Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2024 Jun 4;103(8):103942. doi: 10.1016/j.psj.2024.103942

Lactobacillus salivarius ameliorates Mycoplasma gallisepticum-induced inflammation via the JAK/STAT signaling pathway involving respiratory microbiota and metabolites

Kexin Wang *,1, Yusong Miao *,†,1, Weiqi Liu *, Ishfaq Muhammad ‡, Jiaxin Bao *, Xiaodi Jin *, Zhiyong Wu *, Rui Li *, Chunli Chen *,§, Jichang Li *,2
PMCID: PMC11246048  PMID: 38908119

Abstract

Mycoplasma gallisepticum (MG) can cause chronic respiratory disease (CRD) in chickens, which has a significant negative economic impact on the global poultry sector. Respiratory flora is the guardian of respiratory health, and its disorder is closely related to respiratory immunity and respiratory diseases. As a common probiotic in the chicken respiratory tract, Lactobacillus salivarius (L. salivarius) has potential antioxidant, growth performance enhancing, and anti-immunosuppressive properties. However, the specific mechanism through which L. salivarius protects against MG infection has not yet been thoroughly examined. This study intends to investigate whether L. salivarius could reduce MG-induced tracheal inflammation by modulating the respiratory microbiota and metabolites. The results indicated that L. salivarius reduced MG colonization significantly and alleviated the anomalous morphological changes by using the MG-infection model. L. salivarius also reduced the level of Th1 cell cytokines, increased the level of Th2 cell cytokines, and ameliorated immune imbalance during MG infection. In addition, L. salivarius improved the mucosal barrier, heightened immune function, and suppressed the Janus kinase/Signal transducer, and activator of transcription (JAK/STAT) signaling pathway. Notably, MG infection changed the composition of the respiratory microbiota and metabolites, and L. salivarius therapy partially reversed the aberrant respiratory microbiota and metabolite composition. Our results highlighted that these findings demonstrated that L. salivarius played a role in MG-mediated inflammatory damage and demonstrated that L. salivarius, by altering the respiratory microbiota and metabolites, could successfully prevent MG-induced inflammatory injury in chicken trachea.

Key words: mycoplasma gallisepticum, lactobacillus salivarius, inflammation, respiratory microbiota, immune function

INTRODUCTION

Mycoplasma gallisepticum (MG) is a wall-less prokaryotic microorganism. It is the primary cause of chronic respiratory disease (CRD) and severe inflammation in chickens. This disease affects flocks indefinitely, can spread vertically or horizontally, and has a considerable negative influence on the chicken industry (Li, et al., 2019; Marouf, et al., 2022). MG adheres to the surface of the respiratory mucosa through adhesion and pathogenicity proteins and multiplies, damaging the respiratory mucosal barrier and causing respiratory tract inflammation (Zou, et al., 2022). The specific mechanism of MG infection-induced respiratory inflammation is unknown (Yu, et al., 2019; Mahdizadeh, et al., 2021). At present, the most commonly used treatments for treating respiratory pathogens like MG and assisting in the prevention of respiratory infections in chickens are antimicrobials like Tylosin and Tilmicosin (Huang, et al., 2019; Kamathewatta, et al., 2024). Treatment with antibacterials, however, does not eliminate respiratory infections. Prolonged use of antibiotics in the clinical context may make treatment programs more challenging for bacterial infections, including MG infections (Kleven, 2008; Wang, et al., 2020b). Therefore, the focus of future research should be to identify non-antibiotic options for the management and prevention of MG infections. Probiotics including Lactobacillus salivarius (L. salivarius) are attractive candidates for treatment options that target the respiratory microbiota and increase resistance to respiratory pathogenic microbial assault (Zhao, et al., 2023). These interventions have shown promise in recent years.

Poultry respiratory systems are unique, and via the use of culture-based methods and sequencing of bacterial 16S rRNA genes found in the samples, the animal autopsy has recovered a variety of fungi and bacteria from the respiratory tracts of model chickens that are healthy or ill (Kawaguchi, et al., 1992). Animal health is frequently related to the communities of microbes found in the respiratory system (Man, et al., 2017). In chickens of different ages, notable variations were noted in the structure, variety, and quantity of respiratory microbial communities (Zeineldin and Barakat, 2023). The community's structure significantly influences how susceptible chickens are to infections (Abaidullah, et al., 2019). As the guardian of respiratory health, the microbial community has a direct connection to the host's overall health (Li, et al., 2024). The host-microbiota is disrupted by pathogenic microbial infections, and any disturbance of the respiratory flora can lead to more serious illnesses (Luo, et al., 2024). Mycoplasma infections are typically followed by other diseases caused by bacteria or viruses(Li, et al., 2021). It is crucial to thoroughly investigate the connection between respiratory microbiota interactions and MG infections to battle MG infections, as the relationship between the 2 is still unknown.

Among the common microbial communities in poultry, Firmicutes and Bacteroidetes are the most dominant bacterial species in the chicken respiratory flora, with Lactobacillus having the ability to enhance mucosal immune responses (Brisbin, et al., 2015). L. salivarius FFIG58 had a remarkable ability to enhance the protection against secondary pneumococcal infection by modulating the respiratory immune response (Elean, et al., 2023). L. salivarius SNK-6 activates the intestinal mucosal immune system by regulating cecal microbial community structure in laying hens (Liu, et al., 2022). L. salivarius is an important member of the avian respiratory flora (Kawaguchi et al., 1992), and in a previous study, we found that when MG infection caused a highly significant reduction of L. salivarius in the respiratory tract of chicks (Wang, et al., 2020a). A significant ingredient in probiotic products, L. salivarius is crucial to the health of both humans and animals (Jia, et al., 2019). Live L. salivarius bacterial components and metabolites strongly activate T-cells and macrophages in vivo and ex vivo, effectively stimulating the release of inflammatory cytokines (Quinteiro-Filho, et al., 2015). L. salivarius can attenuate glycemic levels and inflammatory cytokines in patients with type 1 diabetes mellitus (Zhou, et al., 2022). Whether L. salivarius supplementation corrects host respiratory flora abnormalities to strike MG is currently unknown. The objective of our study was to evaluate the protective function of L. salivarius in the treatment of MG infection and to explain some of the underlying molecular mechanisms driving the regulation of respiratory microbiota and metabolites. Furthermore, this study can provide theoretical and scientific support for using L. salivarius to counteract the financial losses caused by MG in the poultry industry.

MATERIALS AND METHODS

Mycoplasma Strain Culture

The MG strain Rlow was provided by the Harbin Institute of Veterinary Medicine, Chinese Academy of Agricultural Science. MG was grown on a modified Hayflicks medium as mentioned in a previous study(Cai, et al., 2008). The medium color change of MG shifts from phenol red to orange during the mid-exponential phase. Then the concentration of the bacterial solution to 1 × 109 color change units per milliliter (CCU/mL) was accurately adjusted for the following experiment.

Lactobacillus salivarius Isolation and Culture

The 16S rRNA sequence of L. salivarius was isolated from the feces of our SPF White Laihang chickens' excrement and submitted to GenBank (GenBank no. MT378407). L. salivarius was intranasally treated with final concentrations of 109, 107, and 105 CFU/mL after being cultured in MRS broth medium for 12 h at 37°C (Wang et al., 2020b; Wang, et al., 2021b).

