SUMMARY
Purine nucleotides are vital for RNA and DNA synthesis, signaling, metabolism, and energy homeostasis. To synthesize purines, cells use two principal routes: the de novo and salvage pathways. Traditionally, it is believed that proliferating cells predominantly rely on de novo synthesis, whereas differentiated tissues favor the salvage pathway. Unexpectedly, we find that adenine and inosine are the most effective circulating precursors for supplying purine nucleotides to tissues and tumors, while hypoxanthine is rapidly catabolized and poorly salvaged in vivo. Quantitative metabolic analysis demonstrates comparative contribution from de novo synthesis and salvage pathways in maintaining purine nucleotide pools in tumors. Notably, feeding mice nucleotides accelerates tumor growth, while inhibiting purine salvage slows down tumor progression, revealing a crucial role of the salvage pathway in tumor metabolism. These findings provide fundamental insights into how normal tissues and tumors maintain purine nucleotides and highlight the significance of purine salvage in cancer.
In Brief:
Comprehensive isotope tracing analyses reveal the contribution of de novo synthesis and salvage pathways in supplying purine nucleotides across major tissues and tumors.
Graphical Abstract

INTRODUCTION
Beyond their essential roles as the building blocks of RNA and DNA, purine nucleotides are central for cell signaling, metabolism, and energy homeostasis. As such, cells require a constant supply of purines to maintain their function or to grow and proliferate. Notably, the first chemotherapeutic drug ever developed (methotrexate, 1948) targeted and thymidylate purine synthesis. Its early success led to generation of purine antimetabolites and their widespread use in chemotherapy.1–3 Yet, we still don’t know how tissues – healthy or malignant – maintain the pools of these key metabolites in vivo.
Purines are synthesized via two principal routes: the de novo and salvage pathways. The de novo purine synthesis pathway is a metabolically costly process (6 ATP molecules per molecule of purine synthesized) that involves 10 catalytic steps to assemble the purine ring from carbon and nitrogen moieties donated by amino acids (e.g., glutamine, aspartate, glycine) and one-carbon units (Figure 1A).4,5 This pathway is highly regulated through multiple mechanisms, including transcriptional, post-transcriptional, feedback inhibition, or organization into multi-enzyme assemblies (purinosomes).4–10 The de novo purine synthesis is also controlled by pro-growth signaling pathways, including mTORC1 signaling11–13, MAPK/ERK signaling14, and MYC15, which stimulate this pathway to support cell growth.
Figure 1. Assessment of the de novo purine synthesis across tissues.
A, Schematics of the in vivo infusions with the indicated stable isotope tracers (15N-glutamine, 13C-hypoxanthine, 15N-adenine, 15N-adenosine, 13C-hypoxanthine, 15N-inosine, 15N-guanine, and 15N-guanosine) to determine relative activities of the de novo and salvage purine synthesis across tissues. Purine species from tissues are analyzed by liquid chromatography-mass spectrometry (LC-MS) analysis. Below, schematic of the de novo and salvage (orange) pathways. Glutamine and other small molecules (e.g. Gly, HCO3-, Asp, Formyl-THF) are shown to be participate in the de novo purine synthesis.
B, Fractional abundance (% isotope labeled metabolite /total abundance) of labeled glutamine and purines nucleotides (IMP, AMP, GMP) in tissues from mice infused with [γ-15N]-glutamine (5h). Labeling into purines shows total isotopologue labeling. Each data point represents one mouse. Data are the mean ± s.d from 8–10 independent mice.
C, Fractional abundance (%) of labeled glutamine and purine nucleotides (IMP, AMP, GMP) in tissues from mice infused with [γ, α-15N]-glutamine (5h). Labeling into purines shows total isotopologue labeling. Each data point represents one mouse. Each data point represents one mouse. Data are the mean ± s.d from 9–10 independent mice.
The salvage pathway operates alongside the de novo pathway, by recycling existing nucleobases from the diet or nucleotide catabolism, to produce nucleotides in an energy-efficient manner, consuming only 1 ATP molecule per purine molecule.16 This pathway is facilitated by the parallel action of two enzymes, APRT and HPRT1, where APRT catalyzes the formation of adenosine 5’-monophosphate (AMP) from adenine, whereas HPRT1 uses guanine or hypoxanthine to produce guanosine 5’-monophosphate (GMP) or inosine 5’-monophosphate (IMP), respectively (Figure 1A). IMP can be further converted to AMP or GMP, which can be phosphorylated to yield nucleotide di-or tri phosphates.
Historically, differentiated cells from adult tissues were believed to produce most of their purines through the salvage pathway16, while proliferating cells were thought to primarily rely on the de novo pathway to meet the demands for cell proliferation.5,17 However, these assumptions have not been tested, and our understanding of the contribution of the purine synthesis pathways to nucleotide supply in vivo remains limited. Additionally, the significance of the salvage pathway in cancer is also not well understood. Here, we established in vivo isotope infusion methods coupled to metabolomics to determine the contribution of the salvage and de novo purine synthesis pathways to nucleotide supply across tissues and tumors. Our findings reveal an unappreciated role for the salvage pathway in both normal tissues and tumor growth.
RESULTS
De Novo and Salvage Purine Synthesis Activities Across Tissues
To systematically study purine synthesis routes across tissues, we infused healthy C57BL/6 mice with labeled nutrients that specifically trace de novo and salvage pathways, and analyzed the purine metabolite contents in nine major tissues, including the brain, heart, lung, pancreas, liver, small intestine, spleen, kidney, and adipose tissue (Figure 1A).
To assess the activity of the de novo purine pathway, we used [γ-15N]-glutamine or [γ, α-15N]-glutamine, which effectively reached isotopic steady-state labeling in the bloodstream (Figure S1A) and uniformly labeled most major tissues (labeled fraction ~ 30%) (Figure 1B). The γ-15N atoms are directly incorporated into two positions in the purine ring (Figures S1B), while the α-15N can be transferred to the purine ring through serine, glycine, or aspartate metabolism. In most tissues, the fraction of the newly synthesized purine nucleotides with γ-15N label was low (< 1% in AMP, GMP, IMP), except for the small intestine, which showed a relatively higher enrichment in labeled purines (1.5–2.5%) (Figure 1B).
Doubly labeled glutamine improved the overall labeling in purines in tissues and confirmed that the small intestine has the highest de novo purine synthesis activity consistent with [γ-15N]-glutamine infusion (Figure 1C). To confirm the specificity of the labeling, we pharmacologically inhibited de novo purine synthesis with AG203718, a selective inhibitor of the GART enzyme, which resulted in a decrease in the abundance of newly synthesized purines in the small intestine (Figure S1C). Our data suggest an active role for de novo purine synthesis in the small intestine, correlating with its rapid proliferation rate, as evidenced by higher BrdU incorporation compared to other tissues (Figure S1D). However, we did not observe an association between purine synthesis rate in tissues and the protein abundance of de novo purine synthesis enzymes (Figures S1E and S1F), likely due to the complex regulation of the purine synthesis pathway.
Since differentiated tissues are thought to acquire most of their nucleotides through the salvage pathway 16, we sought to systematically assess the salvage of common circulating nucleobases and nucleosides. Given that intracellular metabolite pool sizes may influence isotope labeling patterns, we examined the relative abundance of purine nucleotides and their precursors across various tissues. Although most purine species exhibited distinct tissue-specific distributions, the variations in pool sizes of purine nucleotides (IMP, AMP, GMP) were less pronounced (Figure S2A). To minimize perturbations to endogenous metabolism, we empirically optimized the infusion conditions for purine precursors, including [15N5]-adenine, [15N5]-adenosine, [13C5]-hypoxanthine, [15N4]-inosine, [15N5]-guanine, or [15N5]-guanosine (Figure 1A). No substantial changes were observed in the levels of purine nucleotides or their precursors in blood or tissues from mice infused with isotope-labeled purines compared to those infused with control saline (Figures S2B–H).
We first examined the salvage of adenylate precursors, 15N5-adenine and 15N5-adenosine (Figure 2A). Both tracers effectively achieved isotopic steady-state labeling in circulation (fractional enrichment ~30%) (Figures 2B and C), but displayed distinct tissue-specific utilization patterns (Figure 2D–G). Adenine is directly recycled by APRT to produce AMP, which is metabolized to IMP by AMP deaminase (AMPD). IMP is further converted to GMP through the action of IMP dehydrogenase (IMPDH) and GMP synthase (GMPS) (Figure 2A). Time-course adenine infusions (30 min, 1h, 5h) revealed a gradual rise in labeled adenine, AMP, and IMP across most tissues (~3–15%), except for the brain, which exhibited less than 1% labeling (Figure 2D). By the end of the 5-hour infusion, most tissues presented uniform 15N5-adenine enrichment (~10%) and high purine nucleotide labeling, particularly in the kidney, lung, spleen, and the small intestine (e.g., AMP and IMP fractional enrichment 5–10%) (Figure 2E). Guanylate nucleotides emerged mainly after 5-hour labeling, indicating a slower rate of GMP synthesis (Figure 2D). Despite similar adenine pool sizes across tissues (Figure S2A), the heart and pancreas showed relatively less adenine salvage, in line with lower expression of APRT in these tissues (Figure S1F).
Figure 2. Salvage of adenine and adenosine purine precursors across tissues.
A, Schematic of [15N5]-adenine or [15N5]-adenosine labeling showing the incorporation of nitrogen into purine nucleotides (AMP, IMP, GMP). Enzymes involved in purine salvage metabolism are indicated in italic: APRT, adenine phosphoribosyltransferase; ADA, adenosine deaminase; ADK, adenosine kinase; PNP, purine nucleoside phosphorylase; HPRT1, hypoxanthine-guanine phosphoribosyltransferase; ADSL, Adenylosuccinate lyase; ADSS, Adenylosuccinate synthase; AMPD, AMP deaminase; IMPDH, IMP Dehydrogenase; GMPS, GMP synthase.
B, Tracer enrichment in the blood from intravenous infusions with [15N5]-adenine. Fractional abundance of adenine (M+5) is shown for the indicated time points. Data are the mean ± s.e.m from 10 independent mice.
C, Tracer enrichment in the blood from intravenous infusions with [15N5]-adenosine. Fractional abundance of adenosine (M+5) is shown for the indicated time points. Data are the mean ± s.e.m from 5 independent mice.
D, Fractional abundance (%) of adenine (M+5), IMP (M+4), AMP (M+5), GMP (M+4) is shown from time-course intravenous infusion with [15N5]-adenine across tissues. Tissues (color-coded) were collected at the indicated time points (30 minutes, 1h and 5h). Data are the mean ± s.e.m from 5 independent mice.
E, Fractional abundance (%) of adenine (M+5), IMP (M+4), AMP (M+5), GMP (M+4) is shown in the indicated tissues from intravenous infusion with [15N5]-adenine (5h). Each data point represents one mouse. Data are the mean ± s.d from 10 independent mice.
F, As in (D) but from time-course intravenous infusion with [15N5]-adenosine for the indicated time points (30 minutes, 1h and 5h). Data are the mean ± s.e.m from 5 independent mice.
G, Fractional abundance (%) of adenosine (M+5), IMP (M+4), AMP (M+5), GMP (M+4) from the 5h timepoint [15N5]-adenosine in (F) is presented as bar graphs. Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
In contrast to the widespread tissue utilization of 15N5-adenine, 15N5-adenosine exhibited preferential salvage in the lung and spleen (Figures 2F and 2G). Time-course infusions indicated significant enrichment of 15N5-adenosine, AMP (M+5), and IMP (M+4) in the lung and spleen at earlier time points (30 minutes/1 hour) prior to adenosine attaining steady-state levels, indicating rapid adenosine salvage in these tissues (Figure 2F). In contrast to the direct APRT-mediated adenine synthesis of AMP, adenosine can generate AMP through multiple pathways: 1) direct phosphorylation by adenosine kinase (ADK); 2) PNP-mediated catabolism to adenine and subsequent APRT-dependent salvage; and 3) deamination to inosine by adenosine deaminase (ADA), and subsequent conversion to IMP via HPRT1 (Figure 2A and S2I). We observed a high enrichment of adenine (M+5), inosine (M+4), and hypoxanthine (M+4) in the lung and spleen (Figure S2J), indicating efficient adenosine metabolism by PNP and ADA in these tissues. However, protein expression of PNP, ADA, and ADK did not significantly correlate with labeling in adenosine-derived nucleotides, suggesting that enzyme abundance may not directly reflect pathway activity (Figure S1F).19 These findings reveal distinct utilization of adenine and adenosine across tissues, likely influenced by a multifaceted interaction of various factors, including uptake mechanisms, synthesis rates, pool sizes, and unique metabolic features of each tissue.
Next, we explored the HPRT1-facilitated purine recycling, which converts hypoxanthine to IMP and guanine to GMP. Additionally, inosine and guanosine can also enter the nucleotide pools via HPRT1, following their PNP-mediated breakdown into hypoxanthine and guanine, respectively (Figure S2K).
While 15N4-inosine displayed isotopic steady-state enrichment (~30%) similar to adenine (Figure S2L), hypoxanthine, guanine, and guanosine showed low enrichment in circulation (data not shown). Nevertheless, the kidney emerged as the primary site of salvage for all these purine substrates. Inosine and hypoxanthine demonstrated parallel patterns, with inosine exhibiting more pronounced labeling in purine nucleotides across various tissues, notably in the kidney, spleen, lung, and small intestine (~2–10% enrichment) (Figures 3A, 3B and S2M). The guanosine-guanine pair also exhibited a comparable labeling trend, marked by significant enrichment of GMP in the kidney and heart (approximately 6–20%) (Figures 3C and 3D). However, hardly any 15N5-guanosine or 15N5-guanine was detected in circulation, suggesting rapid sequestration of these metabolites by the tissues.
Figure 3. Comprehensive tracer analysis of HPRT1-facilitated purine salvage.
A, Fractional abundance (%) of inosine (M+4), IMP (M+4), AMP (M+4), GMP (M+4) is shown in the indicated tissues from intravenous infusion with [15-N4]-inosine (5h). Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
B, Fractional abundance (%) of hypoxanthine (M+5), IMP (M+5), AMP (M+5), GMP (M+5) is shown in the indicated tissues from intravenous infusion with [13C5]-hypoxanthine (5h). Each data point represents one mouse. Data are the mean ± s.d from 8 independent mice.
C, Fractional abundance (%) of guanosine (M+5), IMP (M+4), AMP (M+4), GMP (M+5) is shown in the indicated tissues from intravenous infusion with [15N5]-guanosine (5h). Each data point represents one mouse. Data are the mean ± s.d from 10 independent mice.
D, Fractional abundance (%) of guanine (M+5), IMP (M+4), AMP (M+4), GMP (M+5) is shown in the indicated tissues from intravenous infusion with [15N5]-guanine (5h). Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
E, Ex vivo labeling (3h) of human kidney sections with the indicated tracers. Fractional abundance (%) of glutamine, adenine, and hypoxanthine into IMP, AMP, and GMP. Normal renal cortex slices were used in triplicate from each patient with kidney cancers. Each data point represents one kidney section slice, from up to two patients. Data are the mean ± s.d.
Overall, our data suggest an active role of the kidney in recovering purine bases into nucleotides. The purine concentrations in the kidney ranged between ~4–40 μmol/mg, with adenine being the most abundant (~40 μmol/mg) followed by hypoxanthine (~23 μmol/mg) (Figure S2N). To test whether the salvage pathway also supports purine pools in human kidney, we performed ex-vivo isotope tracing of human organotypic kidney slices with 15N5-adenine, 13C5-hypoxanthine, or 15N-glutamine. Strikingly, human kidney also showed a higher degree of purine generation from the salvage of adenine and hypoxanthine as compared to glutamine (Figures 3E).
Despite the high salvage pathway activity in the kidney, we were puzzled by the low enrichment of hypoxanthine, guanosine, and guanine in circulation following intravenous infusion. We reasoned that the route of administration could be a factor for these observations, as these molecules are normally consumed from food and possibly metabolized differently along the digestive tract. Therefore, we compared the intravenous infusions to the oral administration of these nucleobases given as a single bolus (Figures S3A-E). Despite administering hypoxanthine, guanosine, and guanine at a five-fold higher dose than the intravenous infusion, their enrichment levels in the blood and most tissues remained low, except in the small intestine, which exhibited comparatively higher enrichment (Figures S3A-D). Notably, adenine, even as a single bolus dose, effectively enriched the blood, mirroring the labeling patterns observed with intravenous infusions (Figure S3E). The pronounced enrichment of nucleotides in the small intestine from dietary purines, likely reflects the first-pass effect, where these precursors are absorbed and salvaged before entering systemic circulation. Interestingly, we observed high expression of purine transporters (ENTs and CNTs) in the small intestine, which aligns with its efficient absorption of these nutrients (Figure S3F).
Since the route of administration did not account for the low levels of hypoxanthine or guanosine in the bloodstream, we hypothesized that these precursors could potentially be rapidly degraded and cleared by the kidney. Degradation of purine nucleobases is mediated by the action of xanthine dehydrogenase (XDH), which generates uric acid, the end product of purine catabolism in humans. In mice, uric acid is further metabolized to allantoin via uricase20 (Figure 4A). Overproduction of uric acid is the cause of gout and kidney stones in humans. Allopurinol, an XDH inhibitor that blocks purine catabolism and lowers uric acid levels, is used for management of gout in humans.21
Figure 4. Influence of the xanthine dehydrogenase-mediated purine catabolism on purine salvage.
A, Schematic depicting the interaction of purine salvage and purine catabolism. Allopurinol inhibits xanthine dehydrogenase (XDH), which generates uric acid from the catabolism of hypoxanthine and xanthine. Uricase (UO) converts uric acid to allantoin, the end product of purine catabolism in mice.
B, Mice were treated with vehicle or allopurinol for 8 consecutive days prior to intravenous infusions with [13C5]-hypoxanthine (5h). Fractional abundance of (%) of xanthine (M+5) and allantoin (M+4) in blood are shown. Each data point represents one mouse, n=5 mice. Data are the mean ± s.d from 5 independent mice.
C, As in (B), but hypoxanthine (M+5) enrichment is shown in the blood for the indicated time. Data are the mean ± s.e.m from 5 independent mice.
