Dermatol. 10(7), 14–17 (2017). [PMC free article] [PubMed] [Google Scholar]
- 7.Van Hauwenhuyse F, Fiori A, Van Dijck P. Ascorbic acid inhibition of candida albicans Hsp90-mediated morphogenesis occurs via the transcriptional regulator Upc2. Eukaryot Cell 13(10), 1278–1289 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]; •• This study investigated Vitamin C mechanisms of action on Candida albicans strains.
- 8.Ojha R, Manzoor N, Khan LA. Ascorbic acid modulates pathogenecity markers of Candida albicans. Int. J. Microbiol. Res. 1(1), 19–24 (2009). [Google Scholar]; •• Interesting manuscript about Vitamin C modulatory effects on Candida albicans strains.
- 9.Avci P, Freire F, Banvolgyi A, Mylonakis E, Wikonkal NM, Hamblin MR. Sodium ascorbate kills Candida albicans in vitro via iron-catalyzed Fenton reaction: importance of oxygenation and metabolism. Future Microbiol. 11(12), 1535–1547 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]; •• Indicated that ascorbate may present antimicrobial effects against Candida albicans strains.
- 10.Lee AJ, Lim JW, Kim H. Ascorbic acid suppresses house dust mite-induced expression of interleukin-8 in human respiratory epithelial cells. J. Cancer Prev. 26(1), 64–70 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]; •• Demonstrated in a different model of infection that vitamin C may present an anti-inflammatory effect.
- 11.Mohammed Ahmed Yussif N, Abdul-Waniss Mohammed Abdul-Aziz M, Reda Abdel Rahman A. Evaluation of the anti-inflammatory effect of locally delivered vitamin C in the treatment of persistent gingival inflammation: clinical and histopathological study. J. Nutr. Metab. 2016, 2978741 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jablonská E, Kubásek J, Vojtěch D, Ruml T, Lipov J. Test conditions can significantly affect the results of in vitro cytotoxicity testing of degradable metallic biomaterials. Sci. Rep. 11, 6628 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.da Sampaio AG, Chiappim W, Milhan NVM, Botan Neto B, Pessoa R, Koga-Ito CY. Effect of the pH on the antibacterial potential and cytotoxicity of different plasma-activated liquids. Int. J. Mol. Sci. 23(22), 13893 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Suarez-Arnedo A, Torres Figueroa F, Clavijo C, Arbeláez P, Cruz JC, Muñoz-Camargo C. An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLOS ONE 15(7), e0232565 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Vitale RG. Role of antifungal combinations in difficult to treat candida infections. J. Fungi. 7(9), 731 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Böttger F, Vallés-Martí A, Cahn L, Jimenez CR. High-dose intravenous vitamin C, a promising multi-targeting agent in the treatment of cancer. J. Exp. Clin. Cancer Res. 40(1), 343 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zylinska L, Lisek M, Guo F, Boczek T. Vitamin C modes of action in calcium-involved signaling in the brain. Antioxidants 12(2), 231 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Aytekin Z, Arabacı T, Toraman A, Bayır Y, Albayrak M, Üstün K. Immune modulatory and antioxidant effects of locally administrated vitamin C in experimental periodontitis in rats. Acta Odontol. Scand. 78(6), 425–432 (2020). [DOI] [PubMed] [Google Scholar]
- 19.Lu SY. Oral candidosis: pathophysiology and best practice for diagnosis, classification, and successful management. J. Fungi 7(7), 555 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Tsukaguchi H, Tokui T, Mackenzie Bet al. A family of mammalian Na+-dependent L-ascorbic acid transporters. Nature 399(6731), 70–75 (1999). [DOI] [PubMed] [Google Scholar]
- 21.Ghahremani-Nasab M, Del Bakhshayesh AR, Akbari-Gharalari N, Mehdipour A. Biomolecular and cellular effects in skin wound healing: the association between ascorbic acid and hypoxia-induced factor. J. Biol. Eng. 17(1), 62 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Cho S, Chae JS, Shin Het al. Hormetic dose response to L-ascorbic acid as an anti-cancer drug in colorectal cancer cell lines according to SVCT-2 expression. Sci. Rep. 8(1), 11372 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Castellano-Pellicena I, Thornton MJ. Isolation of epidermal keratinocytes from human skin: the scratch-wound assay for assessment of epidermal keratinocyte migration. Methods Mol. Biol. 2154, 1–12 (2020). [DOI] [PubMed] [Google Scholar]