Chickens and Treatments

Forty 1-day-old healthy white leghorn chickens were purchased from Xianfeng Guangda chicken farm (Harbin, China). We tested the purchased chickens for MG and common pathogens before conducting all experiments, and the results were negative. We maintained the experimental animals under pathogen-free conditions and unrestrictedly supplied them with sterilized food and drink by the Guidelines for Ethical Review of Laboratory Animals - Animal Welfare (GB/T 35892-2018, National Standard of the People's Republic of China). The animals were divided into 4 experimental groups (10 animals/group): A: Control group; B: MG group; C: MG group treated with L. salivarius (MG+L. salivarius group); D: L. salivarius alone treated group (L. salivarius group). Groups A and B were both intranasally treated twice daily with 50 mL of PBS starting on d 1. L. salivarius group and MG+ L. salivarius group 1-day-old chickens were intranasally treated with 50 μL of L. salivarius from d 1 to d 7, twice a day, L. salivarius group (107 CFU/mL) and MG+ L. salivarius group (109, 107, and 105 CFU/mL). MG-infected group and MG + L. salivarius group chickens were inoculated with MG strain Rlow (1 × 109 CCU/mL) in the caudal thoracic air sac on d 7(Ishfaq, et al., 2020). After being infected for 3 d, the chickens were euthanized, and tracheal tissue, blood, and samples of respiratory tract lavage fluid (RTLF) were obtained for further analysis. (Figure 1).

Figure 1.

Figure 1

Open in a new tab

Schematic diagram of the experimental group in this study. The information is displayed in the Materials and Methods section for the experimental chicken groups.

Mycoplasma Quantification

The method for quantification of MG abundance was as previously described (Gao, et al., 2017). In brief, the absolute content of MG was determined by quantitative PCR (qPCR) using a recombinant plasmid containing the cloned mgc2 gene. DNA was isolated from chicken tracheal tissues using the E.Z.N.A. Bacterial DNA Kit (Omega Bio-Tek, Inc., Norcross, GA) according to the manufacturer's instructions. DNA was directly applied to a qPCR, and a standard curve was established by a standardized PCR amplicon. PCR amplification of the mgc2 gene as part of the MG genomic DNA and sequencing (Synbio-tech, Suzhou, China). The primers were as follows: mgc2-F: 5′-TTGGGTTTAGGGATTGGGATT; mgc2-R: 5′-CCAAGGGATTCAACCATCTT(Wang, Ishfaq, Fan, Chen and Li, 2020a). PCR conditions: 95°C-5 min, 95°C-10 s, 55°C-30 s, 72°C-60 s, 39 cycles.

Histopathological and Ultrastructural Observations

As described previously, hematoxylin and eosin (HE) staining was used for histopathological examination (Ishfaq, et al., 2021). Briefly, A series of ethanol solutions were used to dehydrate appropriately sized trachea specimens after they had been fixed in 10% neutral formalin for at least 24 h. Afterward, the paraffin was embedded in the samples and the slices were prepared. Then the sections were stained with hematoxylin and eosin dye, and observed under a light microscope (Nikon ECLIPSE E100, 40 × magnification).

Fixation of tracheal specimens was carried out with glutaraldehyde at a concentration of 2.5% for 1 wk. Then the specimens were washed with PBS twice for 20 min and postfixed in 1% osmium tetroxide at 4°C for 1 h, dehydrated in a series of ethanol, and polymerized in epoxy resin. Transmission electron microscopy (TEM, JEOL Ltd, Tokyo, Japan) was used to examine ultrathin sections stained with lead dye. The samples were dried for 4 h, and a metal film was plated on the surface of 1 mm3 tracheal tissue with ion sputtering coating equipment; and then analyzed by scanning electron microscopy (SEM, SU8010, HITACHI., Ltd. Japan) (Zhang, et al., 2020).

Measurement of Cytokine Activity by ELISA

An enzyme-linked immunosorbent assay (ELISA) kit was used to extract and analyze each group of chicken trachea samples according to the manufacturer's instructions (Beijing Cheng Lin Biological Technology Co., Ltd.). Detection of the inflammatory factors IFN-γ, T-bet, IL-4, and GATA-3 (Wu, et al., 2019).

Total RNA Extraction and qRT-PCR

RNA was extracted from chicken trachea samples using the TRIzol reagent (Invitrogen Inc., Carlsbad, CA) following the instructions and reverse transcribed into cDNA by One-Step PrimeScript RT-PCR Kit (Takara Biomedical Technology (Beijing) Co., Ltd.). Quantitative RT-PCR was performed using LightCycler 96 (Roche, Basel, Switzerland)(Wu, et al., 2020). Table 1 displays the primer sequences for each gene. The data were quantified using the 2-ΔΔCt method, with the GAPDH gene serving as the internal standard.

Table 1.

List of primers used in qRT-PCR.

Genes Primers (from 5′ to 3′) Primers origin
IFN-γ F: AAGCCGCACATCAAACACATATC
R: GTCGTTCATCGGGAGCTTGG		 NM-205149.1
IL-12p40 F: CCTGTGGCTCGCACTGATAA
R: ATCTCAGTCGGCTGGTGCTC		 DQ202328.1
IL-4 F: TCTTCCTCAACATGCGTCAG
R: GGTCTGCTAGGAACTTCTCCAT		 NM-1007079.1
GATA-3 F: AGCCACATTTCACCCTTCAGTCAC
R: AAGGAGAGGCTGGATGGAGGATG		 NM_001008444.1
JAK2 F: CCTTTGAAGATCGGGACCCAACAC
R: TTCACAGCCACCACCTCTCCAG		 NM_001030538.2
TYK2 F: GACGCTGTACGAACTGCTGACC
R: CCGCTCTCCAGGACCTCCATC		 XM_025145739.1
Claudin-1 F: CATACTCCTGGGTCTGGTTGGT
R: GACAGCCATCCGCATCTTCT		 NM-001013611.2
Occludin F: GGTTCCTCATCGTCATCCTGCTC
R: GCCTCGTTCTTCACCCACTCCT		 NM-205128.1
ZO-1 F: CTTCAGGTGTTTCTCTTCCTCCTC
R: CTGTGGTTTCATGGCTGGATC		 XM-413773
GAPDH F: GGTAGTGAAGGCTGCTGCTGATG
R: AGTCCACAACACGGTTGCTGTATC		 NM-204305
Open in a new tab

Western Blot

The tracheal tissues were homogenized in RIPA lysis buffer (Beyotime, China) with 1% PMSF (Beyotime, China) and then centrifuged at 12,000 × g for 10 min at 4°C. A BCA kit (P0012S, Beyotime, China)was used to detect the protein concentration, and then equal amounts of protein were loaded and separated by SDS-PAGE (10–12%) and transferred to PVDF membranes (Millipore, Bedford). Primary antibodies for Claudin-1 (WL03073, Wanleibio, Shenyang, China), Occludin (WL01996, Wanleibio, Shenyang, China), ZO-1 (WL03419, Wanleibio, Shenyang, China), TLR4 (bs-20379R, Bioss, Beijing, China), IL-12Rβ2 (bs-2604R, Bioss, Beijing, China), TYK2 (bs-6662R, Bioss, Beijing, China), p-STAT4 (bs-3430R, Bioss, Beijing, China) and GAPDH (A5028, Bimake) (all at 1:1000 dilution) protein were incubated for 12 h at 4°C. Secondary anti-rabbit IgG horseradish peroxidases were incubated for 1.5 h. The density of the protein bands was measured with ImageJ software (V 1.42, National Institutes of Health) (Hu, et al., 2021).

Flow Cytometry Analysis

The separation of chicken peripheral blood lymphocytes from blood samples was accomplished using a kit (LTS1090C, Tianjin Haoyang Biological Manufacture Co., Ltd.). Each sample received the fluorescent antibodies Mouse Anti-Chicken CD3+-FITC (SouthernBiotech), Mouse Anti-Chicken CD4+-PE (SouthernBiotech), and Mouse Anti-Chicken CD8α+-APC (SouthernBiotech). Using flow cytometry (Coulter Epics XL, Beckman Coulter, United States), the CD4+/CD8α+ ratio was measured(Wang, et al., 2019).