D, As in (B), but fractional abundance (%) of hypoxanthine (M+5), IMP (M+5), AMP (M+5), and GMP (M+5) is shown in tissues after allopurinol administration. Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
Indeed, we observed a high enrichment in purine degradation products, including xanthine and allantoin in circulation immediately after hypoxanthine infusions (Figure 4B). To test the contribution of XDH-mediated purine degradation, we treated mice with vehicle or allopurinol followed by intravenous infusion with 13C5-hypoxanthine. Remarkably, allopurinol treatment resulted in a substantial increase of labeled hypoxanthine in the blood (~15 %), in stark contrast to the vehicle-treated group, which reached a maximum enrichment of 2% (Figure 4C). The allopurinol-treated group exhibited a pattern akin to adenine labeling, displaying uniform enrichment in most tissues (~10%). Additionally, purine synthesis was also greatly enhanced in many tissues, including the kidney, spleen, small intestine, liver, and lungs, indicating a crucial role for XDH-mediated purine degradation in influencing nucleotide synthesis (Figure 4D). In contrast to hypoxanthine, guanosine was insensitive to XDH-mediated degradation. Indeed, the abundance of guanosine in various tissues from mice infused with 15N5-guanosine remained unaffected by the inhibition of purine degradation with allopurinol (Figure S3G). Furthermore, allopurinol treatment did not significantly alter the levels of guanine or adenine in the blood, emphasizing XDH's specific role in hypoxanthine degradation (Figure S3H).
Together, our work reveals distinct patterns of salvage precursor utilization across different tissues. We show that circulatory adenine and inosine are salvaged by most tissues, adenosine is primarily utilized in the lungs, while guanine and guanosine are predominantly salvaged in the heart and kidneys. We also reveal the significance of XDH-mediated degradation in impacting purine synthesis, especially for hypoxanthine salvage.
Proliferating cells and tumors use both the de novo synthesis and salvage pathways to maintain nucleotide levels.
Tumor cells switch on de novo synthesis to meet their nucleotide requirements for rapid cell division.4,5,22 However, the metabolic routes by which tumors maintain their purine supply are incompletely described. To this end, we sought to examine the in vivo activity of the de novo synthesis and salvage pathways in tumors by applying the same tracing schemes we developed for tissues (Figures 1, 2, and 3). We applied up to eight tracers, for assessing the de novo (i.e., [γ-15N]-glutamine, [γ, α-15N]-glutamine) and the salvage (i.e., [15N5]-adenine, [15N5]-adenosine, [13C5]-hypoxanthine, [15N4]-inosine, [15N5]-guanosine, and [15N5]-guanine), pathways across six tumor models, including xenograft and genetically engineered mouse models.
Akin to normal tissues, 15N-glutamine entered all xenograft tumors, resulting in a fractional enrichment within the tumors ranging from 20% to 40%. These included models of breast cancer (Cal-51), renal cell carcinoma (RCC, Renca), colon cancer (HCT-116), and an orthotopic RCC patient-derived xenograft (Figures 5A, 5B, S4A-C). The 15N-glutamine tracer led to the labeling of approximately 1–2% of the tumor adenylate pools and 2–4% of the tumor guanylate pools, rates comparable to those observed in the small intestine (Figures 1B and 1C).
Figure 5. Tumors utilize both the de novo and salvage pathways to maintain their purine nucleotides.
A, Isotope tracer infusions with [γ-15N]-glutamine, [15N5]-adenine, [15N5]-adenosine, [15N4]-inosine, [13C5]-hypoxanthine, and [15N5]-guanosine assessing the de novo and salvage pathway in tumors derived from Cal-51 human breast cancer cell. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tumor tracer are shown. Each data point represents data from one tumor-bearing athymic nude mouse. Data are the mean ± s.d from 4–8 independent mice.
B, As in (A), but fractional abundance (%) of tumor metabolites from Renca mouse kidney cancer cells derived tumor. Each data point represents data from one tumor-bearing BALB/cJ mouse. Data are the mean ± s.d from 4–6 independent mice.
C, Cal-51 or Renca tumor-bearing mice were treated with allopurinol for 8 consecutive days prior to intravenous infusions with [13C5]-hypoxanthine (5h). Fractional abundance (%) of tumor hypoxanthine (M+5), IMP (M+5), AMP (M+5), and GMP (M+5) is shown. Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
D, Schematic of colon cancer model induced by AOM/DSS that was subjected to intravenous infusions.
E, Fractional abundance (%) of the indicated metabolites are shown as in (A), but from normal colon (vehicle-treated mice) or from tumor-bearing colon (AOM/DSS treatment group) infused with [γ, α-15N]-glutamine or [15N5]-adenine as described in (D) and. Data are from six mice in each treatment group. Each data point represents one colon section (up to two colon sections were obtained from each mouse). Data are the mean ± s.d. from 6 independent mice.
F, Immunoblots of the de novo (blue) purine biosynthesis (PRPS1, PRPS2, PPAT, GART, PFAS, PAICS, ATIC, ADSS, ADSL, GMPS, and IMPDH2), or purine salvage (orange) (APRT, HPRT1, ENT2) in a MYC-driven hepatocellular carcinoma (HCC) model using the LAP-tTA/TRE-MYC transgenic mice. Each sample represents a distinct mouse. Adjacent normal liver and MYC-overexpressing tumors were analyzed.
G, Fractional abundance (%) of glutamine and the newly synthesized purines IMP, AMP, GMP in normal livers or the MYC-driven HCC described in (F). Mice were infused with [γ, α-15N]-glutamine to assess the de novo purine synthesis. Each data point represents data from one mouse, Data are the mean ± s.d from 5–6 independent mice. *p < 0.05, were calculated using a two-sided Student’s t-test.
H, Schematic depicting tumor cells producing purine nucleotides either from the de novo or from the salvage pathway through acquiring circulating purines in the tumor microenvironment.
We also examined the contribution of the salvage of adenine, adenosine, inosine, hypoxanthine, guanosine, and guanine isotopes across tumor xenografts. Despite the low enrichment of these purine bases and nucleosides in tumors (ranging from 1–6%), we observed efficient labeling into downstream purine nucleotide intermediates (Figures 5A, 5B, S4A, S4C, and S4D). Adenine surpassed adenosine in labeling the AMP pools, reaching about 4% enrichment compared to ~0.5% enrichment from adenosine. Similarly, guanosine labeled GMP pools more efficiently than guanine (~1–2% for guanosine versus ~0.5% for guanine). Inosine also showed more pronounced labeling in tumor IMP pools compared to hypoxanthine (2–7% enrichment for inosine versus 1.5–4% for hypoxanthine, respectively) (Figures 5A, 5B, S4A, S4C, and S4D). Notably, akin to tissues, blocking hypoxanthine degradation with allopurinol led to increased hypoxanthine enrichment and salvage across tumors (4–10% labeling into tumor purine nucleotides) (Figures 5C, S4E). To account for the labeling of various tracers across tumors, we normalized the fractional enrichment of purines to the fractional labeling of each tracer. This analysis showed a higher contribution of the salvage pathway than de novo synthesis in tumors (Figures S4F, S4G, and S4H), suggesting efficient recovery of nucleobases into tumor nucleotides.
We also employed a colorectal cancer chemically induced by Azoxymethane/Dextran Sulfate Sodium (AOM/DSS)23 and a transgenic liver cancer model induced by MYC overexpression. 24–26 Similar to the xenograft tumors, we observed a moderate level of newly labeled purines (1–4%) from de novo purine synthesis and the salvage pathway in the AOM/DSS model (Figure 5D, E, and S4I). Surprisingly, neither the de novo synthesis nor the salvage pathways were significantly upregulated in tumors as compared to the normal colon tissue, despite a trend toward elevation of the de novo synthesis pathway (Figure 5D, E, and S4I).
Given that c-MYC is a master regulator of nucleotide biosynthesis15,27,28, we sought to examine the effects of oncogenic MYC activation on the de novo synthesis and salvage pathways in vivo. We used a MYC-driven hepatocellular carcinoma (HCC) transgenic model, where MYC expression is under the control of a tetracycline response element (LAP-tTA/TRE-MYC).24,25 Indeed, liver-specific overexpression of MYC resulted in increased protein levels of de novo purine synthesis enzymes (Figure 5F). Infusion of 15N2-glutamine revealed a striking activation of de novo purine synthesis upon MYC overexpression compared to control livers, indicating that MYC drives de novo purine production in the liver (Figure 5G). MYC overexpression also upregulated HPRT1, as well as purine nucleobase/nucleoside transporters such as ENT2, however, these changes did not result in a significant increase in hypoxanthine salvage in MYC overexpressing livers (Figures 5F and S4J).
Together, our data demonstrate that tumors engage both the de novo synthesis and salvage pathways to maintain their purine pools, with the salvage pathway rapidly recycling nucleobases into nucleotides (Figure 5H). Our finding that Myc oncogene stimulates the de novo nucleotide synthesis pathway in HCC shows that purine synthesis is functionally activated in a mouse tumor model, extending beyond gene expression analysis.
Significance of the de novo and purine salvage synthesis pathways for tumor growth in vivo
With each cell division, cancer cells must double their macromolecules, including nucleotides.29,30 Our data indicate that tumors can effectively use the salvage pathway to synthesize nucleotides; however, the significance of the salvage pathway in cancer is less appreciated. Nucleobases or nucleosides obtained from circulation or through catabolism of nucleic acids enter the cells through purine nucleoside transporters (e.g. ENTs) and are converted into nucleotides through HPRT1 and APRT.31 High mRNA expression of HPRT1, APRT, or purine transporters is correlated with poor prognosis in several cancer models.32 In our study, we found a significant increase in the protein levels of HPRT1, APRT, and ENT2 in human breast cancer samples when compared to the adjacent normal breast tissue (Figure 6A and S5A).
Figure 6. The salvage purine synthesis pathway is critical for tumor growth.
A, Schematic of a protein microarray from human breast tumor and normal tissue. Quantifications of the immunoblots for HPRT1 and APRT are presented. Data present the mean ± s.d from n = 55 patient samples. Unpaired t-test, ***p < 0.001.
B, Experimental design of the tumor studies using control cancer cells or GART-deficient (ΔGART) or HPRT1-deficient (Δ HPRT1) cells.
C, Immunoblots of wild type (WT), ΔGART, or ΔHPRT1 Cal-51 cancer cells that were injected subcutaneously into athymic nude mice. Tumor growth was monitored after tumor onset for the indicated times. Data are the mean ± s.d. from 4–7 independent animals. **P < 0.01, ***P < 0.001 were calculated using a two-sided Student’s t-test.
D, As in (C), but immunoblots from Renca ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1 that were injected subcutaneously into Balb/c wild-type mice. Tumor growth was monitored as in (C). Data are the mean ± s.d. from 5 independent animals. *P < 0.05 was calculated using a two-sided Student’s t-test.
E, As in (C), but immunoblots are from MC38 wild type (WT) or ΔGART cells, or MC38 ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1 that were injected subcutaneously into NSG mice. Tumor growth was monitored as in (C). Data are the mean ± s.d. from 5–8 independent animals. *P < 0.05, **P < 0.01, were calculated using a two-sided Student’s t-test.
F, Immunoblots from Cal-51 cells stably expressing a doxycycline (dox)-inducible shRNA targeting APRT (i-shAPRT) or scrambled (i-shCtrl) were treated with dox prior to subcutaneous injection into athymic nude mice. Dox treatment in mice was administered for the entire duration of the study. Tumor growth was monitored as in (C). Data are the mean ± s.d. from 4 independent animals. *P < 0.05 was calculated using a two-sided Student’s t-test.
G, Schematic of experimental design depicting hydrodynamic transfection of the indicated genes for inducing liver tumors driven by β-catenin/Myc, while simultaneously delivering control single guide (sg) RNAs (sgCtrl) or those targetting GART (sgGART) or HPRT1 (sgHPRT1).
H, Representative gross liver photographs and H&E images showing liver tumors from the experiment described in (G).
I, Quantification of the micro-tumors from H&E images in (H). Data are the mean ± s.d. from 6–10 independent mice. *P < 0.05, **P < 0.01 were calculated using a two-sided Student’s t-test.
J, Relative protein expressions are shown for GART and HPRT1 from the experiment described in (G). Data are the mean ± s.d. from n = 8–11 independent mice. *P < 0.05, ***P < 0.001 were calculated using a two-sided Student’s t-test.
K, Immunoblots from Cal-51 cells stably expressing a dox-inducible shRNA targeting HPRT1 (i-shHPRT1) or scrambled (i-shCtrl) that were injected subcutaneously into athymic nude mice. Dox treatment was administered after tumor formation (100 mm3). Tumor growth was monitored as in (C). Data are shown as mean ± s.d. from 7–8 independent animals. *P < 0.05 was calculated using a two-sided Student’s t-test.
L, Immunoblots from HCT116 cells stably expressing a dox-inducible shRNA targeting HPRT1 (i-shHPRT1) or scrambled (i-shCtrl) that were injected subcutaneously into NSG nude mice. Dox treatment was administered after tumor formation (100 mm3). Tumor growth was monitored after tumor onset and for the indicated times. Data are shown as mean ± s.d. from 7 independent animals. *P < 0.05 was calculated using a two-sided Student’s t-test.
We aimed to understand the role of the salvage pathway in tumor growth and how it compares to the de novo pathway. We employed CRISPR–Cas9 to deplete the de novo purine synthesis enzyme GART, or the salvage enzymes HPRT1 or APRT in cancer cell lines of different origins, including breast (human Cal-51), kidney (murine Renca) or colon (murine MC38) (Figures 6B–E). While we achieved GART and HPRT1 deficiency, deleting APRT proved challenging (Figures 6C–F and S5B–D). Interestingly, the Cancer Dependency Map (DepMap) identified APRT as a largely essential gene across numerous cancer cell lines.33
Strikingly, GART deficiency prevented tumor formation, while loss of HPRT1 significantly decreased tumor growth from Cal-51, Renca, and MC38 cells (Figures 6C–E and S5B). In vivo infusions further corroborated the critical role of HPRT1 in tumor purine salvage, demonstrating a significant decrease in purine nucleotide labeling from 15N4-inosine, 13C5-hypoxanthine, and 15N5-guanosine in HPRT1-deficient tumors (Figure S5E–H). Knockdown of APRT with shRNA also reduced adenine salvage (Figure S5I) the growth of Cal-51-derived tumors (Figure 6F).
We also induced liver cancer through a hydrodynamic tail-vein injection that delivered plasmids expressing MYC and β-catenin, together with Cas9/sgRNA targeting GART, HPRT1, or control (GAL4).34 MYC and β-catenin cooperate in liver carcinogenesis35,36, resulting in rapid tumor formation within two weeks. Remarkably, loss of GART or HPRT1 significantly reduced tumor growth, accompanied by a decreased liver/body weight ratio (Figures 6G–J, S5J and S5K). Overall, these data indicate a critical role for both the salvage and de novo synthesis pathways in tumor growth, with the latter having a stronger effect.
To further examine the necessity of the salvage pathway for tumor growth, we used a dox-inducible shRNA to deplete HPRT1 in Cal-51 and HCT116 cells after tumors formed (~100 mm3). Depletion of HPRT1 significantly reduced tumor growth in both models (Figures 6K and 6L), demonstrating a significant role of HPRT1 and the salvage pathway for tumor growth.
We also investigated whether the abundance of circulating nucleotides impacted tumor growth. While nucleotides are naturally present in all food sources, particularly those from animal products, the presence of nucleotides are very limited in normal mouse diet. Thus, we subjected mice bearing various tumor types, to oral administration of a balanced nucleotide mixture containing purine and pyrimidine nucleotide monophosphates (AMP, GMP, CMP, UMP; total nucleotide content ~ 2.5% of the total diet) (Figure 7A).
Figure 7: Dietary nucleotides promote tumor growth.
A, Schematic of experimental design. Tumor-bearing mice were subjected to vehicle control (water) or a nucleotide mixture (AMP, GMP, CMP, UMP). When tumors become palpable (~100 mm3), nucleotides were administered orally for 6 days/week and for the indicated times.
B, Cal-51 breast cancer cells were injected subcutaneously into athymic nude mice. After tumor formation (100 mm3) animals were treated with vehicle or a nucleotide mixture for six consecutive weeks. Tumor growth was monitored after tumor onset for the indicated times. Data are shown as mean ± s.d. from 6–8 independent animals. **P < 0.01 was calculated using a two-sided Student’s t-test.
C, As in (B), but tumor growth was assessed from NSG mice injected with HCT-116 colorectal cancer cells and treated with vehicle or a nucleotide mixture for three consecutive weeks. Data are shown as mean ± s.d. from 10 independent animals. **P < 0.01 was calculated using a two-sided Student’s t-test.
D, As in (B), but tumor growth was assessed from NSG mice injected with A549 lung cancer cells that were treated with vehicle (water) or a nucleotide mixture for four consecutive weeks. Data are shown as mean ± s.d. from 6–8 independent animals. **P < 0.01 was calculated using a two-sided Student’s t-test.
E, As in (B), but tumor growth was assessed from NSG mice injected with 786-O kidney cancer cells that were treated with vehicle or a nucleotide mixture for five consecutive weeks. Data are shown as mean ± s.d. from 10 independent animals. **P < 0.01 was calculated using a two-sided Student’s t-test.
F, Cal-51 breast cancer cells were injected subcutaneously into athymic nude mice. After tumor formation (100 mm3) animals were treated with vehicle or dipyridamole (25 mg/kg) five times a week for 6 weeks. Tumor growth was monitored as in (B). Data are the mean ± s.d. from 9–10 independent samples. *P < 0.05 was calculated using a two-sided Student’s t-test.
Remarkably, we found that nucleotide supplementation significantly enhanced tumor growth across diverse cancer cell origins, including Cal-51 (breast), HCT116 (colon), A549 (lung), 786-O (kidney) (Figures 7A–E). Consistently, tumors extracted from nucleotide-fed mice displayed increased cell proliferation signal, as evidenced by enhanced Ki-67 immunostaining (Figures S6A, B). Furthermore, inhibiting the entry of circulating nucleobases into cells by treating the mice with dipyridamole, an inhibitor of nucleobase/nucleoside transport (Figure S6C)31,37, reduced the growth of Cal-51 tumor xenografts and lowered tumor purine nucleotides (Figure 7F and S6D). These findings indicate that dietary nucleotides, along with their surrounding nucleobases and nucleosides, play a significant role in promoting tumor growth.
Together, our data demonstrate that tumors use both the de novo synthesis and salvage pathways to maintain purine pools and support a critical role for the salvage pathway in tumor progression.
DISCUSSION
This study uncovers the contributions of the novo and salvage pathways to purine nucleotide generation across major tissues and various tumor types. Through an array of isotope tracers, we elucidate how purines are utilized and produced in mouse tissues.
Among all differentiated organs, the small intestine exhibits the highest rate of de novo purine synthesis, which aligns with its rapid turnover rate (3–5 days) and increased nucleotide demand for frequent cell division.9 Interestingly, the small intestine also displays high expression of nucleobase/nucleotide transporters and efficient salvage of dietary purine bases, aligning with its intrinsic nutrient absorption capacity.
