Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | DDX6 | GenBank | HGNC:2747 | |
| Strain, strain background (Escherichia coli) | BL21 Star (DE3) | Thermo Fisher | Invitrogen: C601003 | |
| Cell line (H. sapiens) | HEK293T | ATCC | CRL-3216 | Identity authenticated by SRT profiling, negative for mycoplasma. |
| Cell line (H. sapiens) | HEK293T DDX6 KO | Elisa Izaurralde Lab | Hanet et al., 2019 | Developed and maintained by Elisa Izaurralde lab, identity authenticated by SRT profiling, negative for mycoplasma. This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (E. coli) | pnEK-NvHM-Strep-MBP | Elisa Izaurralde Lab | Chang et al., 2019 | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (E. coli) | pETM-60-NusA-3C-HsRCK_296–472-Strep | Elisa Izaurralde Lab | Addgene #146209 | Addgene #146209 |
| Transfected construct (H. sapiens) | pT7-EGFP-C1-MBP | Elisa Izaurralde Lab | Addgene #146318 | Addgene #146318 |
| Transfected construct (H. sapiens) | pT7-EGFP-C1-HsDDX6 | Elisa Izaurralde Lab | Addgene #25033 | Addgene #25033 |
| Transfected construct (H. sapiens) | pT7-EGFP-C1-HsDDX6_1–295 | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pT7-EGFP-C1-HsDDX6_296–463 | Elisa Izaurralde Lab | Addgene #145971 | Addgene #145971 |
| Transfected construct (H. sapiens) | pT7-EGFP-C1-HsDDX6_E236Q | Elisa Izaurralde Lab | Addgene #146456 | Addgene #146456 |
| Transfected construct (H. sapiens) | pT7-EGFP-C1-HsDDX6_Mut1 | Elisa Izaurralde Lab | Addgene #147023 | Addgene #147023 |
| Transfected construct (H. sapiens) | pT7-EGFP-C1-HsDDX6_Mut2 | Elisa Izaurralde Lab | Addgene #148452 | Addgene #148452 |
| Transfected construct (H. sapiens) | pCIneo-HA-RPL22 | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-RLuc | Elisa Izaurralde Lab | Addgene #146090 | Addgene #146090 |
| Transfected construct (H. sapiens) | pCIneo-RLuc_ 30xRC | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-RL-AR | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-RL-Stop-AR | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-RL-BMP2 | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-RL-Stop-BMP2 | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-v5-SBP-MBP-MS2 | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-RL-6xMS2bs | Elisa Izaurralde Lab | Addgene #148306 | Addgene #148306 |
| Transfected construct (H. sapiens) | pCIneo-RL-AR-6xMS2bs | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Transfected construct (H. sapiens) | pCIneo-RL-BMP2-6xMS2bs | Elisa Izaurralde Lab | This paper | This material can be obtained from the Elisa Izaurralde Lab. |
| Antibody | anti-GFP (Rabbit polyclonal) | Elisa Izaurralde Lab | Chen et al., 2014 | IP (This material can be obtained from the Elisa Izaurralde Lab.) |
| Antibody | anti-GFP (Mouse monoclonal) | Roche | Roche #11814460001 | WB(1:2000) |
| Antibody | anti-HA-HRP (Mouse monoclonal) | Roche | Roche #12013819001 | WB(1:5000) |
| Antibody | anti-CNOT1 (Rabbit polyclonal) | Elisa Izaurralde Lab | Chen et al., 2014 | WB(1:1000) |
| Antibody | anti-DDX6 (Rabbit polyclonal) | Bethyl, A300-461Z | Bethyl #A300-461Z | WB(1:1000) |
| Antibody | anti-RPS3A (Rabbit polyclonal) | Abcam | Abcam #ab264368 | WB(1:1000) |
| Antibody | anti-V5 (Mouse monoclonal) | BioRad | BioRad #MCA1360GA | WB(1:5000) |
| Antibody | anti-Tubulin (Mouse monoclonal) | Sigma Aldrich | Sigma Aldrich #T6199 | WB(1:3000) |
| Sequence-based reagent | AR_F | This paper | qPCR primers | gacatgcgtttggagactgcca |
| Sequence-based reagent | AR_R | This paper | qPCR primers | cccagagtcatccctgcttcat |
| Sequence-based reagent | BMP2_F | This paper | qPCR primers | cccagagtcatccctgcttcat |
| Sequence-based reagent | BMP2_R | This paper | qPCR primers | cagcaacgctagaagacagcgg |
| Sequence-based reagent | LGALS1_F | This paper | qPCR primers | ctcaaacctggagagtgccttc |
| Sequence-based reagent | LGALS1_R | This paper | qPCR primers | tcgtatccatctggcagcttga |
| Sequence-based reagent | PSMB9_F | This paper | qPCR primers | cttttgccattggtggctccgg |
| Sequence-based reagent | PSMB9_R | This paper | qPCR primers | ccataccaggttttggccctag |
| Sequence-based reagent | GAPDH_F | This paper | qPCR primers | ctctgctcctcctgttcgacag |
| Sequence-based reagent | GAPDH_R | This paper | qPCR primers | ttcccgttctcagccttgacgg |
| Sequence-based reagent | Beta-Actin_F | This paper | qPCR primers | ccaaaagcatgacaggcagaaa |
| Sequence-based reagent | Beta-Actin_R | This paper | qPCR primers | tcccgtgttcctcaccaatcat |
| Sequence-based reagent | DLX5_F | This paper | qPCR primers | CAGCCATGTCTGCTTAGACCAG |
| Sequence-based reagent | DLX5_R | This paper | qPCR primers | TACTGGTAGGGGTTGAGAGCTT |
| Sequence-based reagent | ENO2_F | This paper | qPCR primers | ATGTGTCACTTGTGCTTTGCTC |
| Sequence-based reagent | ENO2_R | This paper | qPCR primers | ACCCCAGTCATCTTGGGATCTA |
| Commercial assay or kit | RNeasy Mini Kit | Qiagen | Qiagen 74104 |
|
| Commercial assay or kit | TruSeq RNA Library Prep Kit v2 | Illumina | Illumina RS-122–2002 |
|
| Commercial assay or kit | Ribo-Zero Gold Kit | Illumina | discontinued | |
| Chemical compound, drug | Actinomycin D | Sigma-Aldrich | Sigma-Aldrich #A1410 | |
| Software, algorithm | Bowtie2 | Langmead and Salzberg, 2012 | ||
| Software, algorithm | Tophat2 | Kim et al., 2013 | ||
| Software, algorithm | QuasR | Gaidatzis et al., 2015 | ||
| Software, algorithm | edgeR | Robinson et al., 2010; McCarthy et al., 2012 | ||
| Software, algorithm | RiboDiff | Zhong et al., 2017 | ||
| Software, algorithm | Integrative Genomics Viewer (IGV) | Broad Institute; Robinson et al., 2011; Thorvaldsdóttir et al., 2013 |
||
| Software, algorithm | goseq | Young et al., 2010 |