16S rRNA Amplicon Sequencing, Data Processing, and Analysis

16S rRNA sequencing was performed as previously described (Wang et al., 2020a). To create amplicons, variable 3–4 regions of the bacterial 16S rRNA gene were chosen with the following primers: 338F: (5′-ACTCCTACGGGAGGCAGCA-3′) and 806R: (5′-GGACTACHVGGGTWTCTAAT-3′). The PCR program was set as follows: 94°C-3 min, 30 cycles of 94°C-30 s, 56°C-45 s, 72°C-45 s, and final extension at 72 °C for 10 min. Sequencing was performed by Shanghai Personal Biotechnology Limited Company (Shanghai, China) using the Illumina MiSeq sequencing platform (Illumina, Personal Biotechnology Limited Company, Shanghai, China). OTU-level alpha (Chao1 and Shannon index) and beta [principal coordinates analysis (PCoA)] diversity were calculated using QIIME. An analysis of bacterial taxa results was conducted based on the LDA effect size (LEfSe). PICRUSt software was used to predict KEGG and COG functions. R package for plotting bar plots and heatmaps of classification levels(Chen, et al., 2020).

Non-Targeted Metabolomics Study on Respiratory Tract Lavage Fluid

RTLF samples of groups A, B, C, and D groups were examined by the LC-MS system as follows. Briefly, chromatographic separations were performed using an ultra-performance liquid chromatography (UPLC) system (Waters, UK) and an ACQUITY UPLC® HSS T3 column (150 × 2.1 mm, 1.8 μm). On a high-resolution mass spectrometer QE (Thermo), mass spectrometry (MS) was carried out. Both positive and negative ion modes of operation were used for the QE. The spray voltages were set to 3.5 kV for positive ion modes and 2.5 kV for negative ion modes in the detailed parameters. Proteowizard (v3.0.8789) and the metabolomics R package (v3.3.2)[35] were used to analyze the collected MS data, and metabolite identification was based on the KEGG database.

Statistical Analysis

All data are shown as the mean ± standard deviation (mean ± SD) of 3 or more independent experiments. Statistical analyses were performed by 1-way ANOVA and LSD post hoc test using SPSS 22.0 software (IBM, Armonk, NY). The significance was set at a P value ≤ 0.05 or 0.01.

RESULTS

L. salivarius Attenuated MG Colonization in the Trachea

qRT-PCR was used to detect the quantitative expression of the MG virulence gene mgc2 in chicken tracheal tissue. The amount of MG colonization in the MG group trachea significantly increased (Figure 2). Moreover, we found that L. salivarius (109 and 107 CFU/mL) treatment significantly reduced MG colonization.

Figure 2.

Figure 2

Open in a new tab

Effect of L. salivarius on MG trachea burden (n = 6). Each point represents a chicken, and the horizontal line represents the average value.

L. salivarius Alleviated MG-Induced Tracheal Damage

To comprehend the effects of MG infection on the chickens' trachea, pathological and ultrastructural observations were made (Figure 3). Histopathological examination revealed that the chicken trachea was infected with MG, which resulted in a significant loss of cilia and an increased mucosal thickness (Figure 3B). In the MG group, SEM revealed that the cilia were severely exfoliated and broken (Figure 3H). As a result of MG infection, TEM revealed that the cilia were ruptured, inverted, and reduced in number (Figure 3N). In contrast, tracheal tissue micrographs in the Control group showed normal morphology and appearance (Figures 3A, 3G, and 3M) and L. salivarius alone group (Figures 3F, 3L, and 3R). However, after treatment with L. salivarius (109 and 107 CFU/mL), the abnormal morphology and structural deterioration were partially protected, and MG-induced tracheal damage was remarkably restored (Figures 3C, 3D, 3I, 3J, 3O, and 3P). L. salivarius (105 CFU/mL) treatment partially alleviated histopathological symptoms (Figures 3E, 3K, and 3Q). These findings demonstrated that 107 CFU/mL is the ideal concentration of L. salivarius treatment for MG-infected chicken in subsequent experiments.

Figure 3.

Figure 3

Open in a new tab

Pathological and ultrastructural examination of chicken trachea (A, G, and M from the Control group; B, H, and N from the MG group; C, I, and O from the MG+ L. salivarius (109 CFU/mL) group; D, J, and P from the MG + L. salivarius (107 CFU/mL) group; E, K and Q from the MG+ L. salivarius (105 CFU/mL) group; F, L and R from the L. salivarius (107 CFU/mL) group). Paraffin sections of tracheal tissues in each experimental group were observed through light microscopy (40 × magnification). Tracheal tissues in each experimental group were examined by SEM (2 500 × magnification) and TEM (8 000 × magnification). (A), (G) and (M) The red circle shows that the abundant cilia were well arranged and only a small amount of inflammatory cell infiltration was noted. (B), (H) and (N) The blue circle indicates that the cilia were severely exfoliated and that there was a greater quantity of inflammatory cell infiltration. (C), (I) and (O) The red square shows that there were more dense and intact cilia. (D), (J) and (P) The blue square reveals that only a small number of cilia ruptured and shed. (E), (K) and (Q) The red triangle reveals that the cilia were broken. (F), (L) and (R) The blue triangle shows that there were many abundant and uniformly arranged cilia.

Repression of Inflammatory Cytokines in the Trachea by L. salivarius

The results of tracheal tissue inflammatory cytokines are shown in Figure 4. IFN- and T-bet levels clearly increased in response to MG infection, and IL-4 and GATA-3 activities were significantly reduced (all P < 0.01). We observed that treatment with L. salivarius appeared to restore the normal levels of these inflammatory cytokines.

Figure 4.

Figure 4

Open in a new tab

Effect of L. salivarius and/or MG-infection on the enzyme activities of cytokines, including (A–D) IFN-γ, T-bet, IL-4, and GATA-3, detected by ELISA in chicken trachea. All bar graphs show the mean results ± SD (n = 3). The values with a star differ significantly (0.01 < *P < 0.05; ⁎⁎P < 0.01) among groups.

Figures 5A–5D shows the effect of MG infection on Th1 and Th2 cytokine mRNA expression. The mRNA expression of Th1 cytokine, including IFN-γ and IL-12p40, was significantly increased in tracheal tissues, and the mRNA expression of Th2 cytokines including IL-4 and GATA-3, was decreased in the MG group compared to the control group (P < 0.05). However, L. salivarius treatment remarkably restored the normal levels of Th1 and Th2 cytokine mRNA expression. It was discovered that the Janus kinase/Signal transducer, and activator of transcription (JAK/STAT) pathway-related genes JAK2 and TYK2 had increased mRNA levels in the MG group compared to the Control group. L. salivarius treatment largely reduced JAK2 and TYK2 mRNA expression under MG infection (Figures 5E–5F, P < 0.05). Moreover, L. salivarius treatment alone had no discernible impact on these inflammatory cytokines when compared to the Control group. The host mucosal barrier needs to provide defense against pathogens. It is therefore important to determine whether MG disrupts the mucosal barrier and results in host infection. The findings demonstrated that MG infection significantly decreased the mRNA levels of tight junction-related genes in the trachea, including Claudin-1, Occludin, and ZO-1(Figures 5G–5I, all P < 0.01). However, L. salivarius treatment effectively alleviated the reduction in the expression of these cytokines during MG infection. (P < 0.05).

Figure 5.

Figure 5

Open in a new tab

Effect of L. salivarius and/or MG infection on inflammation-related genes, JAK/STAT signaling pathway-related genes, and tight junction-related gene mRNA measured in the chicken trachea. Inflammation-related gene mRNA expression levels including (A–D) IFN-γ, IL-12p40, IL-4, and GATA-3; JAK/STAT signaling pathway-related gene mRNA expression levels including (E) JAK2 and (F)TYK2; tight junction-related gene mRNA expression levels including (G) Claudin-1, (H) Occludin and (I) ZO-1. Bar graphs represent the mean results ± SD (n = 3). 0.01 < *P < 0.05 and ⁎⁎P < 0.01 represent statistically significant differences compared to the Control group. 0.01 < #P < 0.05 and ##P < 0.01 represent statistically significant differences compared to the MG group.