Our extensive tracing analysis revealed the salvage pathway as the predominant route for purine production in differentiated tissues. Notably, different organs displayed unique preferences for purine salvage precursors. Adenine emerged as the most effective base for adenylate supply across most tissues. Surprisingly, adenosine was primarily utilized by the lung and spleen, while guanosine and guanine were predominantly salvaged in the kidney and heart. The kidney also showed high utilization of inosine and hypoxanthine, with inosine being more efficient in labeling purine pools across various tissues. Furthermore, our work also highlights the kidney as the body's primary organ for recycling purine bases and nucleosides. This insight could also explain why kidney disease patients have a heightened risk of gout, a type of arthritis linked to uric acid buildup in the blood. 9,38 Impaired renal function hinders uric acid clearance and may exacerbate its buildup due to inefficient purine recycling, further promoting gout pathogenesis. Future research employing stable isotope tracing studies in human patients is warranted to accurately delineate the contribution of the purine salvage pathway in human pathologies.
Our study also highlights a critical role for purine catabolism in the rapid degradation of hypoxanthine. While hypoxanthine was previously presumed to be the major nucleobase fueling the salvage pathway in differentiated cells, we found that hypoxanthine was poorly taken up or metabolized in tissues due to its rapid degradation by XDH. Inhibition of the XDH-mediated purine catabolism drastically increased hypoxanthine enrichment in tissues (~20%), thereby increasing purine synthesis across tissues comparable to that of adenine salvage. However, we did not observe an effect of XDH-mediated catabolism on guanosine or guanine, despite their very low abundance in circulation. Intriguingly, even with the introduction of 15N-isotope tracers, guanine and guanosine showed minimal abundance in circulation, and their enrichment was almost undetectable in the blood. This occurred despite their rapid sequestration and salvage in the kidney (~10–20% enrichment). Notably, guanine and guanosine are only sparingly soluble in aqueous solutions. Yet, the kidney revealed similar guanine concentrations to those of hypoxanthine, inosine, and adenosine. This may indicate a physiological response where the body rapidly absorbs these bases to maintain low concentrations in the blood.
The cellular contents of adenylates are at least one order of magnitude higher than those of guanylates, likely due to the essential role of adenylates as mediators of energy storage in ATP.39 The rapid degradation of hypoxanthine or the immediate sequestration of guanine and guanosine by selective tissues may provide a mechanism for maintaining adenine to guanine nucleotide ratios, thus avoiding nucleotide imbalances that can trigger stress responses.40
While it is generally believed that cancer cells rely primarily on the de novo pathway to meet the demands for cell proliferation, the contribution of specific purine synthesis pathways to nucleotide supply in tumors in vivo has remained undescribed. Our findings challenge the prevailing notion that tumors predominantly rely on the de novo pathway for purine supply, revealing that de novo synthesis and salvage pathways contribute similarly to maintaining nucleotide pools in tumors. This work also demonstrates a significant role for the salvage pathway in solid tumor growth and metabolism, drawing parallels with the successful use of the purine antimetabolite 6-mercaptopurine (6MP), a competitive inhibitor of HPRT1, in treating blood cancers such as leukemia.41 However, it is important to recognize that the underlying biology of leukemia is markedly different from that of solid tumors, primarily due to distinctions in their respective microenvironments. In the future, it will be interesting to investigate whether stromal or immune cells within the tumor microenvironment secrete specific metabolites, such as nucleobases and nucleosides, that may promote tumor growth, survival, and disease progression.42,43
This study adds nucleotides to the list of nutrients whose availability may be limiting for tumor growth.44 Nutritionists, oncologists, and cancer researchers have taken a keen interest in the potential influence of diet on cancer growth and aggressiveness. Diet can have an impact on cancer growth or the efficacy of cancer therapies by modulating nutrient availability in tumor cells.45–48 However, the impact of nucleotide content in our diet is often overlooked both in physiological and cancer settings. While food in our diet provides carbohydrates, proteins, and fat, it is also a source of nucleotides. For example, meat products and seafood, in particular, are highly enriched for nucleotides. While physiological doses of nucleotides improve immune and gastrointestinal system regeneration after tissue injury, infection, or during neonatal growth49–51, an increase in purine nucleotide content could support nucleic acid synthesis and act as an energy fuel in proliferating cells.52
We show that a nucleotide-rich diet can accelerate tumor growth in different cancer cell types, suggesting that nucleotide availability is a limiting factor for tumor progression. We reason that nucleotides are recycled by the salvage pathway and serve as nutrient sources to promote tumor growth, but further research is needed to decipher the specific mechanisms by which nucleotide supplementation benefits cancer cells (i.e: whether this involves solely tumor purine uptake or salvage (cell-autonomous) or interactions with the surrounding environment (non-cell autonomous).17,30,42,53 In addition to supporting DNA and RNA synthesis or DNA repair, nucleotides derived from the diet can also indirectly promote tumor growth through their catabolism. For example, degradation products of purines such as uric acid, can allosterically inhibit the pyrimidine enzyme UMP synthase (UMPS) and alter the response to therapy with 5-FU.54 In fact, increased production of uric acid was identified as a marker of poor prognosis in rectal cancer patients receiving chemotherapy.55
The anti-tumoral effects induced by de novo purine synthesis inhibition via GART deletion surpassed those observed with the genetic deletion of the salvage enzyme HPRT1, underscoring the crucial role of de novo purine synthesis in tumorigenesis. However, despite de novo purine synthesis being a prominent target for cancer treatment, inhibitors of this pathway do not completely halt tumor growth and frequently encounter resistance. 56 We postulate that this resistance stems from compensatory mechanisms that activate the purine salvage route, providing a countermeasure against de novo inhibitors. Recent research corroborates this notion, revealing that kidney cancer cells with impaired de novo purine biosynthesis due to fumarate hydratase deficiency predominantly depend on the salvage pathway for growth.57
In summary, this study advances our fundamental understanding of the purine synthesis pathways in tissues and cancer and may inform us on designing rational strategies for targeting the de novo and salvage pathways to eradicate tumor growth and overcome resistance and metabolic adaptation to chemotherapy.
Limitations of the study
Through a comprehensive isotope tracer approach, we unveil important insights into distinct nutrient utilization for purine production in tissues and highlight a previously unappreciated role for the salvage pathway in solid tumor growth. While we quantified nutrient contribution post-steady state enrichment, we do not report absolute pathway activity/flux, which requires additional parameters such as rates of metabolite uptake, production, consumption, and exchange fluxes. Future research building on these findings may explore pre-steady-state isotope labeling or arteriovenous metabolite measurements to further elucidate pathway enzyme velocities.58–61
Besides demonstrating a critical role for the salvage pathway in tumor growth, our work also suggests a significant contribution of purine transport in this process. Although we used dipyridamole, an FDA-approved agent for nucleobase/nucleoside transport62, we did not examine the significance of specific purine transporters like ENTs and CNTs in tumor growth. Analysis of large-scale cancer genomic data from cBioPortal reveals ENTs and CNTs, akin to salvage enzymes such as APRT and HPRT1, are amplified in various cancer types63,64, suggesting that cancer cells may enhance nucleotide transporters and salvage mechanisms to promote purine recycling via the salvage pathway. Further research is necessary to elucidate the regulatory mechanisms and roles of specific purine transporters and the salvage pathway in recycling circulatory nucleotides in the context of tumor development, but this is necessary for rationally targeting these pathways in cancer.
STAR★Methods
RESOURCE AVAILABILITY
Lead contact
Requests of information and requests for reagents should be directed and will be fulfilled by the Lead Contact, Gerta Hoxhaj (gerta.hoxhaj@utsouthwestern.edu)
Materials availability
All unique reagents generated in this study will be made available by the Lead Contact.
Data and code availability
Original western blot and microscopy images have been deposited at Mendeley and are publicly available as of the date of publication. DOI is listed in the key resources table.
This paper does not report original code.
Any additional information is available from the lead contact upon request.
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| ADA | Proteintech Group | 13328-1-AP |
| ADSL | Proteintech Group | 15264-1-AP |
| ADSS | Proteintech Group | 16373-1-AP |
| APRT | Abcam | ab196558 |
| Brdu | Abcam | ab8039 |
| Ki67 | Abcam | ab279653 |
| ATIC | Proteintech Group | 10726-1-AP |
| β-Actin | Sigma-Aldrich | A5316 |
| c-Myc | Cell Signaling Technology | 18583S |
| ENT1 | Santa Cruz Biotechnology | sc-377283 |
| ENT2 | Santa Cruz Biotechnology | sc-373871 |
| GART | Proteintech Group | 13659-1-AP |
| GMPS | Proteintech Group | 16376-1-AP |
| HPRT | Santa Cruz Biotechnology | sc-376938 |
| IMPDH1 | Proteintech Group | 22092-1-AP |
| IMPDH2 | Proteintech Group | 12948-1-AP |
| Nucleoside phosphorylase (PNP) | Proteintech Group | 18009-1-AP |
| PAICS | Proteintech Group | 12967-1-AP |
| PFAS | Cell Signaling Technology | 61852S |
| PPAT | Proteintech Group | 15401-1-AP |
| PRPS1 | Proteintech Group | 15549-1-AP |
| PRPS2 | Proteintech Group | 27024-1-AP |
| Vinculin | Cell Signaling Technology | 13901S |
| XDH | Proteintech Group | 5156-1-AP |
| Anti-mouse secondary antibody | Cell Signaling Technology | 7076S |
| Anti-mouse Alexa Fluor 488 antibody | Thermo Scientific | A-21202 |
| Anti-rabbit secondary antibody | Cell Signaling Technology | 7074V |
| Bacterial and virus strains | ||
| NEB Stable Competent E. coli | NEB | C3040 |
| Biological samples | ||
| Human adjacent kidney tissue | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| L-Glutamine (15N2) | Cambridge Isotope Laboratories Inc. | NLM-1328-0.25 |
| L-Glutamine (Amide-15N) | Cambridge Isotope Laboratories Inc. | NLM-557-1 |
| Adenine(15N5) | Cambridge Isotope Laboratories Inc. | NLM-6924-PK |
| Adenosine(15N5) | Cambridge Isotope Laboratories Inc. | NLM-9750-SL-10 |
| Adenosine(15N5) | BOC Sciences | N/A |
| Hypoxanthine (13C5) | Cambridge Isotope Laboratories Inc. | CLM-8042-0.01 |
| Inosine (15N4) | Cambridge Isotope Laboratories Inc. | NLM-4264-PK |
| Inosine (13C5) | Omicron Biochemicals Inc. | NUC-072 |
| Guanosine (15N5) | Cambridge Isotope Laboratories Inc. | NLM-3798-50 |
| Guanine (15N5) | Cambridge Isotope Laboratories Inc. | NLM-6925-PK |
| Adenine (3H) | PerkinElmer | NET063001MC |
| Hypoxanthine Monohydrochloride (3H) | PerkinElmer | NET177001MC |
| AMP | Sigma-Aldrich | 01930 |
| Brdu | Sigma-Aldrich | B9285-1G |
| Hoechst | Sigma-Merck | 62249 |
| GMP | Sigma-Aldrich | G8377 |
| CMP | Sigma-Aldrich | C1006 |
| UMP | Sigma-Aldrich | U6375 |
| Doxycycline HCl | Research Products International | 10592-13-9 |
| Allopurinol | Cayman Chemical Company | 10012597 |
| Azoxymethane (AOM) | Sigma-Aldrich | A5486-25MG |
| Dextran sulfate sodium salt (DSS) | MP Biomedicals | 9011-18-1 |
| AG 2037 | MedKoo Biosciences, Inc. | 202200 |
| Dipyridamole | Sigma-Aldrich | D9766 |
| Methanol Optima® LC/MS | Fisher Scientific | A456-4 |
| Polybrene®, 10 mg/mL, Liquid | Santa Cruz Biotechnology | sc-134220 |
| Puromycin dichloride | Santa Cruz Biotechnology | sc-108071A |
| PolyJet™ DNA In Vitro Transfection Reagent | SL100688 | SignaGen Laboratories |
| Glutamine-free DMEM | Gibco | 11960-044 |
| Opti-MEM media | ThermoFisher | 31985062 |
| Lipofectamine™ 3000 | Invitrogen™ | L3000015 |
| DMEM | Corning | 10-017-CV |
| MEM α, nucleosides, | Gibco | 11900-024 |
| Fetal bovine serum (FBS) | R&D Systems a biotech brand | S11150 |
| Fetal Bovine Serum dialyzed | R&D Systems a biotech brand | S12850 |
| Cultrex Basement Membrane Extract, Type 3, Pathclear | R&D Systems | 3632-010-02 |
| SuperSignal™ West Femto Chemiluminescent | Thermo Fisher Scientific | PI34096 |
| SuperSignal™ West Pico PLUS | Thermo Fisher Scientific | PI34580 |
| Microcystin-LR | Enzo Life Sciences | NC9580520 |
| Bio-Rad Bradford | Bio-Rad | 5000006 |
| Pierce™ BCA Protein Assay Kit | Thermo Fischer Scientific | 23225 |
| Protease inhibitor cocktail | Sigma-Aldrich | P8340-5ML |
| Lenti-X™ Packaging Single Shots | Takara | 631278 |
| Millicell Cell Culture Insert, 30 mm, hydrophilic PTFE, 0.4 μm | Sigma-Aldrich | PICM0RG50 |
| Heparinized Micro-Hematocrit capillary tubes | Fisherbrand | 22-362-566 |
| Critical commercial assays | ||
| SomaPlex™ Reverse Phase Protein Microarray Human Breast Tumor & Normal Tissue | Protein Biotechnologies | PMA2-001-L |
| Quick-RNA Purification Kit | Zymo Research | R1055 |
| EcoDry Premix | Takara | 639545 |
| SsoAdvanced Universal SYBR Green Supermix | Bio-Rad | 1725274 |
| Deposited Data | ||
| A study by Tran_Kim_Kesavan et al, unprocessed files | Mendeley Data | https://data.mendeley.com/preview/5jssj677my?a=c9cf0818-90fd-4eb6-909a-92ef9e01098d |
| Experimental Models: Cell Lines | ||
| Cal-51 | DSMZ | ACC 302 |
| HCT-116 | ATCC | CCL-247 |
| Renca | ATCC | CRL-2947 |
| A549 | ATCC | CCL-185 |
| 786-0 | ATCC | CRL-1932 |
| MC-38 | Kerafast | ENH204-FP |
| ΔHPRT1 Cal-51 | This study | N/A |
| ΔGART Cal-51 | This study | N/A |
| i-shHPRT1 Cal-51 (dox-inducible) | This study | N/A |
| i-shAPRT Cal-51 (dox-inducible) | This study | N/A |
| ΔHPRT1 HCT-116 | This study | N/A |
| ΔGART HCT-116 | This study | N/A |
| i-shHPRT1 HCT-116 (dox-inducible) | This study | N/A |
| Δ HPRT1 Renca+EV | This study | N/A |
| ΔHPRT1 Renca+HPRT1 | This study | N/A |
| ΔGART Renca | This study | N/A |
| ΔHPRT1 MC38+EV | This study | N/A |
| ΔHPRT1 MC38+HPRT1 | This study | N/A |
| ΔGART MC38 | This study | N/A |
| Experimental models: Organisms/strains | ||
| NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG mice) | The Jackson Laboratory | 005557 |
| NU/J, Homozygous for Foxn1<nu> (Nude mice) | The Jackson Laboratory | 002019 |
| BALB/cJ mouse strain | The Jackson Laboratory | 000651 |
| FVB/NJ mouse strain | The Jackson Laboratory | 001800 |
| LAP-MYC mouse | Laboratory of Hao Zhu (UTSW) | N/A |
| Recombinant DNA | ||
| Lenti-III-EF1α vector | ABMGood | LV043 |
| HPRT1 | OriGene | RC200462 |
| Lenti-III-human HPRT1-EF1α | This study | N/A |
| Lenti-III-mouse HPRT1-EF1α | This study | N/A |
| Lenti-III-mouse GART-PGK | This study | N/A |
| piSMART hEF1a/TurboRFP HPRT1 | Horizon (Dharmacon) | V3SH11252-230205535 |
| piSMART hEF1a/TurboRFP APRT | Horizon (Dharmacon) | V3SH11252-224780830 |
| SMARTvector Inducible non-targeting | Horizon (Dharmacon) | VSC11651 |
| HPRT1 sgRNA (human) | Santa Cruz | sc-417332 |
| PX458 | Addgene | #48138 |
| GART sgRNA (human)-PX458 | Soflaee et al., 2022 | PMID:35577785 |
| HPRT1 sgRNA (mouse)-PX458 | This study | N/A |
| GART sgRNA (mouse)-PX458 | This study | N/A |
| px333 | Addgene | 64073 |
| HPRT1 sgRNA (mouse) - px333 | This study | N/A |
| GART sgRNA (mouse) - px333 | This study | N/A |
| GAL4 sgRNA (non-targeting control)-px333 | Hao Zhu lab | N/A |
| SB100 transposase | Addgene | #34879 |
| c-myc-PT3EF1a | Addgene | #92046 |
| pT3-EF1aH N90-beta-catenin | Addgene | #86499 |
| Software and algorithms | ||
| GraphPad Prism v.9.4.1 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| ImageJ withJava 1.8.0_172 | National Institute of Health | https://imagej.nih.gov/ij/download.html |
| Profinder B.08.00 | Agilent | https://www.agilent.com/en/product/software-informatics/mass-spectrometry-software/data-analysis |
| BioRender | ©BioRender | biorender.com |
| QuPath 0.3.2 | Queen’s University, Belfast, Northern Ireland | https://qupath.github.io/ |
| Bio-Rad CFX Manager software v3.1.1517.0823 | Bio-rad | 1845000 |
| Other | ||
| 6550 iFunnel Q-TOF | Agilent | N/A |
| 6546 LC/Q-TOF | Agilent | N/A |
| SpectraMax iD3- Microplate reader | Molecular devices | N/A |
| LUNA-II™ Automated Cell Counter | LUNA-II™ | N/A |
| SpeedVac SPD2030 | Thermoscientific | Model: SPD2030-220 |
| CFX384 Touch Real-Time PCR Detection System | Bio-rad | 1855484 |
| NE-4000 Two Channel Syringe Pump | New Era Pump Systems | NE-4000 |
| Beckman LS6000LL Multi-Purpose Scintillation Counter | Beckman Coulter | LS 6500 |
EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS
Mice
All mouse procedures were performed according to protocols approved by the Institutional Animal Care and the Use Committee at the University of Texas Southwestern Medical Center. Two to eight weeks old male mice were used, as described in the Method Details section. Most procedures were under protocol no. 2020–102880, but the orthotopic PDX was under protocol no: 2015–100932, and hydrodynamic liver gene delivery was under protocol no: 2015–101118.