- 24.Chong WT, Tan CP, Cheah YK, Lai OM. In-vitro and in-vivo evaluations of tocotrienol-rich nanoemulsified system on skin wound healing. PLOS ONE 17(5), e0267381 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Chaitrakoonthong T, Ampornaramveth R, Kamolratanakul P. Rinsing with L-ascorbic acid exhibits concentration-dependent effects on human gingival fibroblast in vitro wound healing behavior. Int. J. Dent. 2020, 4706418 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Yi Y, Wu M, Zhou Xet al. Ascorbic acid 2-glucoside preconditioning enhances the ability of bone marrow mesenchymal stem cells in promoting wound healing. Stem Cell Res. Ther. 13(1), 119 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Savini I, Rossi A, Duranti G, Avigliano L, Catani MV, Melino G. Characterization of keratinocyte differentiation induced by ascorbic acid: protein kinase C involvement and vitamin C. J. Invest. Dermatol. 118(2), 372–379 (2002). [DOI] [PubMed] [Google Scholar]
- 28.Egusa H, Nikawa H, Makihira S, Yatani H, Hamada T. In vitro mechanisms of interleukin-8-mediated responses of human gingival epithelial cells to Candida albicans infection. Int. J. Med. Microbiol. 296(4–5), 301–311 (2006). [DOI] [PubMed] [Google Scholar]
- 29.Dongari-Bagtzoglou A, Kashleva H. Granulocyte-macrophage colony-stimulating factor responses of oral epithelial cells to Candida albicans. Oral Microbiol. Immunol. 18(3), 165–170 (2003). [DOI] [PubMed] [Google Scholar]
- 30.Griffiths JS, Camilli G, Kotowicz NK, Ho J, Richardson JP, Naglik JR. Role for IL-1 family cytokines in fungal infections. Front Microbiol. 12, 633047 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Gao Y, Liang G, Wang Qet al. Different host immunological response to C. albicans by human oral and vaginal epithelial cells. Mycopathologia 184(1), 1–12 (2019). [DOI] [PubMed] [Google Scholar]
- 32.Kang JS, Kim HN, Jung DJet al. Regulation of UVB-induced IL-8 and MCP-1 production in skin keratinocytes by increasing vitamin C uptake via the redistribution of SVCT-1 from the cytosol to the membrane. J. Invest. Dermatol. 127(3), 698–706 (2007). [DOI] [PubMed] [Google Scholar]
- 33.Bowie AG, O'Neill LAJ. Vitamin C inhibits NF-κB activation by TNF via the activation of p38 mitogen-activated protein kinase. J. Immunol. 165(12), 7180–7188 (2000). [DOI] [PubMed] [Google Scholar]
- 34.Gęgotek A, Skrzydlewska E. Antioxidative and anti-inflammatory activity of ascorbic acid. Antioxidants 11(10), 1993 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ghalibaf MHE, Kianian F, Beigoli Set al. The effects of vitamin C on respiratory, allergic and immunological diseases: an experimental and clinical-based review. Inflammopharmacology 31(2), 653–672 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Cárcamo JM, Bórquez-Ojeda O, Golde DW. Vitamin C inhibits granulocyte macrophage-colony-stimulating factor-induced signaling pathways. Blood 99(9), 3205–3212 (2002). [DOI] [PubMed] [Google Scholar]
- 37.Chen Y, Luo G, Yuan Jet al. Vitamin C Mitigates Oxidative Stress and Tumor Necrosis Factor-Alpha in Severe Community-Acquired Pneumonia and LPS-Induced Macrophages. Mediators Inflamm. 2014, 426740 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]; •• In this study, a different model of infection was performed, in which vitamin C showed anti-inflammatory effect.
- 38.Ness T, Abdallah M, Adams Jet al. Candida albicans-derived mannoproteins activate NF-κB in reporter cells expressing TLR4, MD2 and CD14. PLOS ONE 12(12), e0189939 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Lopes JP, Lionakis MS. Pathogenesis and virulence of Candida albicans. Virulence 13(1), 89–121 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