L. salivarius Protected the Host Mucosal Barrier and Suppressed the JAK/STAT Signaling Pathway

The respiratory mucosal barrier is crucial in preventing the invasion of exogenous pathogenic microorganisms. The expression of tight junction proteins reflects the host mucosal barrier function of the respiratory mucosa. According to the western blot results (Figure 6), MG infection reduced the expression of the tight junction proteins Claudin-1, Occludin, and ZO-1 in comparison to the Control group (all P < 0.05). Meanwhile, L. salivarius prevented the expression levels of tight junction proteins from declining under MG infection. Additionally, MG infection markedly increased the expression of the JAK/STAT signaling pathway-related proteins TLR4, IL-12R2, TYK2, and p-STAT4 (all P < 0.01). In contrast, L. salivarius treatment resulted in a reduction (P < 0.05) in the protein expression levels of the JAK/STAT signaling pathway when compared to the MG group. The results above demonstrated that L. salivarius treatment restored the host's mucosal barrier function following MG infection and that L. salivarius significantly reduced the activation of the JAK/STAT signaling pathway.

Figure 6.

Figure 6

Open in a new tab

Effect of L. salivarius and/or MG infection on tight junction-related proteins and JAK/STAT signaling pathway correlative protein expression measured in chicken trachea. Protein expression levels of Claudin-1, Occludin, ZO-1, TLR4, IL-12Rβ2, TYK2, and p-STAT4 were examined using Western blot, and GAPDH was used as an internal control. The values with a star differ significantly (0.01 < *P < 0.05; ⁎⁎P < 0.01) among groups.

L. salivarius Improved Chicken Immune Function

The ratio of serum CD4+T to CD8+T lymphocytes was measured to investigate whether MG infection altered chicken immunity. As a result of MG infection, chicken blood contained fewer CD4+T/CD8+T cells in comparison with the control group (P < 0.01) (Figure 7). L. salivarius treatment significantly increased the ratio of CD4+T/CD8+T cells under MG infection (P < 0.01). When comparing the L. salivarius treatment group to the MG group, a significant difference was found. These findings suggested that L. salivarius had a positive impact on immune function and that MG infection significantly suppressed immune function in chickens.

Figure 7.

Figure 7

Open in a new tab

Effect of L. salivarius and/or MG infection on CD4+T and CD8+T lymphocyte parameters measured in chicken blood. The percentage of CD4+T or CD8+T lymphocytes in the blood of the (A) control group, (B) MG group, (C) MG + L. salivarius group and (D) L. salivarius group chickens were analyzed by flow cytometry. (E) Changes in the ratio of CD4+T/CD8+T lymphocytes. Bar graphs represent the mean results ± SD (n = 3). ⁎⁎P < 0.01 represents a statistically significant difference compared to the Control group. ##P < 0.01 represents a statistically significant difference compared to the MG group.

L. salivarius Alleviates MG-Induced Respiratory Microbiota Dysbiosis

The variable 3–4 regions of the 16S rRNA gene that were isolated from RTLF samples were sequenced to determine the general makeup of the respiratory microbiota. When compared to the Control group, MG infection significantly decreased the bacterial diversity and richness (Chao1 index and Shannon index) of the respiratory microbiota. In contrast to the MG group, the L. salivarius treatment significantly raised the Chao1 index and Shannon index (Figure 8A). The respiratory microbiota composition of the Control group and MG group could be clearly distinguished using PCoA (Figure 8B). The PCoA of distances was similar in the control group and L. salivarius group. Figure 8C shows that the most abundant bacteria at the phylum level belong to Firmicutes and Proteobacteria. There was an increase in the relative abundance of Proteobacteria and a decrease in Bacteroidetes and Firmicutes in MG-infected chickens, which was reversed by L. salivarius. The phyla detected in all 4 chicken groups included Proteobacteria, Bacteroidetes, Firmicutes, Actinobacteria, Tenericutes, Thermi, Cyanobacteria, Chloroflexi, Acidobacteria and Gemmatimonadetes. In addition, the heatmap results showed that the significantly increased genus of the MG group was Sphingomonas compared to that of the control group, and L. salivarius treatment inhibited the MG-related increase in Sphingomonas (Figure 8D). The most differentially abundant taxa enriched in the respiratory microbiota were revealed by LDA effect size (LefSe) analysis, as shown in Figure 8E. According to the LefSe results, Verrucomicrobiae predominated in the respiratory microbiota of control group chickens, and Epsilonproteobacteria predominated in the respiratory microbiota of MG + L. salivarius group chickens and Gammaproteobacteria predominated in the respiratory microbiota of MG-infected chickens. A comparison of the relative abundance of KEGG metabolic pathways in each group was made by detecting metabolic alterations (Figure 8F). In all 4 groups, there were more or less differences in the relative abundance of cellular processes, environmental information processing, genetic information processing, human diseases, metabolism, and organismal systems, particularly for the metabolism of amino acids, cofactors, vitamins, and carbohydrates. Under MG infection, L. salivarius had a regulating effect on the respiratory flora of chickens, and the composition of respiratory flora was similar to that of chickens in the control group.

Figure 8.

Figure 8

Open in a new tab

Effect of L. salivarius and/or MG infection on the composition of respiratory microbiota in chicken. (A) Alpha diversity of respiratory microbiota (Chao1 and Shannon index). (B) Principal coordinate analysis (PCoA) of the respiratory microbiota composition at the operational taxonomic unit (OTU) level based on the Jaccard distance (n = 5). (C) Phylum-level respiratory microbiota composition (n = 5). Only the top 10 most abundant phyla are included. (D) Heatmap of the abundance of the respiratory microbiota at the genus level (n = 5). Blue represents the more abundant genus in the corresponding sample and phenol red represents the less abundant genus. (E) Cladograms of the respiratory microbiota were constructed showing taxa that were significantly enriched in each group (n = 5). Cladogram: node size is proportional to the advantage abundance, different backgrounds represent different groups, the branches in the blue nodes play an important role in the control group, red nodes play an important role in the MG group, and green nodes play an important role in MG + L. salivarius group, purple nodes play an important role in the L. salivarius group. (F) KEGG annotation and summary of functional categories for the prediction of metabolic pathways.

L. salivarius Inhibits MG Infection-Mediated Inflammation by Modulating Metabolites

To investigate the effect of MG infection and L. salivarius on respiratory metabolites, we carried out the nontargeted metabolomics profiling of the metabolites in RTLF samples from each group. The orthogonal projections to latent structures discriminant analysis (OPLS-DA) of metabolites indicated that the systemic metabolic profile of each group was different (Figure 9A). Differentially expressed metabolites (DEMs) were screened by combining VIP and P-value univariate analysis. Screening conditions: (1) VIP ≥ 1; (2) P-value ≤ 0.05; (3) one-way ANOVA P-value ≤ 0.05. Under various experimental circumstances, the metabolic patterns of metabolites were measured using agglomerate hierarchical clustering analysis. The results of the differentially abundant metabolites of the agglomerate hierarchical clustering analysis are presented as a heatmap (Figures 9B and 9C). Between the Control group and the MG group, there were a total of 48 different metabolites, and between the MG group and the MG+L. salivarius group, there were 87 different metabolites. MG challenge significantly decreased the levels of L-iditol, dimethyl sulfone, and L-isoleucine in RTLF when compared to the Control group, while L. salivarius treatment significantly increased the levels of pyridoxine, indole, and pantothenol. The correlation analysis between each metabolite was done by calculating the Pearson or Spearman's rank correlation coefficient between all metabolites. The correlation of metabolites revealed the synergy of changes between differentially abundant metabolites, which is exhibited in Figure 9D. The relationship between dimethyl sulfone and L-valine was positively correlated, while 5-hydroxyindoleacetic acid was negatively correlated with dimethyl sulfone. The metabolic pathways of the lysosome, D-arginine and D-ornithine metabolism, melanogenesis, and citrate cycle (TCA cycle) were activated significantly, which were found using metaboanalyst analysis (Figure 9E).

Figure 9.

Figure 9

Open in a new tab

Effect of L. salivarius and/or MG infection on the composition of respiratory metabolites in chicken. (A) Orthogonal projections to latent structures discriminant analysis (OPLS-DA) score plots (n = 6). (B) Heatmap of differentially abundant metabolites in the RTLF of the control group and MG group (n = 6). (C) Heatmap of differentially abundant metabolites in the RTLF of the MG group and MG + L. salivarius group (n = 6). (D) The correlation heatmap of differentially abundant metabolites in the RTLF of all groups. (E) Bar plot of metabolic pathway analysis with KEGG enrichment of differentially abundant metabolites.