Human samples
The human kidney cortex was collected from two male patients, aged 67 and 74 years old, undergoing scheduled nephrectomy. Patients were recruited and enrolled after informed consent was obtained under protocol - STU2019–1061. All human subjects research is overseen by the University of Texas Southwestern Medical Center Institutional Review Board (IRB).
Cell Culture
Cells were maintained in DMEM (Corning/Cellgro, 10–017-CV) containing 10% fetal bovine serum (FBS). Cancer cell lines, such as Renca, HCT-116, A549, and 786-O, were obtained from American Type Culture Collection. Cal-51 and MC-38 were acquired from DSMZ and Kerafast, respectively.
METHOD DETAILS
Ex vivo tracing of human kidney sections
The human kidney cortex embedded in 0.1% agarose were sectioned into ~ 300-μm-thick slices using a microtome (Compresstome VF-300 Precisionary Instruments).65 Slices of the kidney section were then transferred to hydrophilic PTFE cell culture inserts (MilliporeSigma™ PICM0RG50) and maintained in 10% dialyzed human serum in DMEM. Before labeling with isotope-labeled nutrients, slices were washed with 0.9% saline twice. For glutamine tracing experiments, slices were incubated in glutamine-free DMEM containing 10% dialyzed FBS and 2 mM [γ, α-15N]-glutamine; for hypoxanthine and adenine tracing experiments, slices were incubated with DMEM containing 10% dialyzed FBS and 5 μM [13C5]-hypoxanthine, and 5 μM [15N5]-adenine, respectively. All labeling experiments were performed for 3h. Metabolites were extracted with 500 μl of ice-cold 80% methanol as previously described.66 Metabolite extracts from the pooled supernatants were dried down in a SpeedVac concentrator. Dried samples were resuspended in 0.1% formic acid in water and run in a 6550 iFunnel Q-TOF (Agilent Technologies).
Isotope tracer infusions in wild-type mice
Mice were housed in pathogen-free animal care facilities with a 12:12 light/dark cycle and fed a chow diet (Envigo, Teklad Global 16% Protein Rodent Diet) ad libitum. All infusions were performed without prior fasting.67 Healthy 6–10 week-old male mice (C57BL/Ka) were initially anesthetized using ketamine and xylazine (75 mg kg−1 and 10 mg kg−1, intraperitoneally (i.p.)) and maintained under anesthesia for the duration of the infusion through subsequent doses of ketamine and xylazine as needed. A 27-gauge catheter was inserted into the mouse tail vein and the stable isotope was administered as described below. For glutamine infusions: a total dose of 2.5 g kg−1 of [γ-15N]-glutamine67 or [γ, α-15N]-glutamine was dissolved in 1,500 μl normal saline and administered as a bolus of 150 μl min−1 for 1 min followed by a constant infusion rate of 2.5 μl min−1 for 5 h. Infusions were performed with 4 mM [15N5]-adenine, 1mM [15N5]-adenosine, 24 mM [15N4]-inosine, 12 mM [13C5]-hypoxanthine, 4 mM [15N5]-guanosine, and 4 mM [15N5]-guanine, respectively. First, a bolus of 125 μl min−1 was administered for one minute, followed by a constant infusion rate of 0.1 μl min−1 g−1 for 5 h for adenine, hypoxanthine, inosine, or a constant infusion rate of 0.3 μl min−1 g−1 for 5 h for adenosine, guanosine, and guanine. Blood was collected retro-orbitally during the procedure to assess tracer enrichment. At the end point of the infusion, mice were euthanized and tissues were rapidly collected and frozen in liquid nitrogen. For the allopurinol treatment experiment, allopurinol (25 mg/kg/day) or vehicle was administered via oral gavage for 8 consecutive days, prior to [13C5]-hypoxanthine and [15N5]-guanosine infusions that were performed as described above. The indicated tumor-bearing mice (~1.5–2 cm) were also treated with allopurinol (25 mg/kg/day) for 8 consecutive days, prior to [13C5]-hypoxanthine infusions.
Oral gavage delivery of isotope tracers
The total amount of nucleobases used during the infusions was calculated, and a single dose of these molecules was administered via oral gavage to 6–8 week old male mice. We administered 1X dose of [15N5]-adenine (same as infusions), but a 5X dose was used for [13C5]-hypoxanthine, [15N5]-guanosine, or [15N5]-guanine. Tissues were collected 5 hours after oral gavage.
Isotope tracer infusions in tumor models.
Subcutaneous tumor models. Male athymic nude mice (6–8 weeks old) were subcutaneously injected with Cal-51 cells (5 × 106 cells) in one of the flanks. Similarly, 5 × 106 Renca cells were subcutaneously injected into 6–8 week old BALB/cJ male mice, while 5 × 106 cells HCT-116 were injected into NSG mice. Tumor growth was monitored weekly. Intravenous infusions were performed when the tumor size reached ~1.5–2 cm3. The same infusion conditions established for wild-type mice (see above) were used for [γ-15N]-glutamine, [γ, α-15N]-glutamine, [15N5]-adenine, [15N5]-adenosine, [15N4]-inosine, [13C5]-hypoxanthine, [15N5]-guanosine, and [15N5]-guanine. After a 5-hour infusion, tumors were rapidly collected, frozen in liquid nitrogen, and processed for metabolomics analysis.
For treatment with AG203718, mice bearing Cal-51 tumors were subjected to treatment with AG2037 (5 mg/kg) or vehicle (PBS) when tumors reached ~100 mm3. Mice were treated with these agents three times a week for 3 weeks and then subjected to [γ, α-15N]-glutamine infusion (5 hours). Tissues and tumors were rapidly collected and frozen in liquid nitrogen.
Orthotopic patient-derived xenograft of RCC
The PDX line XP490 was derived from a 64-year-old male diagnosed with ccRCC and was previously described.68 Tumor fragments were implanted orthotopically into the renal capsule of 6-week-old non-obese diabetic severe combined immunodeficient (NOD/SCID) male mice as previously described.68 Tumor growth was monitored weekly by physical examination. When tumors reached medium volume (~ 100 mm3), the mice were subjected to the [γ, α-15N]-glutamine, and [13C5]-hypoxanthine infusions, using methods similar to those described for wild-type mice.
Chemically induced colon cancer model
The Azoxymethane (AOM)/ dextran sodium sulfate (DSS) colon cancer model was performed as described previously.23 Briefly, 6 weeks old BALB/cJ male mice were injected one time intraperitoneally with 10 mg/kg AOM. A week later, mice were subjected to 2.5 % DSS containing drinking water (free access) for 7 days (cycle 1). One week after the first cycle of DSS treatment, mice were subjected to another cycle of DSS for 7 consecutive days. 14–15 weeks from the first AOM injection, mice underwent intravenous infusions with [γ, α-15N]-glutamine, [15N5]-adenine, and [13C5]-hypoxanthine. BALB/cJ mice that were subjected to the same housing conditions, but treated with vehicle (PBS) were used as controls and subjected to the intravenous infusion. Colon sections (sigmoid and descending) were rapidly collected, frozen in liquid nitrogen, and processed later for metabolite analysis.
cMyc-driven Hepatocellular carcinoma (HCC) Model
The MYC-driven HCC transgenic model (LAP-tTA;TRE-MYC) was a kind gift from Hao Zhu and previously described.24,26 Tetracycline transactivator (tTA) expression is under the control of the liver activator protein (LAP). The c-MYC expression is under the control of the tetracycline response element (TRE). Mice were maintained in doxycycline-containing water (1 g/L) to suppress MYC. To induce MYC in male mice, doxycycline water was replaced with regular water at ~two weeks of age and for ~ 5 weeks. Mice were then infused with [γ, α-15N]-glutamine, [15N5]-adenine, and [13C5]-hypoxanthine for 5 hours. Liver tumors and normal adjacent livers were collected and processed for metabolomics and western blot analysis.
Hydrodynamic transfection (HDT) to induce β-Catenin/Myc-driven liver cancer
Wild-type male FVB mice (Jackson Laboratories) ~6 weeks of age (body weight of ~20 g) were used to perform the hydrodynamic transfection as previously described (Chen and Calvisi, 2014). To induce simultaneous hepatocyte-specific expression of MYC and β-Catenin and deplete the genes of interest, we performed hydrodynamic injections with a cocktail of plasmids that included transposon vectors expressing MYC (c-myc-PT3EF1a) or β-Catenin (pT3-EF1-CTNNB1), a vector expressing SB100 transposase (pCMV(CAT)T7-SB100) to integrate the transposon expressing vectors in the liver, and a CRISPR-Cas9 vector (px333) expressing sgRNAs for each gene of interest (Gart, Hprt1, and non-targeting control Gal4). Two sgRNAs for each gene were cloned into a px333 backbone that allows tandem expression of two sgRNAs from independent promoters. MYC, CTNNB1, and the px333 plasmids were combined at a 10:1 mass ratio with SB100 transposase plasmid and resuspended in 2 mL of saline. The plasmid mix was administered via tail vein injection within 7 seconds, and the livers were analyzed two weeks later. The liver weight and body weight were measured, and the ratio was used as a proxy for tumor burden. Liver samples were collected for immunohistochemistry and immunoblotting. Microtumors were quantified from whole slide images of H&E, using the QuPath image analysis software.69 First, a pixel classifier was trained using the artificial neural network classifier at moderate resolution on the hematoxylin channel. Two sections from experimental mice and one section from control mice were used to train the classifier until microtumors were defined as closely as possible. Multiple regions of high hematoxylin density, which correspond to microtumors, were manually annotated as “tumor” and multiple regions of normal hematoxylin density which correspond to typical liver tissue were manually annotated as class “stroma”. Whitespace area was ignored. The classifier was then applied onto the whole slide images to measure the proportion of the section that was tumor. The percentage of the tumor class area for each section was recorded and used for statistical analysis.
Xenograft and Syngeneic tumor experiments
HPRT1 or GART were deleted in Cal-51, Renca, or MC-38 cells using CRISPR–Cas9. 66 GART- or HPRT1-deficient Cal-51 cells (5×106 cells) were subcutaneously injected into athymic nude mice (males, 6–8 weeks of age). HPRT1-deficient Renca (5×106 cells) or MC-38 cells (5×106 cells) stably reconstituted with constructs expressing either empty vector or HPRT1, or wild-type or GART-deficient were subcutaneously injected into BalB/cJ (Renca) or NSG mice (MC-38).
Cal-51 or HCT116 cells (5×106 cells) expressing dox-inducible scrambled shRNA or dox-inducible shRNA against HPRT1 were also subcutaneously injected into athymic nude mice (males, 6–8 weeks of age). Doxycycline (1g/L) was provided in the water to induce shRNA expression once tumors became palpable (100 mm3) and tumor growth was monitored weekly. Similarly, Cal-51 cells (5×106 cells) expressing dox-inducible shRNA against APRT were also injected into mice, and doxycycline (1g/L) in water was provided at the time of tumor cell implantation. Tumor growth was monitored weekly with a caliper, and mice were euthanized prior to tumor reaching a diameter of ~2 cm. For the nucleotide treatment experiments, 5×106 Cal-51 cells were subcutaneously injected into athymic nude mice (Cal-51) (males, 6–8 weeks of age). HCT-116 (0.5×106 cells), A549 (5×106 cells), or 786-O (3×106 cells), cancer cells were subcutaneously injected into NSG mice (males, 6–8 weeks old) (NOD.Cg-Prkdc Il2rg/SzJ Strain: 005557). Mice bearing Cal-51, HCT-116, A549, or 786-O tumors were treated with a cocktail of nucleotide monophosphates (AMP:GMP:CMP:UMP at 1:1:1:1 ratio) when tumors became palpable ~100 mm3.70 The nucleotide mixture was prepared in autoclaved water and filtered (0.22 μm). Mice received the nucleotide mixture (75 mg/day) or vehicle (water) via oral gavage six times/week for 7 weeks. For the dipyridamole experiment, mice bearing Cal-51 tumors (~100 mm3) were injected intraperitoneally with dipyridamole (25 mg/kg) or vehicle (PBS) five times a week for the duration of the experiment.
Immunohistochemistry
Livers that underwent hydrodynamic injection were fixed in 4% paraformaldehyde (PFA) and processed for hematoxylin and eosin staining (H&E) by the Histo Pathology Core, UTSW. The H&E section slides were imaged with an automatic NanoZoomer 2.0-HT (HAMAMATSU, Japan) slide scanner with ×20 mode (0.46 μm/pixel) (UTSW Whole Brain Microscopy Facility (RRID:SCR_017949)).
cDNA constructs, shRNA, and CRISPR/Cas9
HPRT1 cDNA (OriGene, RC200462) was subcloned into a lentivirus vector (Lenti-III-EF1; Abmgood, LV043) with a C-terminal FLAG-tag. Human HPRT1 CRISPR–Cas9 knockout plasmids were obtained from Santa Cruz (sc-417332), while human GART CRISPR–Cas9 knockout plasmids were described previously.71,72 Mouse HPRT1 or GART sgRNA sequences designed with CRISPOR (http://crispor.tefor.net) were cloned into a GFP-Cas9 expressing vector (PX458, Addgene, #48138) or in a px333 (Addgene, 64073). All plasmids were verified by sequencing at the McDermott Center Sequencing Core at University of Texas Southwestern Medical Center.
To generate HPRT1- or GART-deficient cells, cells were transfected with the CRISPR/Cas9 knockout plasmids that express a GFP marker. 48h later, the GFP-positive cells were single-cell sorted in 96-well plates using a BD FACS Aria Fusion (CRI Flow Cytometry Core). GART knockout cells were grown and maintained in nucleotide-containing media (Gibco11900–024), and knockout colonies were screened by immunoblotting. Transfections were performed with PolyJet, according to the manufacturers’ instructions. The dox-inducible lentiviral shRNAs for APRT and HPRT1 were acquired from Dharmacon and lentivirus was generated using Lenti-X™ Packaging Single Shots (Takara). Cal-51 and HCT-116 cells were transduced with lentivirus and selected with puromycin (2 μg/ml), as previously described. 72 The resulting dox-inducible stable cell lines were used in xenograft experiments.
The following sequences were used for px333 or PX458.
HPRT1_m_ex2_S, TAATCATTATGCCGAGGATT
HPRT1_m_ex2_AS, AATCCTCGGCATAATGATTA
HPRT1_m_ex3_S, GTGCTTTAATGTAATCCAGC
HPRT1_m_ex3_AS, GCTGGATTACATTAAAGCAC
GART_m_ex2_S, CGAGTTCTTGTCATCGGTAG
GART_m_ex2_AS, CTACCGATGACAAGAACTCG
GART_m_ex3_S, ACTCGTAGTTGTCGGACCAG
GART_m_ex3_AS, CTGGTCCGACAACTACGAGT
RNA isolation and quantitative real time PCR (RT-qPCR)
Total RNA was isolated from eight-week-old C57BL6 male mice using a Quick-RNA Purification Kit (R1055, Zymo Research). cDNA was generated with 1 microgram of total RNA using the EcoDry Premix (Takara, 639545). The resulting cDNA was diluted 1:4 with nuclease-free water. RT-qPCR was done with Bio-Rad SsoAdvanced Universal SYBR Green Supermix (1725274) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad). Gene expression was normalized to the housekeeping gene Gapdh as previously described. 71 Data analysis was performed using Bio-Rad CFX Manager software (version 3.1.1517.0823). Primer sequences for mouse genes are as below in table:
Gapdh Forward primer: CATCACTGCCACCCAGAAGACTG
Gapdh Reverse primer: ATGCCAGTGAGCTTCCCGTTCAG
Cnt1 Forward primer: GAACAGAGCCAGGATTCGTTGC
Cnt1 Reverse primer: GGCAAAGACATCCTTGACCAGAG
Cnt2 Forward primer: CTGGAGGCTTTGCTACCATAGC
Cnt2 Reverse primer: CCAGTTTGGACAAGGCAAGTGC
Cnt3 Forward primer: CGTCACCAAGTCGGAACTCCAT
Cnt3 Reverse primer: GCAGTTAGCAAATGCGTG
Ent1 Forward primer: CTTCACCTGCCTCAACTCGT
Ent1 Reverse primer: GGCAGTGACAAGGAATACCAGC
Ent2 Forward primer: TCTTGACCCTGAGAAGGAGCCA
Ent2 Reverse primer: CTGTGATGGCAGGAAAGACCGA
Ent3 Forward primer: CCTGGAACTTCTTTGTCACTGCT
Ent3 Reverse primer: GCAACTGCCAGGTAGCTCTCAA
Aprt Forward primer: GTCATTGTGGATGACCTCCTGG
Aprt Reverse primer: TGGTATAGGTCCTAGCCTCTCC
Hprt1 Forward primer: CTGGTGAAAAGGACCTCTCGAAG
Hprt1 Reverse primer: CCAGTTTCACTAATGACACAAACG
Immunoblotting
Cells and tissues were lysed on ice in Triton lysis buffer (1 % Triton X-100, 40 mM HEPES, pH 7.4, 120 mM NaCl, 10 mM sodium pyrophosphate, 10 mM glycerol 2-phosphate, 50 mM NaF, 1 mM EDTA, 1 μM Microcystin-LR (Enzo life sciences, ALX-350–012-C500) and protease inhibitor cocktail (Sigma, P8340)) as previously described.73,74 Lysates were clarified with centrifugation (20,000 g × 15 minutes at 4°C) and protein concentrations were determined with Bradford assay (Biorad, 500–0006) for cells or with Pierce™ BCA Protein Assay Kit (Thermo Scientific, 23225) for tissues. Lysates were subjected to SDS-PAGE and immunoblotting with the following antibodies at 1: 1,000 dilution: ADA (Proteintech Group, 13328–1-AP), ADSL (Proteintech Group, 15264–1-AP), ADSS (Proteintech Group, 16373–1-AP), APRT (Abcam, ab196558), ATIC (Proteintech Group, 10726–1-AP), c-Myc (Cell Signaling Technologies, 18583S), ENT2 (Santa Cruz, sc-373871), GART (Proteintech Group, 13659–1-AP), GMPS (Proteintech Group, 16376–1-AP), HPRT1 (Santa Cruz, sc-376938), IMPDH1 (Proteintech Group, 22092–1-AP), IMPDH2 (Proteintech Group, 12948–1-AP), Nucleoside phosphorylase (PNP) (Proteintech Group, 18009–1-AP), PAICS (Proteintech Group, 12967–1-AP), PFAS (Cell Signaling Technology, 61852S), PPAT (Proteintech Group, 15401–1-AP), PRPS1 (Proteintech Group, 15549–1-AP), PRPS2 (Proteintech Group, 27024–1-AP), Vinculin (Cell Signaling Technologies, 13901S) and XDH (Proteintech Group, 5156–1-AP). β-Actin (Sigma-Aldrich, A5316), anti-mouse secondary antibody (Cell Signaling Technologies, 7076), and anti-rabbit (Cell Signaling Technologies, 7074) were diluted at 1: 5,000. Detection was performed with enhanced chemiluminescence (ECL). Blots were analyzed with ImageJ software version Java 1.8.0_172 (National Institutes of Health) and paneled with Adobe Fireworks 8.
