#	Plasmid Name	Source	Figure	comments
1	lenti-GFP-Sec61β	GFP-Sec61β cloned and inserted into pLenti-pRRL-SV40(puro)_CMV	Fig. 1, Extended Data Fig. 1
2	lenti-BFP-CAAX	BFP-CAAX cloned and inserted into pLenti-pRRL-SV40(puro)_CMV	Extended Data Fig. 1, Fig. 3	CAAX motif of K-Ras protein (GKKKKKKSKTKCVIM) was cloned to the C-terminus of BFP
3	lenti-GFP-CAAX	GFP-CAAX cloned and inserted into pLenti-pRRL-SV40(puro)_CMV	Fig. 2
4	GFP-JPH2	Gift from Gea-Ny Tseng Lab	Fig. 3
5	mCherry-JPH2	Gift from Gea-Ny Tseng Lab	Fig. 3
6	GFP-Sec61β	Lab cloned	Fig. 3
7	mCherry-Sec61β	Lab cloned	Fig. 3,5
8	GFP-JPH3	Cloned from cDNA of U2OS cells	Fig. 3,4,5,6, Extended Data Fig. 3,7
9	GFP-JPH4	Cloned from cDNA of U2OS cells	Fig. 3
10	GFP-E-Syt2	Addgene #66831 (Pietro De Camilli Lab)	Fig. 3
11	mCherry-E-Syt2	Insert E-Syt2 in mCherry-C1 vector through restriction cutting sites	Extended Data Fig. 3
12	GFP-MAPPER	From Jen Liou Lab	Fig. 3, Extended Data Fig. 3
13	GB-CAAX	GB was cloned from Addgene #61020 plasmid (Robert Campbell lab), CAAX sequence was then added to the 3’ end of GB.	Extended Data Fig. 3
14	RA-Sec61β	RA was cloned from Addgene #61019 plasmid (Robert Campbell lab), Sec61β sequence was then added to the 3’ end of RA.	Extended Data Fig. 3
15	JPH2-Y141H	PCR from WT JPH2, inserted into pEGFP-C1 vector	Extended Data Fig. 4
16	JPH2-S101R	PCR from WT JPH2, inserted into pEGFP-C1 vector	Extended Data Fig. 4
17	JPH2-S165F	PCR from WT JPH2, inserted into pEGFP-C1 vector	Extended Data Fig. 4
18	GFP-Δ8MORNΔLCR	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
19	GFP-Δ8MORN	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
20	GFP-ΔLCR	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
21	GFP-LCR	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
22	GFP-LCR-KRtoA	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
23	GFP-LCR-TM	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
24	GFP-8MORN	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
25	GFP-8MORN_LCR	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
26	GFP-8MORN-αHelix	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
27	GFP-JPH3-Sec61β	PCR from WT JPH3, and Sec61β, inserted into pEGFP-C1 vector	Fig. 5	Sequence of the TM domain of Sec61β used:VGPVPVLVMSLLFIASVFMLHIWGKYTRS
28	GFP-JPH3:8MORN_LCR-αHelix	PCR from WT JPH3, inserted into pEGFP-C1 vector	Fig. 5
29	GFP-JPH2:8MORN_LCR-αHelix	PCR from WT JPH2, inserted into pEGFP-C1 vector	Fig. 5
30	GFP-JPH4:8MORN_LCR-αHelix	PCR from WT JPH4, inserted into pEGFP-C1 vector	Fig. 5
31	mCherry-8MORN_LCR	PCR from WT JPH3, inserted into pmCherry-C1 vector	Fig. 6, Extended Data Fig. 6
32	mCherry-LCR	PCR from WT JPH3, inserted into pmCherry-C1 vector	Fig. 6
33	lenti-BFP-shScramble	Addgene #1864 (David Sabatini lab)	Fig. 6
34	lenti-BFP-shClathrin-1	shRNAs are cloned in the pLKO.1 vector from Addgene # 8453. We replaced the puromycin resistant sequence in the pLKO.1 vector with a sequence encoding EBFP2.	Fig. 6	target seq: CGGTTGCTCTTGTTACGGATA
35	lenti-BFP-shClathrin-2	Same as above	Fig. 6	target seq: CGTGTTCTTGTAACCTTTATT
36	lenti-BFP-shCAVIN1-1	Same as above	Fig. 6	target seq: AACTTTAAAGTCATGATCTAC
37	lenti-BFP-shCAVIN1-2	Same as above	Fig. 6	target seq: CCTTCCACGTCAAGAAGATCC
38	lenti-BFP-shCAV1-1	Same as above	Fig. 6	target seq: CCACCTTCACTGTGACGAAAT
39	lenti-BFP-shCAV1-2	Same as above	Fig. 6	target seq: GCTTTGTGATTCAATCTGTAA (UTR)
40	lenti-iRFP-shCAV2-1	Same as above, but the fluorescent protein (FP) sequence was of iRFP	Fig. 6	target seq: CCTCTTTGAAATCAGCAAATA
41	lenti-iRFP-shCAV2-2	Save as above	Fig. 6	target seq: CAACTGAGCCAGGATTGAATA
42	lenti-BFP-shEHD1-1	Save as above, FP: EBFP2	Fig. 6	target seq: CGCTTTCCTCAACAGGTTCAT
43	lenti-BFP-shEHD1-2	Save as above	Fig. 6	target seq: CGTTAGAGGCTGCGTTCTTTG
44	lenti-mCherry-shEHD2-1	Save as above, FP: mCherry	Fig. 6	target seq: GCGAGTTCACGCTTACATCAT
45	lenti-mCherry-shEHD2-2	Save as above	Fig. 6	target seq: ATCCGTCATTCATTCAAATAT
46	lenti-iRFP-shEHD4-1	Save as above, FP: iRFP	Fig. 6	target seq: ACCACTGACTCACCGAATGAC
47	lenti-iRFP-shEHD4-2	Save as above	Fig. 6	target seq: TCAGCAGGCTACCGGAAATCT
48	lenti-BFP-shBIN1-1	Save as above, FP: EBFP2	Extended Data Fig. 7	target seq: CCCGACATCAAGTCACGCAT
49	lenti-BFP-shBIN1-2	Save as above	Extended Data Fig. 7	target seq: TGTGTCCTCTAGTTGAGTTTC
50	EHD4-GFP	Cloned from cDNA of U2OS cells	Fig. 6, Extended Data Fig. 5, 6
51	EHD4-mCherry	Cloned from cDNA of U2OS cells	Fig. 6, Extended Data Fig. 5
52	EHD1-GFP	Cloned from cDNA of U2OS cells	Extended Data Fig. 5
53	EHD2-GFP	Cloned from cDNA of U2OS cells	Extended Data Fig. 5
54	mCherry-STIM1	Gift from Richard Lewis Lab	Fig. 4
55	ORAI1-GFP	Gift from Richard Lewis Lab	Fig. 4