DISCUSSION

In previous studies, it has been demonstrated that infections caused by MG can lead to CRD and cause lung, trachea, and other organ injury (Wu, et al., 2022; Miao, et al., 2022a; Wang, et al., 2023b). It is worth mentioning that MG infection leads to severe inflammatory lesions, immunosuppression, a decrease in production efficiency, and significant financial losses in the poultry industry (Ishfaq, et al., 2019; Mugunthan, et al., 2023; Wang, et al., 2023a). It is still unclear how MG-induced tracheal inflammation occurs in chickens. MG infection caused severe inflammatory reactions and compromised the structural integrity of the chicken trachea in the current study. We also confirmed that MG colonization and mucosal thickness were increased, and the cilia were severely exfoliated and broken in the chicken trachea during MG infection.

Currently, the most effective method against MG infection in the poultry industry is antibiotic treatment(Helmy, et al., 2020). However, the use of antibiotics to treat MG infection is constrained by bacterial resistance and drug residues (Bao, et al., 2021; Zhang, et al., 2022). Previous reports showed that probiotic treatment could regulate inflammatory responses and enhance antibody-mediated immune responses (Gurbatri, et al., 2020). More importantly, probiotics not only affect the intestine but also exert effects on the respiratory tract (Garcia-Crespo, et al., 2013), reproductive system (Boris and Barbés, 2000), and oral cavity (Homayouni Rad, et al., 2023). Probiotics such as L. salivarius make significant contributions to the maintenance of homeostatic microbial communities (Wang et al., 2021b). Additionally, L. salivarius can effectively boost chicken macrophage antiviral responses and enhance immune function (Shojadoost, et al., 2019). Given that L. salivarius is involved in immune system modulation, the present study aimed to determine how L. salivarius affects MG infection. According to our study, L. salivarius was able to significantly reduce abnormal pathological damage and tracheal structure deterioration in chickens suffering from MG. In chickens treated with L. salivarius, MG colonization was reduced in the trachea. The infection characteristics of MG are mainly colonized on the cilia and air sacs of the tracheal mucosa (Kulappu Arachchige, et al., 2022). Importantly, L. salivarius can resist MG by colonizing the respiratory tract. However, antibiotics cannot directly act on the cilia and air sacs and they only fight against MG through blood circulation.

It is well known that the balance of inflammation is associated with Th1/Th2 cells, and some studies have confirmed that Th1/Th2 imbalance is bound to lead to inflammation (Chang, et al., 2017). Th1/Th2 cytokines are essential for controlling immune reactions. IL-4 and GATA-3 are often measured as standard Th2 markers, which lead to humoral immunity. IFN-γ, IL-12, and T-bet are common Th1 markers that are involved in cell-mediated immunity (Song, et al., 2018; Fu, et al., 2019). Our results revealed that MG infection increased Th1 cytokine and decreased Th2 cytokines expression, which induced a Th1/Th2 immune imbalance, which is consistent with our previous study (Miao et al., 2022a). However, under MG infection, L. salivarius reduced the immune imbalance induced by inflammation. The mucosal immune barrier of the respiratory tract is crucial in preventing the entry of ad hoc pathogenic microorganisms. Expression of tight junction proteins as a measure of the physical barrier function of the respiratory tract mucosa(Sawada, 2013; Vaswani, et al., 2023). The results revealed that MG infection undermined barrier function, while L. salivarius intervention heightened barrier function. The JAK/STAT signaling pathway was found to be interrelated with many of the immune function-related genes that were significantly differentially expressed with MG infection, according to research (Beaudet, et al., 2017). Numerous studies have reported a positive correlation between the expression of TLR4 and the activation of the JAK/STAT signaling pathway in sepsis and allergic contact dermatitis (Bechara, et al., 2017). We wondered whether the JAK/STAT pathway significantly contributes to the respiratory system damage caused by MG infection based on earlier studies. Therefore, during MG infection, we evaluated the levels of protein expression of genes connected to the JAK/STAT signaling pathway. Our results showed that the JAK/STAT signaling pathway was also highly expressed during MG infection periods, but L. salivarius intervention muted its activation. T lymphocytes are important adaptive immune cells that are generally divided into 2 subsets, which are classified as CD4+ or CD8+T cells. CD8+T cells can kill infected or damaged cells, and their presence is of great significance to innate immune function. Unlike CD8+T cells, CD4+T cells have no cytotoxic effect but can assist or activate other immune cells such as CD8+T, B cells, and macrophages (Gutcher and Becher, 2007). According to our research, a change in chicken immune function was significantly correlated with MG infection based on the variety of CD4+T/CD8+T cell ratios. Additionally, the ratio of CD4+T/CD8+T cells changed as a result of L. salivarius treatment, which demonstrated a significant improvement in immune function in chickens with MG infection. Based on the above results, it was conjectured that L. salivarius ameliorated MG-induced inflammation-induced injury of the respiratory tract and immunosuppression in chickens.

Three elements interact to shape the respiratory microbiome's composition: microbial migration, microbial eradication, and relative rates of member proliferation. In healthy hosts, microbial immigration and elimination maintain a dynamic balance, which forms a microbial barrier against pathogen infection, but this balance is often broken in disease (Dickson, et al., 2014). It has been reported that maintaining the microecological balance of the respiratory tract has a major impact on the health of the respiratory system (Pérez-Cobas, et al., 2023). Disordered respiratory tract microbiota often leads to respiratory tract mucosal damage. To prevent MG infection, it is crucial to preserve respiratory microbiota homeostasis. According to the 16S rRNA sequencing findings, the composition of the respiratory microbiota varied between the MG group and the control group, which is consistent with earlier studies (Miao et al., 2022a). A recent study revealed that it is derived from L. salivarius from chicken feces, confirming that it has good probiotic properties in poultry production and has a good therapeutic effect on MG through regulating gut microbiota (Wang et al., 2021b). In addition, targeting the L. salivarius microbiota in the respiratory tract has been shown in studies to reduce respiratory infections (Garcia-Crespo et al., 2013). However, the effect of L. salivarius on MG-induced chicken respiratory tract microbiota is still likely imprecise. Therefore, in this research, we examined the effect of L. salivarius on the respiratory tract microbiota in chickens. In the current study, it was discovered that while Proteobacteria predominated in the respiratory tract microbiota of MG group chickens, Firmicutes predominated in the respiratory tract microbiota of the L. salivarius + MG group chickens. At the phylum level, the respiratory microbiota of the L. salivarius + MG group was more similar to that of the control group, which may be interrelated with the intervention effects of L. salivarius. The above results showed that ingesting L. salivarius reduced MG-induced respiratory microbiota dysbiosis and that the altered respiratory microbiota caused by L. salivarius plays a causal role in the protection against MG infection in chickens.

It has been reported that changes in the gut microbiota makeup can affect whether inflammation is localized or systemic by controlling the host metabolome (Zeng, et al., 2020). Research has shown that gut microbiota metabolites play a key role in the process of MG infection improvement (Wang, et al., 2021a). However, whether respiratory microbial metabolites exert similar functions in MG infection remains undetermined. In this study, analysis of the impact of MG infection and L. salivarius on respiratory metabolites was performed using nontargeted metabolomics. We found that MG infection obviously increased the levels of pyridoxine, indole, and pantothenol, and markedly decreased the levels of L-iditol, dimethyl sulfone, and L-isoleucine. However, L. salivarius treatment reversed the MG-induced changes in the levels of these metabolites. Previous studies also showed that dimethyl sulfone could alleviate MG-induced inflammatory damage through its good anti-inflammatory and antioxidant properties (Miao, et al., 2022b). We also confirmed that the metabolites with differential expression were significantly enriched in the lysosome, D-arginine, and D-ornithine metabolic pathways. These findings further demonstrated the possibility that the metabolic improvement of the respiratory microbiota contributes to the ability of L. salivarius to prevent MG infection.