Immunoblotting of Human breast tumors microarray
SomaPlex™ reverse phase protein microarrays of human breast tumors and normal tissue were obtained from Protein Biotechnologies (Product# PMA2–001-L) and immunoblotting was performed according to the manufacturers’ instructions. The arrays were reconstituted with distilled water and washed with TBS-Tween 20 (0.1%) and blocked in the provided Zeptoblock™ protein microarray blocking buffer for two hours at room temperature, prior to incubation with HPRT (1:100 dilution), APRT (1:100 dilution) or ENT2 (1:1000) primary antibodies, overnight at 4°C. Rabbit or mouse secondary antibody was diluted 1:5000 in 5% milk TBS-Tween (0.1%) for 1 hour at RT and enhanced chemiluminescence was used for detection.
BrdU Immuno staining of tissues
Bromodeoxyuridine (BrdU) (Sigma: B9285) was prepared in sterile PBS as a 10 mg/mL stock solution. Eight-week-old male C57BL6 mice received BrdU (100mg/kg) through intraperitoneal (IP) injection. Two hours post-injection, mice were perfused with 20 ml of PBS, followed by tissue collection and overnight fixation in 4% paraformaldehyde (PFA) solution. Tissue sections of 10 μm thickness (obtained with a microtome) were mounted on ThermoSuperfrost slides (Thermo Fisher Scientific, USA).
For histological analysis, tissue sections were stained with a mouse monoclonal anti-BrdU antibody (Abcam: ab8039, 1:1000 dilution) overnight at 4°C. Post-primary antibody incubation, the slides were washed thrice with 0.3% Triton-X 100/PBS (10 min/wash), followed by a 2-hour room temperature incubation with Alexa Fluor 488-conjugated secondary antibody (Thermo Scientific: A-21202, 1:200 dilution in 0.1% Triton-X/PBS). Three subsequent washes were performed with 0.3% Triton-X 100/PBS (10 min/wash). The slides were then mounted using a 50% Glycerol/PBS mounting medium containing 10 μM Hoechst solution (Sigma-Merck, Germany, 62249).
Imaging was taken using a Zeiss LSM 780 Laser Scanning Microscope (Carl Zeiss, Germany) equipped with a 40×1.4 oil Plan-Apochromat objective. The mean fluorescence intensity of the BrdU-positive signal was quantified using ImageJ software version Java 1.8.0_172 (National Institutes of Health), and bar graphs were generated using Prism (GraphPad Prism v.9.4.1).
Immunofluorescence Analysis:
Ki67 immunofluorescence staining in tumor sections was performed as previously described75 with an anti-Ki67 primary antibody (Abcam, ab279653, 1:1000 dilution). Detection of Ki67 was achieved with a Donkey anti-Mouse Alexa Fluor™ 488 secondary antibody (A-21202, Thermo Fisher Scientific Inc, USA). Nuclei were stained with Hoechst 33342 (Sigma-Merck, Germany, 62249). Image acquisition was done a Zeiss LSM 780 Laser Scanning Microscope (Carl Zeiss, Germany) equipped with a high-resolution 40×/1.4 Plan-Apochromat objective lens. Quantification of mean fluorescence intensity of the Ki67-positive cells was performed using ImageJ software (version Java 1.8.0_172, National Institutes of Health).
[2,8-3H] Adenine and [3H] Hypoxanthine incorporation into RNA
Cells were treated as indicated in the figures. Cells were labeled with 1-μCi of either [2,8-3H] Adenine and [3H] Hypoxanthine for 6 hours in DMEM containing 10% dialyzed FBS. Then, RNA was isolated with Quick-RNA Purification Kit (Zymo Research, R1055) according to the manufacturer’s instructions and quantified using a spectrophotometer. Radioactivity was measured by liquid scintillation (35 μl of RNA) and normalized to total RNA concentrations. All conditions were analyzed with biological triplicates.
Cellular Isotope Tracing assays
For [15N4]-inosine tracing in cells, HPRT1-deficient Cal-51 cells expressing empty vector or HPRT1 were plated in DMEM containing 10% FBS in 6 well plates. At 90% confluency, the cells were incubated in DMEM containing 10% dialyzed FBS and 20μM [15N4]-inosine for 30 minutes.
After washing the cells with PBS three times, metabolites were extracted with 500 μl of ice-cold 80% methanol as previously described.66 Metabolite extracts from the pooled supernatants were dried down in a SpeedVac concentrator. Dried samples were resuspended in 100μl water containing 0.1% formic acid and run in a 6546 LC/Q-TOF (Agilent Technologies).
For the purine uptake assay, Cal-51 cancer cells (200,000 cells/well) were plated in DMEM containing 10% FBS in 6 well plates. One day after post-plating, the cells were treated with either vehicle control (DMSO) or 50μM dipyridamole in DMEM containing 10% dialyzed FBS (dFBS). After 16 hours, the cells were incubated in DMEM containing dFBS and either 10μM [15N5]-adenine, 10μM [15N5]-adenosine, 10μM [13C5]-inosine, 10μM [13C5]-hypoxanthine, 10μM [15N5]-guanosine, or 10μM [15N5]-guanine for 5 minutes. After washing the cells with PBS three times, metabolites were extracted as described above.
Effect of purine precursors infusions on purine metabolism
To examine the impact of our infusion protocols on purine levels, four tissues (liver, small intestine, spleen, kidney) were analyzed from mice infused with [15N5]-adenine, [15N5]-adenosine, [15N4]-inosine, [13C5]-hypoxanthine, [15N5]-guanosine, [15N5]-guanine, or saline for 5h. Metabolites were extracted with 1ml of ice-cold 80% methanol as previously described.66 Metabolite extracts were dried down in a SpeedVac concentrator. Dried samples were resuspended in 300μl of 0.1% formic acid in water, and samples were run in a 6546 LC/Q-TOF (Agilent Technologies) in parallel with their control group (saline-infused tissues) to mitigate potential variabilities.
Protein pellets were resuspended in 1 ml of 8M Urea, heated at 60°C, and spun down for 15 minutes. Protein concentrations were quantified with a Pierce™ BCA Protein Assay Kits (Thermo Fisher Scientific). The peak area of each metabolite was normalized with the amounts of protein extracted from the tissue pellet after metabolite extraction (relative peak area). Data are presented as Log2 fold-changes (Relative peak areas of each tracer infusion / saline infusion).
The quantification of purine precursors in kidney
Metabolites were extracted from kidneys (n=5, each kidney weighed 180mg) with 1ml of ice-cold 80% methanol as previously described 66. Metabolite extracts were dried down in a SpeedVac concentrator. Dried samples were resuspended in 300μl of 0.1% formic acid in water and run in a 6546 Q-TOF (Agilent Technologies). To measure the concentration of purine precursors in the samples, four to five dilutions (1nM-5 μM) for each purine precursor (adenine, adenosine, hypoxanthine, inosine, guanine, and guanosine) were prepared to generate standard curves and run side-by-side in a 6546 iFunnel Q-TOF. These dilutions were optimized to align with the range of peak areas we generally observe in our analysis of kidney samples. The amount for each purine precursor was determined from the standard curves. The abundance of each precursors was normalized to the weight of the kidney (~180 mg). The results are presented in ‘μmol of each metabolite/mg of kidney’.
Isotopologue analysis on a 6550 iFunnel Q-TOF or 6546 LC/Q-TOF
Samples were processed and analyzed by a reverse-phase chromatography, using a 1290 UHPLC coupled to a HRMS 6550 iFunnel Q-TOF mass spectrometer (Agilent Technology) or a 6546 LC/Q-TOF (Agilent Technology) as described previously (Tran et al., 2021). Raw data files were analysed with Profinder (Agilent Technologies, version B.08.00 SP3), and peaks were integrated manually for accuracy.
Fractional abundance (%) presents the labeled fraction of the indicated isotopologue (see figures and figure legends). For 15N- or 15N2-glutamine infusion or tracing, the total isotopologue labeling was used to calculate the fractional abundance, to capture the permutations of the nitrogen atoms being incorporated into the purine ring.
Quantification and Statistical Analysis
Statistical analysis was performed using GraphPad Prism 9.4.1 software and Microsoft Excel 365. All error bars represent the standard deviation (SD), except for Figure 2B,C,D,F, 4B, S1A, S2B–H, S2L, and S4E–G, where error bars show the standard error of the mean (SEM). For pairwise comparisons, two-sided Student’s t-tests were used indicated in the figure legends. ImageJ software version Java 1.8.0_172 (National Institutes of Health) was used for Figure. 6A, QuPath 0.3.2 for Figure. 6H, and BioRender for illustrations for Figure 3E, 4A, 5D, 5G, 6B, 6G, 7A, 7F, S1C, S1E, S3A, S4I, S4J, S5E, S6A, S6C, and S6D.
Supplementary Material
A, Schematic of HCT116 colon cancer cells were injected subcutaneously into NSG mice. After tumor formation (100 mm3), animals were treated with vehicle control or a nucleotide mixture for four consecutive weeks, prior to tumor excision and fixation in PFA for analysis in (B).
B, Representative hematoxylin-eosin (H&E) and Ki67 immunofluorescence images of HCT116-derived tumor sections (same experiment as Figure 7C) and described in (A). Ki67 proliferation marker (green) and nuclei (grey) stained with Hoechst are shown. Data is presented as “Relative MFI of Ki67, which indicates the mean fluorescence intensity (MFI) of the Ki67 signal that was normalized to the MFI signal from Hoechst. Each data point represents data from one tumor slide obtained from an independent tumor-bearing mouse (n =5). Data are the mean ± s.d. ***P < 0.001 was calculated using a two-sided Student’s t-test. Scale bars were indicated in the figure.
C, Cellular purine uptake assay. Cal51 cells were treated with Dipyridamole (DPM, 50μM, 16h) prior to a 5-minute incubation with 10 μM of [15N5]-adenine, [15N5]-adenosine, [13C5]-inosine, [13C5]-hypoxanthine, [15N5]-guanosine and [15N5]-guanine. Cells were immediately washed twice with saline, followed by metabolite extraction. Normalized peak areas (peak area/protein) of each tracer are shown. Each data point represents data from one independent biological sample. Data are the mean ± s.d, n=3–4. **P < 0.01 and ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test.
D, Tumor AMP and GMP pools from the experiment shown in Figure 7F. Cal-51 breast cancer cells were injected subcutaneously into athymic nude mice. After tumor formation (100 mm3) animals were treated with vehicle or dipyridamole (25 mg/kg) five times a week for six weeks. Normalized peak areas for AMP and GMP present (peak areas/protein). Data are the mean ± s.d. from 5–6 biologically independent samples. *P < 0.05 was calculated using a two-sided Student’s t-test.
A, Quantifications of the immunoblots for Ent2 are presented from human breast tumor and normal tissue. Data present the mean ± s.d from n = 55 patient samples. Unpaired t-test, ***p < 0.001.
B, Immunoblots of wild type (WT) or ΔGART Renca cancer cells that were injected subcutaneously into BALB/cJ wild-type mice. Tumor growth was monitored after tumor onset for the indicated times. Data are the mean ± s.d. from n = 7 independent animals. ***P < 0.001 was calculated using a two-sided Student’s t-test.
C, Relative incorporation of radiolabel from [3H] Hypoxanthine into RNA in wild-type and HPRT1-deficient (ΔHPRT1) Cal-51, Renca, and MC38 cells. Data are the mean ± s.d. from n = 3 independent samples. **P < 0.01 and ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test.
D, [15N4]-inosine tracing in HPRT1-deficient Cal-51 cells expressing empty vector or HPRT1. Fractional abundance (%) of inosine (M+4), AMP (M+4), and GMP (M+4) are shown. Data are the mean ± s.d from 4 independent samples. ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test.
E, Schematic depicting isotope tracer infusions in tumor-bearing mouse (Renca xenografts).
F, Isotope tracer infusions with [13C5]-hypoxanthine assessing the salvage pathway in tumors derived from Renca ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1. Fractional abundance (%) of tumor hypoxanthine (M+5) and GMP (M+5) are shown. Each data point represents data from one tumor-bearing mouse. Data are the mean ± s.d from 6 independent mice. *P < 0.05 for comparisons were calculated using a two-sided Student’s t-test.
G, As in (F), but isotope tracer infusions with [15N4]-inosine in tumors derived from Renca ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1. Fractional abundance (%) of tumor inosine (M+4), IMP (M+4), AMP (M+4), and GMP (M+4) are shown. Each data point represents data from one tumor-bearing mouse. Data are the mean ± s.d from 6–8 independent mice. *P < 0.05 and **P < 0.01 for comparisons were calculated using a two-sided Student’s t-test.
H, As in (F), but isotope tracer infusions with [15N5]-guanosine in tumors derived from Renca ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1. Fractional abundance (%) of tumor guanosine (M+5), and GMP (M+5) are shown. Each data point represents data from one tumor-bearing mouse. Data are the mean ± s.d from 3–4 independent mice. **P < 0.01 for comparisons were calculated using a two-sided Student’s t-test.
I, Cal-51 cells stably expressing a doxycycline (dox)-inducible shRNA targeting APRT (i-shAPRT) or scrambled (i-shCtrl) were treated with doxycycline for 48 hours prior to incubation with [3H] Adenine (6h labeling). Immunoblots and relative incorporation of radiolabel from [3H] Adenine into RNA are shown. Data are the mean ± s.d. from n = 3 independent samples. ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test
J, Related to 6G and 6J. Immunoblots of GART, HPRT1, and β-actin from liver tumors generated via the hydrodynamic gene delivery. Quantification in Figure 6J are from the indicated immunoblots.
K, Related to 6G and 6H. Ratio of liver weight (LW)/body weight (BW) for liver tumors generated by hydrodynamic gene delivery of β-catenin/Myc while simultaneously targeting GART (sgGART) or HPRT1 (sgHPRT1) with guide RNAs. Control guides (sgCtrl) were used in parallel. Data are the mean ± s.d. from n = 11–19 independent mice. **P < 0.01 was calculated using a two-sided Student’s t-test.
A, Isotope tracer infusions with [γ-15N]-glutamine, [15N5]-adenine, [15N5]-adenosine, [15N4]-inosine, [13C5]-hypoxanthine, [15N5]-guanosine, [γ, α-15N]-glutamine and [15N5]-guanine assessing the de novo and salvage pathway in tumors derived from HCT-116 colorectal cancer cells. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tumor tracer are shown. Each data point represents data from one tumor-bearing NSG mouse. Data are the mean ± s.d from 4–8 independent mice.
B, Isotope tracer infusions with [γ, α-15N]-glutamine assessing the de novo in tumors derived from Cal-51 breast cancer cells or Renca kidney cancer cells. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tumor tracer are shown. Each data point represents data from one mouse. Data are the mean ± s.d from 4–5 independent mice.
C, Isotope tracer infusions with [γ, α-15N]-glutamine or [13C5]-hypoxanthine from an orthotopic patient-derived renal cell carcinoma. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tracers are shown. Each data point represents data from one tumor-bearing NOD/SCID mouse. Data are the mean ± s.d from 4–5 independent mice.
D, Isotope tracer infusions with [15N5]-guanine assessing guanine salvage pathway in tumors derived from Renca cancer cells. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tumor tracer are shown. Each data point represents data from one tumor-bearing BALB/cJ mouse. Data are the mean ± s.d from 4 independent mice.
E, HCT-116 tumor-bearing mice were treated with allopurinol for 8 consecutive days prior to intravenous infusions with [13C5]-hypoxanthine (5h). Fractional abundance (%) of tumor hypoxanthine (M+5), IMP (M+5), AMP (M+5), and GMP (M+5) is shown. Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
F, Related to Figure 5A and S4B. Normalized to tracer graphs indicate the ratio of the fraction labeling of nucleotides (IMP, AMP, GMP) to the fraction labeling of tumor tracer (Cal-51 tumors). Each tracer is color-coded as indicated.
G, Related to Figure 5B, S4B, and S4D. Normalized to tracer graphs indicate the ratio of the fraction labeling of nucleotides (IMP, AMP, GMP) to the fraction labeling of tumor tracer (Renca tumors). Each tracer is color-coded as indicated.
H, Related to Figure S4A. Normalized to tracer graphs indicate the ratio of the fraction labeling of nucleotides (IMP, AMP, GMP) to the fraction labeling of tumor tracer (HCT-116 tumor). Each tracer is color-coded as indicated.
I, Related to Figure 5D,E. Fractional abundance (%) of the indicated metabolites are shown, but from normal colon (vehicle-treated mice) or from tumor-bearing colon (AOM/DSS treatment group) infused with [13C5]-hypoxanthine (described in Figure 5D). Data are from six mice in each treatment group. Each data point represents one colon section (up to two colon sections were obtained from each mouse). Data are the mean ± s.d. from 6 independent mice.
J, Fractional abundance (%) of hypoxanthine (M+5), IMP (M+5), AMP (M+5), GMP (M+5) in normal livers or the MYC-driven HCC. Mice were infused with [13C5]-hypoxanthine. Each data point represents data from one mouse. Data are the mean ± s.d from 7–8 independent mice.
A, Schematic of oral gavage with [15N5]-guanosine, [15N5]-guanine, [13C5]-hypoxanthine or [15N5]-adenine.
B, Fractional abundance (%) of guanosine (M+5) or GMP (M+5) in the indicated tissues from administration of a single bolus of [15N5]-guanosine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 5–6 independent mice.
C, As in (B), but fractional abundance of (%) guanine (M+5), IMP (M+4), AMP (M+4), GMP (M+5) is shown in the small intestine from administration of a single bolus of [15N5]-guanine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 4 independent mice.
D, As in (B), but fractional abundance of (%) hypoxanthine (M+5), IMP (M+5), AMP (M+5), GMP (M+5) is shown in the indicated tissues from administration of a single bolus of [13C5]-hypoxanthine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 3–8 independent mice.