In summary, our research demonstrated that L. salivarius could relieve MG-induced tracheal inflammatory injury by ameliorating the host immune imbalance. We also confirmed that the modulation of respiratory microbiota and metabolites may be a mechanism by which L. salivarius prevents MG infection. Furthermore, the current work also offers a theoretical framework for respiratory microbiota targeting MG infection prevention.

DISCLOSURES

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

The authors gratefully acknowledge the funding support. This study was supported by the National Natural Science Foundation of China (NO. 32273062), Post-doctoral Research Foundation in Heilongjiang Province (LBH-Z22260), 2022 ESI International High Impact Research Article Cooperation Program (NO. 212-54900112), Heilongjiang Province Agricultural Science and Technology Innovation Leapfrog Project Agricultural Science and Technology Basic Innovation Excellent Youth Program (CX22BS03).

Availability of Data and Materials: The datasets produced or analyzed during this study are available from the corresponding author upon reasonable request.

Ethics Approval and Consent to Participate: The present study was conducted under the approval of the Laboratory Animal Ethics Committee of Northeast Agricultural University (Heilongjiang Province, China) by the Laboratory animal-Guideline for Ethical Review of Animal Welfare (GB/T 35892-2018, National Standards of the People's Republic of China).

Author Contributions: JL conceived and designed the experiment. KW and MY completed the animal experiment, data analysis, and manuscript writing. WL, JB, and XJ assisted in the experiment. WL, IM, ZW, JB, RL, and CC checked the manuscript and made suggestions for revision.

Content for Publication: Not applicable (No human subjects).

REFERENCES

  1. Abaidullah M., Peng S., Kamran M., Song X., Yin Z. Current findings on gut microbiota mediated immune modulation against viral diseases in chicken. Viruses. 2019;11:681. doi: 10.3390/v11080681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bao J., Wu Z., Ishfaq M., Wang J., Miao Y., Niu D., Li R., Li J., Chen C. Pharmacokinetic/pharmacodynamic profiles of baicalin against Mycoplasma gallisepticum in an in vivo infection model. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101437. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Beaudet J., Tulman E.R., Pflaum K., Liao X., Kutish G.F., Szczepanek S.M., Silbart L.K., Geary S.J. Transcriptional profiling of the chicken tracheal response to virulent mycoplasma gallisepticum strain R(low) Infect. Immun. 2017;85 doi: 10.1128/IAI.00343-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bechara R., Antonios D., Azouri H., Pallardy M. Nickel sulfate promotes IL-17A producing CD4+ T cells by an IL-23-dependent mechanism regulated by TLR4 and Jak-STAT pathways. J Invest Dermatol. 2017;137:2140–2148. doi: 10.1016/j.jid.2017.05.025. [DOI] [PubMed] [Google Scholar]
  5. Boris S., Barbés C. Role played by lactobacilli in controlling the population of vaginal pathogens. Microbes Infect. 2000;2:543–546. doi: 10.1016/s1286-4579(00)00313-0. [DOI] [PubMed] [Google Scholar]
  6. Brisbin J.T., Davidge L., Roshdieh A., Sharif S. Characterization of the effects of three Lactobacillus species on the function of chicken macrophages. Res. Vet. Sci. 2015;100:39–44. doi: 10.1016/j.rvsc.2015.03.003. [DOI] [PubMed] [Google Scholar]
  7. Cai H.Y., Bell-Rogers P., Parker L., Ferencz A., Pozder P. Development and field validation of a Mycoplasma iowae real-time polymerase chain reaction assay. J. Vet. Diagn. Invest. 2008;20:230–235. doi: 10.1177/104063870802000216. [DOI] [PubMed] [Google Scholar]
  8. Chang X., Zhu A., Liu F., Zou L., Su L., Li S., Sun Y. Role of NF-κB activation and Th1/Th2 imbalance in pulmonary toxicity induced by nano NiO. Environ. Toxicol. 2017;32:1354–1362. doi: 10.1002/tox.22329. [DOI] [PubMed] [Google Scholar]
  9. Chen Y.M., Chiu W.C., Chiu Y.S., Li T., Sung H.C., Hsiao C.Y. Supplementation of nano-bubble curcumin extract improves gut microbiota composition and exercise performance in mice. Food Funct. 2020;11:3574–3584. doi: 10.1039/c9fo02487e. [DOI] [PubMed] [Google Scholar]
  10. Dickson R.P., Martinez F.J., Huffnagle G.B. The role of the microbiome in exacerbations of chronic lung diseases. Lancet. 2014;384:691–702. doi: 10.1016/S0140-6736(14)61136-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Elean M., Raya Tonetti F., Fukuyama K., Arellano-Arriagada L., Namai F., Suda Y., Gobbato N., Nishiyama K., Villena J., Kitazawa H. Immunobiotic ligilactobacillus salivarius FFIG58 confers long-term protection against streptococcus pneumoniae. Int. J. Mol. Sci. 2023;24 doi: 10.3390/ijms242115773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fu J., Yang T., Wang W., Xu S. Effect of selenium antagonist lead-induced damage on Th1/Th2 imbalance in the peripheral blood lymphocytes of chickens. Ecotoxicol. Environ. Saf. 2019;175:74–82. doi: 10.1016/j.ecoenv.2019.03.036. [DOI] [PubMed] [Google Scholar]
  13. Gao P., Ma C., Sun Z., Wang L., Huang S., Su X., Xu J., Zhang H. Feed-additive probiotics accelerate yet antibiotics delay intestinal microbiota maturation in broiler chicken. Microbiome. 2017;5:91. doi: 10.1186/s40168-017-0315-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Garcia-Crespo K.E., Chan C.C., Gabryszewski S.J., Percopo C.M., Rigaux P., Dyer K.D., Domachowske J.B., Rosenberg H.F. Lactobacillus priming of the respiratory tract: heterologous immunity and protection against lethal pneumovirus infection. Antiviral. Res. 2013;97:270–279. doi: 10.1016/j.antiviral.2012.12.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gurbatri C.R., Lia I., Vincent R., Coker C., Castro S., Treuting P.M., Hinchliffe T.E., Arpaia N., Danino T. Engineered probiotics for local tumor delivery of checkpoint blockade nanobodies. Sci. Transl. Med. 2020;12 doi: 10.1126/scitranslmed.aax0876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gutcher I., Becher B. APC-derived cytokines and T cell polarization in autoimmune inflammation. J. Clin. Invest. 2007;117:1119–1127. doi: 10.1172/JCI31720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Helmy Y.A., Kathayat D., Ghanem M., Jung K., Closs G., Jr, Deblais L., Srivastava V., El-Gazzar M., Rajashekara G. Identification and characterization of novel small molecule inhibitors to control Mycoplasma gallisepticum infection in chickens. Vet. Microbiol. 2020;247 doi: 10.1016/j.vetmic.2020.108799. [DOI] [PubMed] [Google Scholar]
  18. Homayouni Rad A., Pourjafar H., Mirzakhani E. A comprehensive review of the application of probiotics and postbiotics in oral health. Front. Cell. Infect. Microbiol. 2023;13 doi: 10.3389/fcimb.2023.1120995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hu W., Zhang W., Shah S.W.A., Ishfaq M., Li J. Mycoplasma gallisepticum infection triggered histopathological changes, oxidative stress and apoptosis in chicken thymus and spleen. Dev. Comp. Immunol. 2021;114 doi: 10.1016/j.dci.2020.103832. [DOI] [PubMed] [Google Scholar]
  20. Huang Z., Wu Y., Zhou Z., Xia X., Gu X., Cai Q., Shen X., Yang H., Ding H. Pharmacokinetic and pharmacodynamic integration and resistance analysis of tilmicosin against mycoplasma gallisepticum in an in vitro dynamic model. Front. Pharmacol. 2019;10:670. doi: 10.3389/fphar.2019.00670. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ishfaq M., Chen C., Bao J., Zhang W., Wu Z., Wang J., Liu Y., Tian E., Hamid S., Li R., Ding L., Li J. Baicalin ameliorates oxidative stress and apoptosis by restoring mitochondrial dynamics in the spleen of chickens via the opposite modulation of NF-κB and Nrf2/HO-1 signaling pathway during Mycoplasma gallisepticum infection. Poult. Sci. 2019;98:6296–6310. doi: 10.3382/ps/pez406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ishfaq M., Zhang W., Ali Shah S.W., Wu Z., Wang J., Ding L., Li J. The effect of Mycoplasma gallisepticum infection on energy metabolism in chicken lungs: through oxidative stress and inflammation. Microb. Pathog. 2020;138 doi: 10.1016/j.micpath.2019.103848. [DOI] [PubMed] [Google Scholar]
  23. Ishfaq M., Zhang W., Liu Y., Wang J., Wu Z., Shah S.W., Li R., Miao Y., Chen C., Li J. Baicalin attenuated Mycoplasma gallisepticum-induced immune impairment in chicken bursa of fabricius through modulation of autophagy and inhibited inflammation and apoptosis. J Sci. Food Agric. 2021;101:880–890. doi: 10.1002/jsfa.10695. [DOI] [PubMed] [Google Scholar]
  24. Jia G.C., Che N., Xia Y.J., Lai P.F., Xiong Z.Q., Wang G.Q., Zhang H., Ai L.Z. Adhesion to pharyngeal epithelium and modulation of immune response: Lactobacillus salivarius AR809, a potential probiotic strain isolated from the human oral cavity. J. Dairy Sci. 2019;102:6738–6749. doi: 10.3168/jds.2018-16117. [DOI] [PubMed] [Google Scholar]
  25. Kamathewatta K.I., Kulappu Arachchige S.N., Young N.D., Condello A.K., Wawegama N.K., Browning G.F. Transcriptomic analysis of the effects of tylosin on the protective immunity provided by the Mycoplasma gallisepticum vaccine Vaxsafe MG ts-304. Vet. Microbiol. 2024;291 doi: 10.1016/j.vetmic.2024.110029. [DOI] [PubMed] [Google Scholar]
  26. Kawaguchi I., Hayashidani H., Kaneko K., Ogawa M., Benno Y. Bacterial flora of the respiratory tracts in chickens with a particular reference to Lactobacillus species. J. Vet. Med. Sci. 1992;54:261–267. doi: 10.1292/jvms.54.261. [DOI] [PubMed] [Google Scholar]
  27. Kleven S.H. Control of avian mycoplasma infections in commercial poultry. Avian Dis. 2008;52:367–374. doi: 10.1637/8323-041808-Review.1. [DOI] [PubMed] [Google Scholar]
  28. Kulappu Arachchige S.N., Underwood G.J., Andrews D.M., Abeykoon A.M.H., Wawegama N.K., Browning G.F. Measures of tracheal lesions are more discriminatory and reproducible indications of chronic respiratory disease caused by Mycoplasma gallisepticum in poultry. Avian Pathol. 2022;51:550–560. doi: 10.1080/03079457.2022.2103396. [DOI] [PubMed] [Google Scholar]
  29. Li R., Li J., Zhou X. Lung microbiome: new insights into the pathogenesis of respiratory diseases. Signal Transduct. Target. Ther. 2024;9:19. doi: 10.1038/s41392-023-01722-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Li J., Qiao Z., Hu W., Zhang W., Shah S.W.A., Ishfaq M. Baicalin mitigated Mycoplasma gallisepticum-induced structural damage and attenuated oxidative stress and apoptosis in chicken thymus through the Nrf2/HO-1 defence pathway. Vet. Res. 2019;50:83. doi: 10.1186/s13567-019-0703-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Li Z.J., Zhang H.Y., Ren L.L., Lu Q.B., Ren X., Zhang C.H., Wang Y.F., Lin S.H., Zhang X.A., Li J., Zhao S.W., Yi Z.G., Chen X., Yang Z.S., Meng L., Wang X.H., Liu Y.L., Wang X., Cui A.L., Lai S.J., Jiang T., Yuan Y., Shi L.S., Liu M.Y., Zhu Y.L., Zhang A.R., Zhang Z.J., Yang Y., Ward M.P., Feng L.Z., Jing H.Q., Huang L.Y., Xu W.B., Chen Y., Wu J.G., Yuan Z.H., Li M.F., Wang Y., Wang L.P., Fang L.Q., Liu W., Hay S.I., Gao G.F., Yang W.Z. Etiological and epidemiological features of acute respiratory infections in China. Nat. Commun. 2021;12:5026. doi: 10.1038/s41467-021-25120-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Liu Y., Li L., Yan H., Ning Z., Wang Z. Lactobacillus salivarius SNK-6 activates intestinal mucosal immune system by regulating cecal microbial community structure in laying hens. Microorganisms. 2022;10:1469. doi: 10.3390/microorganisms10071469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Luo Y., Lin B., Yu P., Zhang D., Hu Y., Meng X., Xiang L. Scutellaria baicalensis water decoction ameliorates lower respiratory tract infection by modulating respiratory microbiota. Phytomedicine. 2024;129 doi: 10.1016/j.phymed.2024.155706. [DOI] [PubMed] [Google Scholar]