E, As in (B), but fractional abundance of (%) of adenine (M+5), IMP (M+4), AMP (M+5), GMP (M+4) is shown in the indicated tissues from administration of a single bolus of [15N5]-adenine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 4–5 independent mice.
F, Heat Map shows the relative transcript levels of nucleobase/nucleoside transporters (Ent1, Ent2, Ent3, Cnt1, Cnt2, Cnt3) and purine salvage enzymes (Hprt1 and Aprt) across the indicated tissues. Tissue transcripts for each gene were normalized to their respective brain transcripts. These fold changes were integrated in the Heat Map (GraphPad Prism). The heatmap legend is presented in the figure.
G, Mice were treated with vehicle or allopurinol for 8 consecutive days prior to intravenous infusions with [15N5]-guanosine (5h). Normalized peak areas of guanosine (M+5) are shown in lung, spleen and kidney. Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
H, Mice were treated with vehicle or allopurinol for 8 consecutive days. Peak areas of adenine, guanine and hypoxanthine are shown in blood. Each data point represents one mouse. Data are the mean ± s.d from 4–5 independent mice.
A, Tracer enrichment in the blood from intravenous infusions with γ-15N-glutamine. Fractional abundance of glutamine (M+1) is shown for the indicated time points. Data are the mean ± s.e.m from 4–5 independent mice.
B, Schematic of a purine ring showing the incorporation of nitrogen from 15N-glutamine, and atoms from other small molecules, including formyl-THF (Formyl), aspartate (Asp), glycine (Gly), and CO2.
C, Schematic of experiments showing mice treated with vehicle or GART inhibitor (AG2037) (three times/week for three weeks) prior to infusion with [γ,α-15N2]-glutamine (5h). Normalized peak areas for IMP (M+2), AMP (M+2), and GMP (M+2) are shown for the small intestine for both treatment groups. Each data point represents one mouse. Data are the mean ± s.d. from n=4 independent mice.
D, Proliferating (BrdU staining) in different tissues from wild-type mice. Representative merged immunofluorescence images are shown for BrdU (green) detected with an anti-BrdU antibody, and nuclei (grey) stained with Hoechst. Scale bars, 50 μm. Data is presented as “Relative MFI of BrdU,” which indicates the mean fluorescence intensity (MFI) of the BrdU signal that was first normalized to the MFI signal from Hoechst for each tissue slide. The obtained values were further normalized to the small intestine (100%). Data are the mean ± s.d. from n=4 of independent animals.
E, Schematic of de novo and salvage purine synthesis pathway. The de novo purine synthesis enzymes are shown in blue, salvage enzymes are shown in orange, and the shared enzymes between the two pathways are indicated in black.
F, Immunoblots of key enzyme in de novo purine biosynthesis (PRPS1, PRPS2, GART, PFAS, PAICS, ATIC, ADSS, ADSL, GMPS, IMPDH1, and IMPDH2), purine salvage (APRT, HPRT1, ADA) and degradation pathways (XDH, and PNP) in WT mice.
A, Intracellular levels of purine nucleotides (IMP, AMP, GMP) and their salvage pathway precursors (adenine, adenosine, hypoxanthine, inosine, guanine, and guanosine) were assessed via LC/MS analysis from the indicated tissues. The data are presented as peak area/protein amount (Normalized peak areas). Data are the mean ± s.d from 4–5 independent mice, and are representative of two independent experiments.
B, Comparison of respective tracer abundance (peak areas) before (time 0) and after infusions (5h) with [15N5]-adenine, [15N5]-adenosine, [13C5]-hypoxanthine, [15N4]-inosine, [15N5]-guanosine, and [15N5]-guanine. Data are shown as Log2 fold-changes (5h/0h), and are the mean ± s.e.m from 3–5 independent mice. These data indicate that infusions of labeled purines do not cause substantial changes in circulating levels of the respective metabolite in the blood.
C, Comparison of purine nucleotide pools and precursors in four tissues (kidney, small intestine, spleen, liver) from mice infused with [15N5]-adenine or saline (control) for 5h. Normalized peak areas (peak area/protein amount) were measured in the indicated tissues. Data are presented as Log2 fold-changes (Normalized peak areas of [15N5]-adenine infusion/ saline infusions). Data are the mean ± s.e.m. from n=3–5 independent mice.
D, As in (B), but comparison of purine pools was done from mice infused with [15N5]-adenosine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 5 independent mice.
E, As in (B), but comparison of purine pools was done from mice infused with [15N4]-inosine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 3–5 independent mice.
F, As in (B), but comparison of purine pools was done from mice infused with [13C5]-hypoxanthine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 3–5 independent mice.
G, As in (B), but comparison of purine pools was done from mice infused with [15N5]-guanosine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 5 independent mice.
H, As in (B), but comparison of purine pools was done from mice infused with [15N5]-guanine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 3–5 independent mice.
I, Schematic of [15N5]-adenosine labeling showing the incorporation of nitrogen into adenine, inosine, and hypoxanthine. ADA, Adenosine deaminase. PNP, Purine nucleoside phosphorylase.
J, Fractional abundance (%) of adenine (M+5), inosine (M+4), and hypoxanthine (M+4) is shown in the indicated tissues from intravenous infusion with [15N5]-adenosine (5h). Each data point represents one mouse. Data are the mean ± s.d. from n=5 independent mice.
K, Schematic of HPRT1-facilitated salvage indicates the conversion of hypoxanthine and guanine into IMP and GMP, respectively. Inosine and guanosine can undergo PNP-mediated catabolism and converted into hypoxanthine and guanine, respectively, and then utilized by HPRT1. IMPDH (IMP dehydrogenase); GMPS (GMP synthetase); and GMPR (GMP reductase).
L, Tracer enrichment in the blood for intravenous infusions with [15N4]-inosine. Fractional abundance of inosine (M+4) is shown for the indicated time points. Data are the mean ± s.e.m from 3–4 independent mice.
M, Fractional abundance (%) of hypoxanthine (M+4) is shown in the indicated tissues from intravenous infusion with [15N4]-inosine (5h). Data are the mean ± s.d. from n=5 independent mice
N, Purine concentration from mouse kidney (see methods). The results are presented in μmol/mg. Data are the mean ± s.d from 5 independent mice.
Highlights.
The small intestine has high de novo synthesis, while kidney shows high purine salvage.
The de novo synthesis and salvage pathway contribute similarly to tumor purine pools.
The purine salvage pathway plays a crucial role in promoting tumor growth.
Dietary supplementation of nucleotides accelerates tumor growth.
Acknowledgements
We thank Lauren Zacharias for their assistance with MS analysis, and Emma Vidal at DrawImpacts for illustrating Figure 1A. This research was supported by grants from the NIH: R01GM143236 (G.H.); 3R01GM143236-02S1 (equipment grant, G.H); an ACS Scholar Award (RSG-22-177-01-TBE (G.H), a Welch foundation award (I-2067-20210327(G.H)); a TS Alliance Research Grants Program award (885252 (G.H). G.H. is a recipient of a Pew-Stewart Scholar; CPRIT Scholar (CPRIT; RR190087); V Scholar (V2021-019); ACS Scholar awards (RSG-22-177-01-TBE), and UTSW Kidney Cancer SPORE grant (P50CA196516). A.T. was funded by an Emmy Noether Award from the German Research Foundation (DFG, 467788900) and the Ministry of Culture and Science of the State of North Rhine-Westphalia (NRW-Nachwuchsgruppenprogramm). A.T holds the Peter Hans Hofschneider of Molecular Medicine endowed professorship by the Stiftung Experimentelle Biomedizin. We also acknowledge the UTSW Quantitative Light Microscopy Core, a Shared Resource of the Harold C. Simmons Cancer Center, supported in part by an NCI Cancer Center Support Grant, 1P30 CA142543-01 and NIH: 1S10 RR029731-01, and UTSW Whole Brain Microscopy Facility (RRID:SCR_017949).
Footnotes
Declaration of interests
R.J.D. is an advisor for Agios Pharmaceuticals and Vida Ventures. S.J.M. is an advisor for Frequency Therapeutics and Protein Fluidics as well as a stockholder in G1 Therapeutics and Mereo Biopharma. H.Z. has a sponsored research agreement with Alnylam Pharmaceuticals, consults for Flagship Pioneering and Chroma Medicines, and serves on the SAB of Ubiquitix. J.B. is an employee/paid consultant for Arrowhead, Calithera, Esai, Exelixis, and Johnson & Johnson and reports receiving commercial research grants from Arrowhead. All other authors declare no competing interests. Authors declare no competing interests.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
REFERENCES:
- 1.Luengo A, Gui DY, and Vander Heiden MG (2017). Targeting Metabolism for Cancer Therapy. Cell Chem Biol 24, 1161–1180. 10.1016/j.chembiol.2017.08.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Elion GB (1989). The purine path to chemotherapy. Science 244, 41–47. 10.1126/science.2649979. [DOI] [PubMed] [Google Scholar]
- 3.Ariav Y, Ch'ng JH, Christofk HR, Ron-Harel N, and Erez A. (2021). Targeting nucleotide metabolism as the nexus of viral infections, cancer, and the immune response. Sci Adv 7. 10.1126/sciadv.abg6165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Villa E, Ali ES, Sahu U, and Ben-Sahra I. (2019). Cancer Cells Tune the Signaling Pathways to Empower de Novo Synthesis of Nucleotides. Cancers (Basel) 11. 10.3390/cancers11050688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Ali ES, and Ben-Sahra I. (2023). Regulation of nucleotide metabolism in cancers and immune disorders. Trends Cell Biol. 10.1016/j.tcb.2023.03.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Pareek V, Pedley AM, and Benkovic SJ (2021). Human de novo purine biosynthesis. Crit Rev Biochem Mol Biol 56, 1–16. 10.1080/10409238.2020.1832438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Pedley AM, and Benkovic SJ (2017). A New View into the Regulation of Purine Metabolism: The Purinosome. Trends Biochem Sci 42, 141–154. 10.1016/j.tibs.2016.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Lane AN, and Fan TW (2015). Regulation of mammalian nucleotide metabolism and biosynthesis. Nucleic Acids Res 43, 2466–2485. 10.1093/nar/gkv047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.van der Flier LG, and Clevers H. (2009). Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annu Rev Physiol 71, 241–260. 10.1146/annurev.physiol.010908.163145. [DOI] [PubMed] [Google Scholar]
- 10.Shi DD, Savani MR, Abdullah KG, and McBrayer SK (2023). Emerging roles of nucleotide metabolism in cancer. Trends Cancer 9, 624–635. 10.1016/j.trecan.2023.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ben-Sahra I, Hoxhaj G, Ricoult SJH, Asara JM, and Manning BD (2016). mTORC1 induces purine synthesis through control of the mitochondrial tetrahydrofolate cycle. Science 351, 728–733. 10.1126/science.aad0489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.French JB, Jones SA, Deng H, Pedley AM, Kim D, Chan CY, Hu H, Pugh RJ, Zhao H, Zhang Y, et al. (2016). Spatial colocalization and functional link of purinosomes with mitochondria. Science 351, 733–737. 10.1126/science.aac6054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ali ES, Liponska A, O'Hara BP, Amici DR, Torno MD, Gao P, Asara JM, Yap MF, Mendillo ML, and Ben-Sahra I. (2022). The mTORC1-SLC4A7 axis stimulates bicarbonate import to enhance de novo nucleotide synthesis. Mol Cell 82, 3284–3298 e3287. 10.1016/j.molcel.2022.06.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ali ES, Sahu U, Villa E, O'Hara BP, Gao P, Beaudet C, Wood AW, Asara JM, and Ben-Sahra I. (2020). ERK2 Phosphorylates PFAS to Mediate Posttranslational Control of De Novo Purine Synthesis. Mol Cell 78, 1178–1191 e1176. 10.1016/j.molcel.2020.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Liu YC, Li F, Handler J, Huang CR, Xiang Y, Neretti N, Sedivy JM, Zeller KI, and Dang CV (2008). Global regulation of nucleotide biosynthetic genes by c-Myc. PLoS One 3, e2722. 10.1371/journal.pone.0002722. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Murray AW (1971). The biological significance of purine salvage. Annu Rev Biochem 40, 811–826. 10.1146/annurev.bi.40.070171.004115. [DOI] [PubMed] [Google Scholar]
- 17.Vander Heiden MG, and DeBerardinis RJ (2017). Understanding the Intersections between Metabolism and Cancer Biology. Cell 168, 657–669. 10.1016/j.cell.2016.12.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Emmanuel N, Ragunathan S, Shan Q, Wang F, Giannakou A, Huser N, Jin G, Myers J, Abraham RT, and Unsal-Kacmaz K. (2017). Purine Nucleotide Availability Regulates mTORC1 Activity through the Rheb GTPase. Cell Rep 19, 2665–2680. 10.1016/j.celrep.2017.05.043. [DOI] [PubMed] [Google Scholar]
- 19.Sahin B, Kansy JW, Nairn AC, Spychala J, Ealick SE, Fienberg AA, Greene RW, and Bibb JA (2004). Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation. Eur J Biochem 271, 3547–3555. 10.1111/j.1432-1033.2004.04291.x. [DOI] [PubMed] [Google Scholar]
- 20.Furuhashi M. (2020). New insights into purine metabolism in metabolic diseases: role of xanthine oxidoreductase activity. Am J Physiol Endocrinol Metab 319, E827–E834. 10.1152/ajpendo.00378.2020. [DOI] [PubMed] [Google Scholar]
- 21.Nuki G, and Simkin PA (2006). A concise history of gout and hyperuricemia and their treatment. Arthritis Res Ther 8 Suppl 1, S1. 10.1186/ar1906. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Zhu J, and Thompson CB (2019). Metabolic regulation of cell growth and proliferation. Nat Rev Mol Cell Biol 20, 436–450. 10.1038/s41580-019-0123-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Parang B, Barrett CW, and Williams CS (2016). AOM/DSS Model of Colitis-Associated Cancer. Methods Mol Biol 1422, 297–307. 10.1007/978-1-4939-3603-8_26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Shachaf CM, Kopelman AM, Arvanitis C, Karlsson A, Beer S, Mandl S, Bachmann MH, Borowsky AD, Ruebner B, Cardiff RD, et al. (2004). MYC inactivation uncovers pluripotent differentiation and tumour dormancy in hepatocellular cancer. Nature 431, 1112–1117. 10.1038/nature03043. [DOI] [PubMed] [Google Scholar]
- 25.Beer S, Zetterberg A, Ihrie RA, McTaggart RA, Yang Q, Bradon N, Arvanitis C, Attardi LD, Feng S, Ruebner B, et al. (2004). Developmental context determines latency of MYC-induced tumorigenesis. PLoS Biol 2, e332. 10.1371/journal.pbio.0020332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sun X, Wang SC, Wei Y, Luo X, Jia Y, Li L, Gopal P, Zhu M, Nassour I, Chuang JC, et al. (2017). Arid1a Has Context-Dependent Oncogenic and Tumor Suppressor Functions in Liver Cancer. Cancer Cell 32, 574–589 e576. 10.1016/j.ccell.2017.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Cunningham JT, Moreno MV, Lodi A, Ronen SM, and Ruggero D. (2014). Protein and nucleotide biosynthesis are coupled by a single rate-limiting enzyme, PRPS2, to drive cancer. Cell 157, 1088–1103. 10.1016/j.cell.2014.03.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Wang X, Yang K, Xie Q, Wu Q, Mack SC, Shi Y, Kim LJY, Prager BC, Flavahan WA, Liu X, et al. (2017). Purine synthesis promotes maintenance of brain tumor initiating cells in glioma. Nat Neurosci 20, 661–673. 10.1038/nn.4537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Hoxhaj G, and Manning BD (2020). The PI3K-AKT network at the interface of oncogenic signalling and cancer metabolism. Nat Rev Cancer 20, 74–88. 10.1038/s41568-019-0216-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Pavlova NN, Zhu J, and Thompson CB (2022). The hallmarks of cancer metabolism: Still emerging. Cell Metab 34, 355–377. 10.1016/j.cmet.2022.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Boswell-Casteel RC, and Hays FA (2017). Equilibrative nucleoside transporters-A review. Nucleosides Nucleotides Nucleic Acids 36, 7–30. 10.1080/15257770.2016.1210805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Gyorffy B. (2023). Discovery and ranking of the most robust prognostic biomarkers in serous ovarian cancer. Geroscience. 10.1007/s11357-023-00742-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Tsherniak A, Vazquez F, Montgomery PG, Weir BA, Kryukov G, Cowley GS, Gill S, Harrington WF, Pantel S, Krill-Burger JM, et al. (2017). Defining a Cancer Dependency Map. Cell 170, 564–576 e516. 10.1016/j.cell.2017.06.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Chen X, and Calvisi DF (2014). Hydrodynamic transfection for generation of novel mouse models for liver cancer research. Am J Pathol 184, 912–923. 10.1016/j.ajpath.2013.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Ruiz de Galarreta M, Bresnahan E, Molina-Sanchez P, Lindblad KE, Maier B, Sia D, Puigvehi M, Miguela V, Casanova-Acebes M, Dhainaut M, et al. (2019). beta-Catenin Activation Promotes Immune Escape and Resistance to Anti-PD-1 Therapy in Hepatocellular Carcinoma. Cancer Discov 9, 1124–1141. 10.1158/2159-8290.CD-19-0074. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Bisso A, Filipuzzi M, Gamarra Figueroa GP, Brumana G, Biagioni F, Doni M, Ceccotti G, Tanaskovic N, Morelli MJ, Pendino V, et al. (2020). Cooperation Between MYC and beta-Catenin in Liver Tumorigenesis Requires Yap/Taz. Hepatology 72, 1430–1443. 10.1002/hep.31120. [DOI] [PubMed] [Google Scholar]
- 37.Wang C, Lin W, Playa H, Sun S, Cameron K, and Buolamwini JK (2013). Dipyridamole analogs as pharmacological inhibitors of equilibrative nucleoside transporters. Identification of novel potent and selective inhibitors of the adenosine transporter function of human equilibrative nucleoside transporter 4 (hENT4). Biochem Pharmacol 86, 1531–1540. 10.1016/j.bcp.2013.08.063. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Singh JA, and Cleveland JD (2019). Gout is associated with a higher risk of chronic renal disease in older adults: a retrospective cohort study of U.S. Medicare population. BMC Nephrol 20, 93. 10.1186/s12882-019-1274-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Traut TW (1994). Physiological concentrations of purines and pyrimidines. Mol Cell Biochem 140, 1–22. 10.1007/BF00928361. [DOI] [PubMed] [Google Scholar]
- 40.Diehl FF, Miettinen TP, Elbashir R, Nabel CS, Darnell AM, Do BT, Manalis SR, Lewis CA, and Vander Heiden MG (2022). Nucleotide imbalance decouples cell growth from cell proliferation. Nat Cell Biol 24, 1252–1264. 10.1038/s41556-022-00965-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.DeVita VT Jr., and Chu E. (2008). A history of cancer chemotherapy. Cancer Res 68, 8643–8653. 10.1158/0008-5472.CAN-07-6611. [DOI] [PubMed] [Google Scholar]
- 42.Halbrook CJ, Pontious C, Kovalenko I, Lapienyte L, Dreyer S, Lee HJ, Thurston G, Zhang Y, Lazarus J, Sajjakulnukit P, et al. (2019). Macrophage-Released Pyrimidines Inhibit Gemcitabine Therapy in Pancreatic Cancer. Cell Metab 29, 1390–1399 e1396. 10.1016/j.cmet.2019.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Reinfeld BI, Madden MZ, Wolf MM, Chytil A, Bader JE, Patterson AR, Sugiura A, Cohen AS, Ali A, Do BT, et al. (2021). Cell-programmed nutrient partitioning in the tumour microenvironment. Nature 593, 282–288. 10.1038/s41586-021-03442-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Sullivan MR, and Vander Heiden MG (2019). Determinants of nutrient limitation in cancer. Crit Rev Biochem Mol Biol 54, 193–207. 10.1080/10409238.2019.1611733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Kanarek N, Petrova B, and Sabatini DM (2020). Dietary modifications for enhanced cancer therapy. Nature 579, 507–517. 10.1038/s41586-020-2124-0. [DOI] [PubMed] [Google Scholar]
- 46.Kanarek N, Keys HR, Cantor JR, Lewis CA, Chan SH, Kunchok T, Abu-Remaileh M, Freinkman E, Schweitzer LD, and Sabatini DM (2018). Histidine catabolism is a major determinant of methotrexate sensitivity. Nature 559, 632–636. 10.1038/s41586-018-0316-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Bose S, Allen AE, and Locasale JW (2020). The Molecular Link from Diet to Cancer Cell Metabolism. Mol Cell 78, 1034–1044. 10.1016/j.molcel.2020.05.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Maddocks OD, Berkers CR, Mason SM, Zheng L, Blyth K, Gottlieb E, and Vousden KH (2013). Serine starvation induces stress and p53-dependent metabolic remodelling in cancer cells. Nature 493, 542–546. 10.1038/nature11743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Carver JD (1994). Dietary nucleotides: cellular immune, intestinal and hepatic system effects. J Nutr 124, 144S–148S. 10.1093/jn/124.suppl_1.144S. [DOI] [PubMed] [Google Scholar]
- 50.Gil A. (2002). Modulation of the immune response mediated by dietary nucleotides. Eur J Clin Nutr 56 Suppl 3, S1–4. 10.1038/sj.ejcn.1601475. [DOI] [PubMed] [Google Scholar]
- 51.Singhal A, Kennedy K, Lanigan J, Clough H, Jenkins W, Elias-Jones A, Stephenson T, Dudek P, and Lucas A. (2010). Dietary nucleotides and early growth in formula-fed infants: a randomized controlled trial. Pediatrics 126, e946–953. 10.1542/peds.2009-2609. [DOI] [PubMed] [Google Scholar]
- 52.Strefeler A, Blanco-Fernandez J, and Jourdain AA (2024). Nucleosides are overlooked fuels in central carbon metabolism. Trends Endocrinol Metab. 10.1016/j.tem.2024.01.013. [DOI] [PubMed] [Google Scholar]
- 53.Xu X, Chen Z, Bartman CR, Xing X, Olszewski K, and Rabinowitz JD (2023). One-carbon unit supplementation fuels tumor-infiltrating T cells and augments checkpoint blockade. bioRxiv. 10.1101/2023.11.01.565193. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Cantor JR, Abu-Remaileh M, Kanarek N, Freinkman E, Gao X, Louissaint A Jr., Lewis CA, and Sabatini DM (2017). Physiologic Medium Rewires Cellular Metabolism and Reveals Uric Acid as an Endogenous Inhibitor of UMP Synthase. Cell 169, 258–272 e217. 10.1016/j.cell.2017.03.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Teng H, Wang Y, Sui X, Fan J, Li S, Lei X, Shi C, Sun W, Song M, Wang H, et al. (2023). Gut microbiota-mediated nucleotide synthesis attenuates the response to neoadjuvant chemoradiotherapy in rectal cancer. Cancer Cell 41, 124–138 e126. 10.1016/j.ccell.2022.11.013. [DOI] [PubMed] [Google Scholar]
- 56.Holohan C, Van Schaeybroeck S, Longley DB, and Johnston PG (2013). Cancer drug resistance: an evolving paradigm. Nat Rev Cancer 13, 714–726. 10.1038/nrc3599. [DOI] [PubMed] [Google Scholar]
- 57.Wilde BR, Chakraborty N, Matulionis N, Hernandez S, Ueno D, Gee ME, Esplin ED, Ouyang K, Nykamp K, Shuch B, and Christofk HR (2023). FH variant pathogenicity promotes purine salvage pathway dependence in kidney cancer. Cancer Discov. 10.1158/2159-8290.CD-22-0874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Bartman CR, Faubert B, Rabinowitz JD, and DeBerardinis RJ (2023). Metabolic pathway analysis using stable isotopes in patients with cancer. Nat Rev Cancer 23, 863–878. 10.1038/s41568-023-00632-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Hui S, Cowan AJ, Zeng X, Yang L, TeSlaa T, Li X, Bartman C, Zhang Z, Jang C, Wang L, et al. (2020). Quantitative Fluxomics of Circulating Metabolites. Cell Metab 32, 676–688 e674. 10.1016/j.cmet.2020.07.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Bae H, Lam K, and Jang C. (2022). Metabolic flux between organs measured by arteriovenous metabolite gradients. Exp Mol Med 54, 1354–1366. 10.1038/s12276-022-00803-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Bartman CR, TeSlaa T, and Rabinowitz JD (2021). Quantitative flux analysis in mammals. Nat Metab 3, 896–908. 10.1038/s42255-021-00419-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Ward JL, Sherali A, Mo ZP, and Tse CM (2000). Kinetic and pharmacological properties of cloned human equilibrative nucleoside transporters, ENT1 and ENT2, stably expressed in nucleoside transporter-deficient PK15 cells. Ent2 exhibits a low affinity for guanosine and cytidine but a high affinity for inosine. J Biol Chem 275, 8375–8381. 10.1074/jbc.275.12.8375. [DOI] [PubMed] [Google Scholar]
- 63.Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, Sun Y, Jacobsen A, Sinha R, Larsson E, et al. (2013). Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal 6, pl1. 10.1126/scisignal.2004088. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, Jacobsen A, Byrne CJ, Heuer ML, Larsson E, et al. (2012). The cBio cancer genomics portal: an open platform for exploring multidimensional cancer genomics data. Cancer Discov 2, 401–404. 10.1158/2159-8290.CD-12-0095. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Bezwada D, Lesner NP, Brooks B, Vu HS, Wu Z, Cai L, Kasitinon S, Kelekar S, Cai F, Aurora AB, et al. (2023). Mitochondrial metabolism in primary and metastatic human kidney cancers. bioRxiv, 2023.2002.2006.527285. 10.1101/2023.02.06.527285. [DOI] [Google Scholar]
- 66.Tran DH, Kesavan R, Rion H, Soflaee MH, Solmonson A, Bezwada D, Vu HS, Cai F, Phillips JA 3rd, DeBerardinis RJ, and Hoxhaj G. (2021). Mitochondrial NADP(+) is essential for proline biosynthesis during cell growth. Nat Metab 3, 571–585. 10.1038/s42255-021-00374-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Solmonson A, Faubert B, Gu W, Rao A, Cowdin MA, Menendez-Montes I, Kelekar S, Rogers TJ, Pan C, Guevara G, et al. (2022). Compartmentalized metabolism supports midgestation mammalian development. Nature 604, 349–353. 10.1038/s41586-022-04557-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Elias R, Tcheuyap VT, Kaushik AK, Singla N, Gao M, Reig Torras O, Christie A, Mulgaonkar A, Woolford L, Stevens C, et al. (2021). A renal cell carcinoma tumorgraft platform to advance precision medicine. Cell Rep 37, 110055. 10.1016/j.celrep.2021.110055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Bankhead P, Loughrey MB, Fernandez JA, Dombrowski Y, McArt DG, Dunne PD, McQuaid S, Gray RT, Murray LJ, Coleman HG, et al. (2017). QuPath: Open source software for digital pathology image analysis. Sci Rep 7, 16878. 10.1038/s41598-017-17204-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Jyonouchi H, Sun S, Abiru T, Winship T, and Kuchan MJ (2000). Dietary nucleotides modulate antigen-specific type 1 and type 2 t-cell responses in young c57bl/6 mice. Nutrition 16, 442–446. 10.1016/s0899-9007(00)00287-2. [DOI] [PubMed] [Google Scholar]
- 71.Soflaee MH, Kesavan R, Sahu U, Tasdogan A, Villa E, Djabari Z, Cai F, Tran DH, Vu HS, Ali ES, et al. (2022). Purine nucleotide depletion prompts cell migration by stimulating the serine synthesis pathway. Nat Commun 13, 2698. 10.1038/s41467-022-30362-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Hoxhaj G, Ben-Sahra I, Lockwood SE, Timson RC, Byles V, Henning GT, Gao P, Selfors LM, Asara JM, and Manning BD (2019). Direct stimulation of NADP(+) synthesis through Akt-mediated phosphorylation of NAD kinase. Science 363, 1088–1092. 10.1126/science.aau3903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Mary C, Soflaee MH, Kesavan R, Gelin M, Brown H, Zacharias G, Mathews TP, Lemoff A, Lionne C, Labesse G, and Hoxhaj G. (2022). Crystal structure of human NADK2 reveals a dimeric organization and active site occlusion by lysine acetylation. Mol Cell. 10.1016/j.molcel.2022.06.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Hoxhaj G, Hughes-Hallett J, Timson RC, Ilagan E, Yuan M, Asara JM, Ben-Sahra I, and Manning BD (2017). The mTORC1 Signaling Network Senses Changes in Cellular Purine Nucleotide Levels. Cell Rep 21, 1331–1346. 10.1016/j.celrep.2017.10.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Kesavan R, Fromel T, Zukunft S, Laban H, Geyer A, Naeem Z, Heidler J, Wittig I, Elwakeel E, Brune B, et al. (2020). Cyp2c44 regulates prostaglandin synthesis, lymphangiogenesis, and metastasis in a mouse model of breast cancer. Proc Natl Acad Sci U S A 117, 5923–5930. 10.1073/pnas.1921381117. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
A, Schematic of HCT116 colon cancer cells were injected subcutaneously into NSG mice. After tumor formation (100 mm3), animals were treated with vehicle control or a nucleotide mixture for four consecutive weeks, prior to tumor excision and fixation in PFA for analysis in (B).
B, Representative hematoxylin-eosin (H&E) and Ki67 immunofluorescence images of HCT116-derived tumor sections (same experiment as Figure 7C) and described in (A). Ki67 proliferation marker (green) and nuclei (grey) stained with Hoechst are shown. Data is presented as “Relative MFI of Ki67, which indicates the mean fluorescence intensity (MFI) of the Ki67 signal that was normalized to the MFI signal from Hoechst. Each data point represents data from one tumor slide obtained from an independent tumor-bearing mouse (n =5). Data are the mean ± s.d. ***P < 0.001 was calculated using a two-sided Student’s t-test. Scale bars were indicated in the figure.
C, Cellular purine uptake assay. Cal51 cells were treated with Dipyridamole (DPM, 50μM, 16h) prior to a 5-minute incubation with 10 μM of [15N5]-adenine, [15N5]-adenosine, [13C5]-inosine, [13C5]-hypoxanthine, [15N5]-guanosine and [15N5]-guanine. Cells were immediately washed twice with saline, followed by metabolite extraction. Normalized peak areas (peak area/protein) of each tracer are shown. Each data point represents data from one independent biological sample. Data are the mean ± s.d, n=3–4. **P < 0.01 and ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test.
D, Tumor AMP and GMP pools from the experiment shown in Figure 7F. Cal-51 breast cancer cells were injected subcutaneously into athymic nude mice. After tumor formation (100 mm3) animals were treated with vehicle or dipyridamole (25 mg/kg) five times a week for six weeks. Normalized peak areas for AMP and GMP present (peak areas/protein). Data are the mean ± s.d. from 5–6 biologically independent samples. *P < 0.05 was calculated using a two-sided Student’s t-test.
A, Quantifications of the immunoblots for Ent2 are presented from human breast tumor and normal tissue. Data present the mean ± s.d from n = 55 patient samples. Unpaired t-test, ***p < 0.001.
B, Immunoblots of wild type (WT) or ΔGART Renca cancer cells that were injected subcutaneously into BALB/cJ wild-type mice. Tumor growth was monitored after tumor onset for the indicated times. Data are the mean ± s.d. from n = 7 independent animals. ***P < 0.001 was calculated using a two-sided Student’s t-test.
C, Relative incorporation of radiolabel from [3H] Hypoxanthine into RNA in wild-type and HPRT1-deficient (ΔHPRT1) Cal-51, Renca, and MC38 cells. Data are the mean ± s.d. from n = 3 independent samples. **P < 0.01 and ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test.
D, [15N4]-inosine tracing in HPRT1-deficient Cal-51 cells expressing empty vector or HPRT1. Fractional abundance (%) of inosine (M+4), AMP (M+4), and GMP (M+4) are shown. Data are the mean ± s.d from 4 independent samples. ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test.
E, Schematic depicting isotope tracer infusions in tumor-bearing mouse (Renca xenografts).
F, Isotope tracer infusions with [13C5]-hypoxanthine assessing the salvage pathway in tumors derived from Renca ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1. Fractional abundance (%) of tumor hypoxanthine (M+5) and GMP (M+5) are shown. Each data point represents data from one tumor-bearing mouse. Data are the mean ± s.d from 6 independent mice. *P < 0.05 for comparisons were calculated using a two-sided Student’s t-test.
G, As in (F), but isotope tracer infusions with [15N4]-inosine in tumors derived from Renca ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1. Fractional abundance (%) of tumor inosine (M+4), IMP (M+4), AMP (M+4), and GMP (M+4) are shown. Each data point represents data from one tumor-bearing mouse. Data are the mean ± s.d from 6–8 independent mice. *P < 0.05 and **P < 0.01 for comparisons were calculated using a two-sided Student’s t-test.
H, As in (F), but isotope tracer infusions with [15N5]-guanosine in tumors derived from Renca ΔHPRT1 cells stably expressing either an empty vector (EV) or HPRT1. Fractional abundance (%) of tumor guanosine (M+5), and GMP (M+5) are shown. Each data point represents data from one tumor-bearing mouse. Data are the mean ± s.d from 3–4 independent mice. **P < 0.01 for comparisons were calculated using a two-sided Student’s t-test.
I, Cal-51 cells stably expressing a doxycycline (dox)-inducible shRNA targeting APRT (i-shAPRT) or scrambled (i-shCtrl) were treated with doxycycline for 48 hours prior to incubation with [3H] Adenine (6h labeling). Immunoblots and relative incorporation of radiolabel from [3H] Adenine into RNA are shown. Data are the mean ± s.d. from n = 3 independent samples. ***P < 0.001 for comparisons were calculated using a two-sided Student’s t-test
J, Related to 6G and 6J. Immunoblots of GART, HPRT1, and β-actin from liver tumors generated via the hydrodynamic gene delivery. Quantification in Figure 6J are from the indicated immunoblots.
K, Related to 6G and 6H. Ratio of liver weight (LW)/body weight (BW) for liver tumors generated by hydrodynamic gene delivery of β-catenin/Myc while simultaneously targeting GART (sgGART) or HPRT1 (sgHPRT1) with guide RNAs. Control guides (sgCtrl) were used in parallel. Data are the mean ± s.d. from n = 11–19 independent mice. **P < 0.01 was calculated using a two-sided Student’s t-test.
A, Isotope tracer infusions with [γ-15N]-glutamine, [15N5]-adenine, [15N5]-adenosine, [15N4]-inosine, [13C5]-hypoxanthine, [15N5]-guanosine, [γ, α-15N]-glutamine and [15N5]-guanine assessing the de novo and salvage pathway in tumors derived from HCT-116 colorectal cancer cells. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tumor tracer are shown. Each data point represents data from one tumor-bearing NSG mouse. Data are the mean ± s.d from 4–8 independent mice.
B, Isotope tracer infusions with [γ, α-15N]-glutamine assessing the de novo in tumors derived from Cal-51 breast cancer cells or Renca kidney cancer cells. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tumor tracer are shown. Each data point represents data from one mouse. Data are the mean ± s.d from 4–5 independent mice.
C, Isotope tracer infusions with [γ, α-15N]-glutamine or [13C5]-hypoxanthine from an orthotopic patient-derived renal cell carcinoma. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tracers are shown. Each data point represents data from one tumor-bearing NOD/SCID mouse. Data are the mean ± s.d from 4–5 independent mice.
D, Isotope tracer infusions with [15N5]-guanine assessing guanine salvage pathway in tumors derived from Renca cancer cells. Fractional abundance (%) of tumor purine nucleotides (IMP, AMP, GMP) and tumor tracer are shown. Each data point represents data from one tumor-bearing BALB/cJ mouse. Data are the mean ± s.d from 4 independent mice.
E, HCT-116 tumor-bearing mice were treated with allopurinol for 8 consecutive days prior to intravenous infusions with [13C5]-hypoxanthine (5h). Fractional abundance (%) of tumor hypoxanthine (M+5), IMP (M+5), AMP (M+5), and GMP (M+5) is shown. Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
F, Related to Figure 5A and S4B. Normalized to tracer graphs indicate the ratio of the fraction labeling of nucleotides (IMP, AMP, GMP) to the fraction labeling of tumor tracer (Cal-51 tumors). Each tracer is color-coded as indicated.
G, Related to Figure 5B, S4B, and S4D. Normalized to tracer graphs indicate the ratio of the fraction labeling of nucleotides (IMP, AMP, GMP) to the fraction labeling of tumor tracer (Renca tumors). Each tracer is color-coded as indicated.
H, Related to Figure S4A. Normalized to tracer graphs indicate the ratio of the fraction labeling of nucleotides (IMP, AMP, GMP) to the fraction labeling of tumor tracer (HCT-116 tumor). Each tracer is color-coded as indicated.
I, Related to Figure 5D,E. Fractional abundance (%) of the indicated metabolites are shown, but from normal colon (vehicle-treated mice) or from tumor-bearing colon (AOM/DSS treatment group) infused with [13C5]-hypoxanthine (described in Figure 5D). Data are from six mice in each treatment group. Each data point represents one colon section (up to two colon sections were obtained from each mouse). Data are the mean ± s.d. from 6 independent mice.
J, Fractional abundance (%) of hypoxanthine (M+5), IMP (M+5), AMP (M+5), GMP (M+5) in normal livers or the MYC-driven HCC. Mice were infused with [13C5]-hypoxanthine. Each data point represents data from one mouse. Data are the mean ± s.d from 7–8 independent mice.
A, Schematic of oral gavage with [15N5]-guanosine, [15N5]-guanine, [13C5]-hypoxanthine or [15N5]-adenine.
B, Fractional abundance (%) of guanosine (M+5) or GMP (M+5) in the indicated tissues from administration of a single bolus of [15N5]-guanosine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 5–6 independent mice.
C, As in (B), but fractional abundance of (%) guanine (M+5), IMP (M+4), AMP (M+4), GMP (M+5) is shown in the small intestine from administration of a single bolus of [15N5]-guanine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 4 independent mice.
D, As in (B), but fractional abundance of (%) hypoxanthine (M+5), IMP (M+5), AMP (M+5), GMP (M+5) is shown in the indicated tissues from administration of a single bolus of [13C5]-hypoxanthine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 3–8 independent mice.
E, As in (B), but fractional abundance of (%) of adenine (M+5), IMP (M+4), AMP (M+5), GMP (M+4) is shown in the indicated tissues from administration of a single bolus of [15N5]-adenine via oral gavage. Tissues were collected 5 hours later. Each data point represents one mouse. Data are the mean ± s.d from 4–5 independent mice.
F, Heat Map shows the relative transcript levels of nucleobase/nucleoside transporters (Ent1, Ent2, Ent3, Cnt1, Cnt2, Cnt3) and purine salvage enzymes (Hprt1 and Aprt) across the indicated tissues. Tissue transcripts for each gene were normalized to their respective brain transcripts. These fold changes were integrated in the Heat Map (GraphPad Prism). The heatmap legend is presented in the figure.
G, Mice were treated with vehicle or allopurinol for 8 consecutive days prior to intravenous infusions with [15N5]-guanosine (5h). Normalized peak areas of guanosine (M+5) are shown in lung, spleen and kidney. Each data point represents one mouse. Data are the mean ± s.d from 5 independent mice.
H, Mice were treated with vehicle or allopurinol for 8 consecutive days. Peak areas of adenine, guanine and hypoxanthine are shown in blood. Each data point represents one mouse. Data are the mean ± s.d from 4–5 independent mice.
A, Tracer enrichment in the blood from intravenous infusions with γ-15N-glutamine. Fractional abundance of glutamine (M+1) is shown for the indicated time points. Data are the mean ± s.e.m from 4–5 independent mice.
B, Schematic of a purine ring showing the incorporation of nitrogen from 15N-glutamine, and atoms from other small molecules, including formyl-THF (Formyl), aspartate (Asp), glycine (Gly), and CO2.
C, Schematic of experiments showing mice treated with vehicle or GART inhibitor (AG2037) (three times/week for three weeks) prior to infusion with [γ,α-15N2]-glutamine (5h). Normalized peak areas for IMP (M+2), AMP (M+2), and GMP (M+2) are shown for the small intestine for both treatment groups. Each data point represents one mouse. Data are the mean ± s.d. from n=4 independent mice.
D, Proliferating (BrdU staining) in different tissues from wild-type mice. Representative merged immunofluorescence images are shown for BrdU (green) detected with an anti-BrdU antibody, and nuclei (grey) stained with Hoechst. Scale bars, 50 μm. Data is presented as “Relative MFI of BrdU,” which indicates the mean fluorescence intensity (MFI) of the BrdU signal that was first normalized to the MFI signal from Hoechst for each tissue slide. The obtained values were further normalized to the small intestine (100%). Data are the mean ± s.d. from n=4 of independent animals.
E, Schematic of de novo and salvage purine synthesis pathway. The de novo purine synthesis enzymes are shown in blue, salvage enzymes are shown in orange, and the shared enzymes between the two pathways are indicated in black.
F, Immunoblots of key enzyme in de novo purine biosynthesis (PRPS1, PRPS2, GART, PFAS, PAICS, ATIC, ADSS, ADSL, GMPS, IMPDH1, and IMPDH2), purine salvage (APRT, HPRT1, ADA) and degradation pathways (XDH, and PNP) in WT mice.
A, Intracellular levels of purine nucleotides (IMP, AMP, GMP) and their salvage pathway precursors (adenine, adenosine, hypoxanthine, inosine, guanine, and guanosine) were assessed via LC/MS analysis from the indicated tissues. The data are presented as peak area/protein amount (Normalized peak areas). Data are the mean ± s.d from 4–5 independent mice, and are representative of two independent experiments.
B, Comparison of respective tracer abundance (peak areas) before (time 0) and after infusions (5h) with [15N5]-adenine, [15N5]-adenosine, [13C5]-hypoxanthine, [15N4]-inosine, [15N5]-guanosine, and [15N5]-guanine. Data are shown as Log2 fold-changes (5h/0h), and are the mean ± s.e.m from 3–5 independent mice. These data indicate that infusions of labeled purines do not cause substantial changes in circulating levels of the respective metabolite in the blood.
C, Comparison of purine nucleotide pools and precursors in four tissues (kidney, small intestine, spleen, liver) from mice infused with [15N5]-adenine or saline (control) for 5h. Normalized peak areas (peak area/protein amount) were measured in the indicated tissues. Data are presented as Log2 fold-changes (Normalized peak areas of [15N5]-adenine infusion/ saline infusions). Data are the mean ± s.e.m. from n=3–5 independent mice.
D, As in (B), but comparison of purine pools was done from mice infused with [15N5]-adenosine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 5 independent mice.
E, As in (B), but comparison of purine pools was done from mice infused with [15N4]-inosine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 3–5 independent mice.
F, As in (B), but comparison of purine pools was done from mice infused with [13C5]-hypoxanthine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 3–5 independent mice.
G, As in (B), but comparison of purine pools was done from mice infused with [15N5]-guanosine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 5 independent mice.
H, As in (B), but comparison of purine pools was done from mice infused with [15N5]-guanine or saline. Data are shown as Log2 fold-changes, and are the mean ± s.e.m from 3–5 independent mice.
I, Schematic of [15N5]-adenosine labeling showing the incorporation of nitrogen into adenine, inosine, and hypoxanthine. ADA, Adenosine deaminase. PNP, Purine nucleoside phosphorylase.
J, Fractional abundance (%) of adenine (M+5), inosine (M+4), and hypoxanthine (M+4) is shown in the indicated tissues from intravenous infusion with [15N5]-adenosine (5h). Each data point represents one mouse. Data are the mean ± s.d. from n=5 independent mice.
K, Schematic of HPRT1-facilitated salvage indicates the conversion of hypoxanthine and guanine into IMP and GMP, respectively. Inosine and guanosine can undergo PNP-mediated catabolism and converted into hypoxanthine and guanine, respectively, and then utilized by HPRT1. IMPDH (IMP dehydrogenase); GMPS (GMP synthetase); and GMPR (GMP reductase).
L, Tracer enrichment in the blood for intravenous infusions with [15N4]-inosine. Fractional abundance of inosine (M+4) is shown for the indicated time points. Data are the mean ± s.e.m from 3–4 independent mice.
M, Fractional abundance (%) of hypoxanthine (M+4) is shown in the indicated tissues from intravenous infusion with [15N4]-inosine (5h). Data are the mean ± s.d. from n=5 independent mice
N, Purine concentration from mouse kidney (see methods). The results are presented in μmol/mg. Data are the mean ± s.d from 5 independent mice.
Data Availability Statement
Original western blot and microscopy images have been deposited at Mendeley and are publicly available as of the date of publication. DOI is listed in the key resources table.
This paper does not report original code.
Any additional information is available from the lead contact upon request.
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| ADA | Proteintech Group | 13328-1-AP |
| ADSL | Proteintech Group | 15264-1-AP |
| ADSS | Proteintech Group | 16373-1-AP |
| APRT | Abcam | ab196558 |
| Brdu | Abcam | ab8039 |
| Ki67 | Abcam | ab279653 |
| ATIC | Proteintech Group | 10726-1-AP |
| β-Actin | Sigma-Aldrich | A5316 |
| c-Myc | Cell Signaling Technology | 18583S |
| ENT1 | Santa Cruz Biotechnology | sc-377283 |
| ENT2 | Santa Cruz Biotechnology | sc-373871 |
| GART | Proteintech Group | 13659-1-AP |
| GMPS | Proteintech Group | 16376-1-AP |
| HPRT | Santa Cruz Biotechnology | sc-376938 |
| IMPDH1 | Proteintech Group | 22092-1-AP |
| IMPDH2 | Proteintech Group | 12948-1-AP |
| Nucleoside phosphorylase (PNP) | Proteintech Group | 18009-1-AP |
| PAICS | Proteintech Group | 12967-1-AP |
| PFAS | Cell Signaling Technology | 61852S |
| PPAT | Proteintech Group | 15401-1-AP |
| PRPS1 | Proteintech Group | 15549-1-AP |
| PRPS2 | Proteintech Group | 27024-1-AP |
| Vinculin | Cell Signaling Technology | 13901S |
| XDH | Proteintech Group | 5156-1-AP |
| Anti-mouse secondary antibody | Cell Signaling Technology | 7076S |
| Anti-mouse Alexa Fluor 488 antibody | Thermo Scientific | A-21202 |
| Anti-rabbit secondary antibody | Cell Signaling Technology | 7074V |
| Bacterial and virus strains | ||
| NEB Stable Competent E. coli | NEB | C3040 |
| Biological samples | ||
| Human adjacent kidney tissue | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| L-Glutamine (15N2) | Cambridge Isotope Laboratories Inc. | NLM-1328-0.25 |
| L-Glutamine (Amide-15N) | Cambridge Isotope Laboratories Inc. | NLM-557-1 |
| Adenine(15N5) | Cambridge Isotope Laboratories Inc. | NLM-6924-PK |
| Adenosine(15N5) | Cambridge Isotope Laboratories Inc. | NLM-9750-SL-10 |
| Adenosine(15N5) | BOC Sciences | N/A |
| Hypoxanthine (13C5) | Cambridge Isotope Laboratories Inc. | CLM-8042-0.01 |
| Inosine (15N4) | Cambridge Isotope Laboratories Inc. | NLM-4264-PK |
| Inosine (13C5) | Omicron Biochemicals Inc. | NUC-072 |
| Guanosine (15N5) | Cambridge Isotope Laboratories Inc. | NLM-3798-50 |
| Guanine (15N5) | Cambridge Isotope Laboratories Inc. | NLM-6925-PK |
| Adenine (3H) | PerkinElmer | NET063001MC |
| Hypoxanthine Monohydrochloride (3H) | PerkinElmer | NET177001MC |
| AMP | Sigma-Aldrich | 01930 |
| Brdu | Sigma-Aldrich | B9285-1G |
| Hoechst | Sigma-Merck | 62249 |
| GMP | Sigma-Aldrich | G8377 |
| CMP | Sigma-Aldrich | C1006 |
| UMP | Sigma-Aldrich | U6375 |
| Doxycycline HCl | Research Products International | 10592-13-9 |
| Allopurinol | Cayman Chemical Company | 10012597 |
| Azoxymethane (AOM) | Sigma-Aldrich | A5486-25MG |
| Dextran sulfate sodium salt (DSS) | MP Biomedicals | 9011-18-1 |
| AG 2037 | MedKoo Biosciences, Inc. | 202200 |
| Dipyridamole | Sigma-Aldrich | D9766 |
| Methanol Optima® LC/MS | Fisher Scientific | A456-4 |
| Polybrene®, 10 mg/mL, Liquid | Santa Cruz Biotechnology | sc-134220 |
| Puromycin dichloride | Santa Cruz Biotechnology | sc-108071A |
| PolyJet™ DNA In Vitro Transfection Reagent | SL100688 | SignaGen Laboratories |
| Glutamine-free DMEM | Gibco | 11960-044 |
| Opti-MEM media | ThermoFisher | 31985062 |
| Lipofectamine™ 3000 | Invitrogen™ | L3000015 |
| DMEM | Corning | 10-017-CV |
| MEM α, nucleosides, | Gibco | 11900-024 |
| Fetal bovine serum (FBS) | R&D Systems a biotech brand | S11150 |
| Fetal Bovine Serum dialyzed | R&D Systems a biotech brand | S12850 |
| Cultrex Basement Membrane Extract, Type 3, Pathclear | R&D Systems | 3632-010-02 |
| SuperSignal™ West Femto Chemiluminescent | Thermo Fisher Scientific | PI34096 |
| SuperSignal™ West Pico PLUS | Thermo Fisher Scientific | PI34580 |
| Microcystin-LR | Enzo Life Sciences | NC9580520 |
| Bio-Rad Bradford | Bio-Rad | 5000006 |
| Pierce™ BCA Protein Assay Kit | Thermo Fischer Scientific | 23225 |
| Protease inhibitor cocktail | Sigma-Aldrich | P8340-5ML |
| Lenti-X™ Packaging Single Shots | Takara | 631278 |
| Millicell Cell Culture Insert, 30 mm, hydrophilic PTFE, 0.4 μm | Sigma-Aldrich | PICM0RG50 |
| Heparinized Micro-Hematocrit capillary tubes | Fisherbrand | 22-362-566 |
| Critical commercial assays | ||
| SomaPlex™ Reverse Phase Protein Microarray Human Breast Tumor & Normal Tissue | Protein Biotechnologies | PMA2-001-L |
| Quick-RNA Purification Kit | Zymo Research | R1055 |
| EcoDry Premix | Takara | 639545 |
| SsoAdvanced Universal SYBR Green Supermix | Bio-Rad | 1725274 |
| Deposited Data | ||
| A study by Tran_Kim_Kesavan et al, unprocessed files | Mendeley Data | https://data.mendeley.com/preview/5jssj677my?a=c9cf0818-90fd-4eb6-909a-92ef9e01098d |
| Experimental Models: Cell Lines | ||
| Cal-51 | DSMZ | ACC 302 |
| HCT-116 | ATCC | CCL-247 |
| Renca | ATCC | CRL-2947 |
| A549 | ATCC | CCL-185 |
| 786-0 | ATCC | CRL-1932 |
| MC-38 | Kerafast | ENH204-FP |
| ΔHPRT1 Cal-51 | This study | N/A |
| ΔGART Cal-51 | This study | N/A |
| i-shHPRT1 Cal-51 (dox-inducible) | This study | N/A |
| i-shAPRT Cal-51 (dox-inducible) | This study | N/A |
| ΔHPRT1 HCT-116 | This study | N/A |
| ΔGART HCT-116 | This study | N/A |
| i-shHPRT1 HCT-116 (dox-inducible) | This study | N/A |
| Δ HPRT1 Renca+EV | This study | N/A |
| ΔHPRT1 Renca+HPRT1 | This study | N/A |
| ΔGART Renca | This study | N/A |
| ΔHPRT1 MC38+EV | This study | N/A |
| ΔHPRT1 MC38+HPRT1 | This study | N/A |
| ΔGART MC38 | This study | N/A |
| Experimental models: Organisms/strains | ||
| NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG mice) | The Jackson Laboratory | 005557 |
| NU/J, Homozygous for Foxn1<nu> (Nude mice) | The Jackson Laboratory | 002019 |
| BALB/cJ mouse strain | The Jackson Laboratory | 000651 |
| FVB/NJ mouse strain | The Jackson Laboratory | 001800 |
| LAP-MYC mouse | Laboratory of Hao Zhu (UTSW) | N/A |
| Recombinant DNA | ||
| Lenti-III-EF1α vector | ABMGood | LV043 |
| HPRT1 | OriGene | RC200462 |
| Lenti-III-human HPRT1-EF1α | This study | N/A |
| Lenti-III-mouse HPRT1-EF1α | This study | N/A |
| Lenti-III-mouse GART-PGK | This study | N/A |
| piSMART hEF1a/TurboRFP HPRT1 | Horizon (Dharmacon) | V3SH11252-230205535 |
| piSMART hEF1a/TurboRFP APRT | Horizon (Dharmacon) | V3SH11252-224780830 |
| SMARTvector Inducible non-targeting | Horizon (Dharmacon) | VSC11651 |
| HPRT1 sgRNA (human) | Santa Cruz | sc-417332 |
| PX458 | Addgene | #48138 |
| GART sgRNA (human)-PX458 | Soflaee et al., 2022 | PMID:35577785 |
| HPRT1 sgRNA (mouse)-PX458 | This study | N/A |
| GART sgRNA (mouse)-PX458 | This study | N/A |
| px333 | Addgene | 64073 |
| HPRT1 sgRNA (mouse) - px333 | This study | N/A |
| GART sgRNA (mouse) - px333 | This study | N/A |
| GAL4 sgRNA (non-targeting control)-px333 | Hao Zhu lab | N/A |
| SB100 transposase | Addgene | #34879 |
| c-myc-PT3EF1a | Addgene | #92046 |
| pT3-EF1aH N90-beta-catenin | Addgene | #86499 |
| Software and algorithms | ||
| GraphPad Prism v.9.4.1 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| ImageJ withJava 1.8.0_172 | National Institute of Health | https://imagej.nih.gov/ij/download.html |
| Profinder B.08.00 | Agilent | https://www.agilent.com/en/product/software-informatics/mass-spectrometry-software/data-analysis |
| BioRender | ©BioRender | biorender.com |
| QuPath 0.3.2 | Queen’s University, Belfast, Northern Ireland | https://qupath.github.io/ |
| Bio-Rad CFX Manager software v3.1.1517.0823 | Bio-rad | 1845000 |
| Other | ||
| 6550 iFunnel Q-TOF | Agilent | N/A |
| 6546 LC/Q-TOF | Agilent | N/A |
| SpectraMax iD3- Microplate reader | Molecular devices | N/A |
| LUNA-II™ Automated Cell Counter | LUNA-II™ | N/A |
| SpeedVac SPD2030 | Thermoscientific | Model: SPD2030-220 |
| CFX384 Touch Real-Time PCR Detection System | Bio-rad | 1855484 |
| NE-4000 Two Channel Syringe Pump | New Era Pump Systems | NE-4000 |
| Beckman LS6000LL Multi-Purpose Scintillation Counter | Beckman Coulter | LS 6500 |