  34. Mahdizadeh S., Masukagami Y., Tseng C.W., Markham P.F., De Souza D.P., Nijagal B., Tull D., Tatarczuch L., Browning G.F., Sansom F.M. A mycoplasma gallisepticum glycerol ABC transporter involved in pathogenicity. Appl. Environ. Microbiol. 2021;87:e03112–20. doi: 10.1128/AEM.03112-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Man W.H., de Steenhuijsen Piters W.A., Bogaert D. The microbiota of the respiratory tract: gatekeeper to respiratory health. Nat. Rev. Microbiol. 2017;15:259–270. doi: 10.1038/nrmicro.2017.14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Marouf S., Khalf M.A., Alorabi M., El-Shehawi A.M., El-Tahan A.M., El-Hack M.E.A., El-Saadony M.T., Salem H.M. Mycoplasma gallisepticum: a devastating organism for the poultry industry in Egypt. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2021.101658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Miao Y., Niu D., Wang Z., Wang J., Wu Z., Bao J., Hu W., Guo Y., Li R., Ishfaq M., Li J. Mycoplasma gallisepticum induced inflammation-mediated Th1/Th2 immune imbalance via JAK/STAT signaling pathway in chicken trachea: involvement of respiratory microbiota. Vet. Microbiol. 2022;265 doi: 10.1016/j.vetmic.2021.109330. [DOI] [PubMed] [Google Scholar]
  38. Miao Y., Niu D., Wang Z., Wang J., Wu Z., Bao J., Jin X., Li R., Ishfaq M., Li J. Methylsulfonylmethane ameliorates inflammation via NF-κB and ERK/JNK-MAPK signaling pathway in chicken trachea and HD11 cells during Mycoplasma gallisepticum infection. Poult. Sci. 2022;101 doi: 10.1016/j.psj.2022.101706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Mugunthan S.P., Kannan G., Chandra H.M., Paital B. Infection, transmission, pathogenesis and vaccine development against Mycoplasma gallisepticum. Vaccines. 2023;11:469. doi: 10.3390/vaccines11020469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Pérez-Cobas A.E., Rodríguez-Beltrán J., Baquero F., Coque T.M. Ecology of the respiratory tract microbiome. Trends Microbiol. 2023;31:972–984. doi: 10.1016/j.tim.2023.04.006. [DOI] [PubMed] [Google Scholar]
  41. Quinteiro-Filho W.M., Brisbin J.T., Hodgins D.C., Sharif S. Lactobacillus and Lactobacillus cell-free culture supernatants modulate chicken macrophage activities. Res. Vet. Sci. 2015;103:170–175. doi: 10.1016/j.rvsc.2015.10.005. [DOI] [PubMed] [Google Scholar]
  42. Sawada N. Tight junction-related human diseases. Pathol. Int. 2013;63:1–12. doi: 10.1111/pin.12021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Shojadoost B., Kulkarni R.R., Brisbin J.T., Quinteiro-Filho W., Alkie T.N., Sharif S. Interactions between lactobacilli and chicken macrophages induce antiviral responses against avian influenza virus. Res. Vet. Sci. 2019;125:441–450. doi: 10.1016/j.rvsc.2017.10.007. [DOI] [PubMed] [Google Scholar]
  44. Song L., Xiong D., Hu M., Jiao X., Pan Z. Enhanced Th1/Th2 mixed immune responses elicited by polyethyleneimine adjuvanted influenza A (H7N9) antigen HA1-2 in chickens. Poult. Sci. 2018;97:4245–4251. doi: 10.3382/ps/pey313. [DOI] [PubMed] [Google Scholar]
  45. Vaswani C.M., Varkouhi A.K., Gupta S., Ektesabi A.M., Tsoporis J.N., Yousef S., Plant P.J., da Silva A.L., Cen Y., Tseng Y.C., Batah S.S., Fabro A.T., Advani S.L., Advani A., Leong-Poi H., Marshall J.C., Garcia C.C., Rocco P.R.M., Albaiceta G.M., Sebastian-Bolz S., Watts T.H., Moraes T.J., Capelozzi V.L., Dos Santos C.C. Preventing occludin tight-junction disruption via inhibition of microRNA-193b-5p attenuates viral load and influenza-induced lung injury. Mol. Ther. 2023;31:2681–2701. doi: 10.1016/j.ymthe.2023.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wang J., Ishfaq M., Fan Q., Chen C., Li J. A respiratory commensal bacterium acts as a risk factor for Mycoplasma gallisepticum infection in chickens. Vet. Immunol. Immunopathol. 2020;230 doi: 10.1016/j.vetimm.2020.110127. [DOI] [PubMed] [Google Scholar]
  47. Wang J., Ishfaq M., Guo Y., Chen C., Li J. Assessment of probiotic properties of Lactobacillus salivarius isolated from chickens as feed additives. Front Vet Sci. 2020;7:415. doi: 10.3389/fvets.2020.00415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang J., Ishfaq M., Li J. Baicalin ameliorates Mycoplasma gallisepticum-induced inflammatory injury in the chicken lung through regulating the intestinal microbiota and phenylalanine metabolism. Food Funct. 2021;12:4092–4104. doi: 10.1039/d1fo00055a. [DOI] [PubMed] [Google Scholar]
  49. Wang J., Ishfaq M., Li J. Lactobacillus salivarius ameliorated Mycoplasma gallisepticum-induced inflammatory injury and secondary Escherichia coli infection in chickens: involvement of intestinal microbiota. Vet. Immunol. Immunopathol. 2021;233 doi: 10.1016/j.vetimm.2021.110192. [DOI] [PubMed] [Google Scholar]
  50. Wang T., Jiang G., Lv S., Xiao Y., Fan C., Zou M., Wang Y., Guo Q., Ahsanul Kabir M., Peng X. Avian safety guardian: luteolin restores Mycoplasma gallisepticum-induced immunocompromise to improve production performance via inhibiting the IL-17/NF-kB pathway. Int. Immunopharmacol. 2023;124 doi: 10.1016/j.intimp.2023.110946. [DOI] [PubMed] [Google Scholar]
  51. Wang S., Jin X., Chen H., Han M., Bao J., Niu D., Wang Y., Li R., Wu Z., Li J. Quercetin alleviates Mycoplasma gallisepticum-induced inflammatory damage and oxidative stress through inhibition of TLR2/MyD88/NF-κB pathway in vivo and in vitro. Microb. Pathog. 2023;176 doi: 10.1016/j.micpath.2023.106006. [DOI] [PubMed] [Google Scholar]
  52. Wang X., Sun G., Feng T., Zhang J., Huang X., Wang T., Xie Z., Chu X., Yang J., Wang H., Chang S., Gong Y., Ruan L., Zhang G., Yan S., Lian W., Du C., Yang D., Zhang Q., Lin F., Liu J., Zhang H., Ge C., Xiao S., Ding J., Geng M. Sodium oligomannate therapeutically remodels gut microbiota and suppresses gut bacterial amino acids-shaped neuroinflammation to inhibit Alzheimer's disease progression. Cell Res. 2019;29:787–803. doi: 10.1038/s41422-019-0216-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wu Z., Ding L., Bao J., Liu Y., Zhang Q., Wang J., Li R., Ishfaq M., Li J. Co-infection of Mycoplasma gallisepticum and Escherichia coli triggers inflammatory injury involving the IL-17 signaling pathway. Front. Microbiol. 2019;10:2615. doi: 10.3389/fmicb.2019.02615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Wu Z., Fan Q., Miao Y., Tian E., Ishfaq M., Li J. Baicalin inhibits inflammation caused by coinfection of Mycoplasma gallisepticum and Escherichia coli involving IL-17 signaling pathway. Poult. Sci. 2020;99:5472–5480. doi: 10.1016/j.psj.2020.08.070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Wu C., Zhong L., Zhang L., Li W., Liu B., Huang B., Luo Z., Wu Y. Study on the mechanism of Mycoplasma gallisepticum infection on chicken tracheal mucosa injury. Avian Pathol. 2022;51:361–373. doi: 10.1080/03079457.2022.2068997. [DOI] [PubMed] [Google Scholar]
  56. Yu Y., Zhang L., Chen Y., Li Y., Wang Z., Li G., Wang G., Xin J. GroEL protein (Heat Shock Protein 60) of Mycoplasma gallisepticum induces apoptosis in host cells by interacting with annexin A2. Infect. Immun. 2019;87:e00248–19. doi: 10.1128/IAI.00248-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Zeineldin M., Barakat R. Host-specific signatures of the respiratory microbiota in domestic animals. Res. Vet. Sci. 2023;164 doi: 10.1016/j.rvsc.2023.105037. [DOI] [PubMed] [Google Scholar]
  58. Zeng S.L., Li S.Z., Xiao P.T., Cai Y.Y., Chu C., Chen B.Z., Li P., Li J., Liu E.H. Citrus polymethoxyflavones attenuate metabolic syndrome by regulating gut microbiome and amino acid metabolism. Sci. Adv. 2020;6:eaax6208. doi: 10.1126/sciadv.aax6208. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zhang W., Liu Y., Zhang Q., Shah S.W.A., Wu Z., Wang J., Ishfaq M., Li J. Mycoplasma gallisepticum infection impaired the structural integrity and immune function of bursa of fabricius in chicken: implication of oxidative stress and apoptosis. Front. Vet. Sci. 2020;7:225. doi: 10.3389/fvets.2020.00225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhang N., Zhou M., Yan X., Liu J., Yuan S., Yang H., Ding H., Zhang D., Bai Y. Pharmacokinetic and pharmacodynamic integration of tilmicosin against Mycoplasma gallisepticum in the target infection site in chickens. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.952599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Zhao L., Luo J.L., Ali M.K., Spiekerkoetter E., Nicolls M.R. The human respiratory microbiome: current understandings and future directions. Am. J. Respir. Cell Mol. Biol. 2023;68:245–255. doi: 10.1165/rcmb.2022-0208TR. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Zhou Z., Yu L., Cao J., Yu J., Lin Z., Hong Y., Jiang S., Chen C., Mi Y., Zhang C., Li J. Lactobacillus salivarius promotion of intestinal stem cell activity in hens is associated with succinate-induced mitochondrial energy metabolism. mSystems. 2022;7 doi: 10.1128/msystems.00903-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zou M., Fu Y., Zhao Y., Sun Y., Yin X., Peng X. Mycoplasma gallisepticum induced exosomal gga-miR-193a to disturb cell proliferation, apoptosis, and cytokine production by targeting the KRAS/ERK signaling pathway. Int. Immunopharmacol. 2022;111 doi: 10.1016/j.intimp.2022.109090. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES